backbone Search Results


93
Addgene inc lenti
Lenti, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/pm41283329-128-12-15?v=Addgene+inc
Average 93 stars, based on 1 article reviews
lenti - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

95
Addgene inc addgene plasmid
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/pmc09457169__pnas__2204725119__sapp-82-6-6?v=Addgene+inc
Average 95 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

95
Addgene inc cas13
Cas13, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/pmc08318370-288-57-58?v=Addgene+inc
Average 95 stars, based on 1 article reviews
cas13 - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
Addgene inc accggtacactttgcaaacaa ga 30 n a n a tracrrna integrated dna technologies cat
Accggtacactttgcaaacaa Ga 30 N A N A Tracrrna Integrated Dna Technologies Cat, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/pm33400922-180-89-124?v=Addgene+inc
Average 93 stars, based on 1 article reviews
accggtacactttgcaaacaa ga 30 n a n a tracrrna integrated dna technologies cat - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

95
Addgene inc plasmid backbone
Plasmid Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/bio_rxiv__64898__2026__01__01__697310-189-11-24?v=Addgene+inc
Average 95 stars, based on 1 article reviews
plasmid backbone - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
Addgene inc grna expressing plasmid
Grna Expressing Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/us12383566-1062-20-24?v=Addgene+inc
Average 93 stars, based on 1 article reviews
grna expressing plasmid - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

95
Addgene inc pxr003 casrx grna
Pxr003 Casrx Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/pmc11262032__mjae002_supplemental_file-22-8-9?v=Addgene+inc
Average 95 stars, based on 1 article reviews
pxr003 casrx grna - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
Addgene inc sgrnas была подарена alberto ciccia
Sgrnas была подарена Alberto Ciccia, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/10__25557_slash_2073___7998__2023__11__20___26-78-36-41?v=Addgene+inc
Average 93 stars, based on 1 article reviews
sgrnas была подарена alberto ciccia - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Addgene inc diversity barcode libraries
a. Lentiviral construct design. A PGK promoter drives expression of a transcript encoding zsGreen harbouring a WILD-seq <t>barcode</t> sequence in the 3’UTR. A spacer sequence and polyadenylation signal ensure that that the barcode is detectable as part of a standard oligo dT single cell RNA library preparation and sequencing pipeline. The barcode cassette comprises 2 distinct 12 nucleotide barcode sequences separated by a constant 20 nucleotide linker region. The library of barcode sequences was designed with Hamming distance 5 to allow for sequencing error correction. b. Schematic of WILD-seq method. Tumour cells are infected with the WILD-seq lentiviral library and an appropriate size population of zsGreen positive cells isolated, each of which will express a single unique WILD-seq barcode. This WILD-seq barcoded, heterogenous cell pool is then subjected to an intervention of interest (such as in vivo treatment of the implanted pool with a therapeutic agent) and subsequently analysed by single cell RNA sequencing using the 10X Genomics platform. An additional PCR amplification step is included that specifically enriches for the barcode sequence to increase the number of cells to which a WILD-seq barcode can be conclusively assigned. c. scRNA-seq of in vitro 4T1 WILD-seq cell pool. UMAP plot of in vitro cultured 4T1 WILD-seq cells. Cells for which a WILD-seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to five selected clonal lineages are highlighted. d. scRNA-seq of 4T1 WILD-seq tumours. UMAP plots of vehicle-treated 4T1 WILD-seq tumours generated by injecting the 4T1 WILD-seq pool into the mammary fatpad of BALB/c mice. Four independent experiments were performed each involving injection into 3 separate host animals. Six animals from experiments A and B received vehicle 1 (10% DMSO, 0.9%β- cyclodextrin) and six animals from experiments C and D received vehicle 2 (12.5%ethanol, 12.5% Kolliphor). e. Clonal representation. Proportion of tumour cells assigned to each clonal lineage based on the WILD-seq barcode (n = 1 for in vitro cultured cells, n = 6 for tumours from NSG mice, n = 12 for vehicle-treated tumours from BALB/c mice). Selected clones from the most abundant lineages are plotted. Data represents mean ± SEM. f. Principal component analysis of clonal transcriptomes. Pseudo-bulk analysis was performed by summing counts for all tumour cells expressing the same WILD-seq clonal barcode within an independent experiment. For in vivo tumour samples each point represents the combined cells from 3 animals. Principal component analysis of normalized pseudo-bulk count data showed separation of samples by origin with PC1 and PC2 and separation by clonality with PC3. g. Transcriptomic programs associated with principal components. The top/bottom 50 gene loadings of PC1, PC2 and PC3 were analysed using Enrichr – . h. Clonal transcriptomic signatures from vehicle-treated BALB/c tumours. An AUCell score enrichment was calculated for each clone and for each experiment by comparing cells of a specific clonal lineage of interest to all assigned tumour cells within the same experiment. All gene sets which showed consistent and statistically significant enrichment in one of the six most abundant clones across experiments are illustrated.
Diversity Barcode Libraries, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/bio_rxiv__2021__12__09__471927-182-30-44?v=Addgene+inc
Average 93 stars, based on 1 article reviews
diversity barcode libraries - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Addgene inc aav sgrna plasmid
a. Lentiviral construct design. A PGK promoter drives expression of a transcript encoding zsGreen harbouring a WILD-seq <t>barcode</t> sequence in the 3’UTR. A spacer sequence and polyadenylation signal ensure that that the barcode is detectable as part of a standard oligo dT single cell RNA library preparation and sequencing pipeline. The barcode cassette comprises 2 distinct 12 nucleotide barcode sequences separated by a constant 20 nucleotide linker region. The library of barcode sequences was designed with Hamming distance 5 to allow for sequencing error correction. b. Schematic of WILD-seq method. Tumour cells are infected with the WILD-seq lentiviral library and an appropriate size population of zsGreen positive cells isolated, each of which will express a single unique WILD-seq barcode. This WILD-seq barcoded, heterogenous cell pool is then subjected to an intervention of interest (such as in vivo treatment of the implanted pool with a therapeutic agent) and subsequently analysed by single cell RNA sequencing using the 10X Genomics platform. An additional PCR amplification step is included that specifically enriches for the barcode sequence to increase the number of cells to which a WILD-seq barcode can be conclusively assigned. c. scRNA-seq of in vitro 4T1 WILD-seq cell pool. UMAP plot of in vitro cultured 4T1 WILD-seq cells. Cells for which a WILD-seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to five selected clonal lineages are highlighted. d. scRNA-seq of 4T1 WILD-seq tumours. UMAP plots of vehicle-treated 4T1 WILD-seq tumours generated by injecting the 4T1 WILD-seq pool into the mammary fatpad of BALB/c mice. Four independent experiments were performed each involving injection into 3 separate host animals. Six animals from experiments A and B received vehicle 1 (10% DMSO, 0.9%β- cyclodextrin) and six animals from experiments C and D received vehicle 2 (12.5%ethanol, 12.5% Kolliphor). e. Clonal representation. Proportion of tumour cells assigned to each clonal lineage based on the WILD-seq barcode (n = 1 for in vitro cultured cells, n = 6 for tumours from NSG mice, n = 12 for vehicle-treated tumours from BALB/c mice). Selected clones from the most abundant lineages are plotted. Data represents mean ± SEM. f. Principal component analysis of clonal transcriptomes. Pseudo-bulk analysis was performed by summing counts for all tumour cells expressing the same WILD-seq clonal barcode within an independent experiment. For in vivo tumour samples each point represents the combined cells from 3 animals. Principal component analysis of normalized pseudo-bulk count data showed separation of samples by origin with PC1 and PC2 and separation by clonality with PC3. g. Transcriptomic programs associated with principal components. The top/bottom 50 gene loadings of PC1, PC2 and PC3 were analysed using Enrichr – . h. Clonal transcriptomic signatures from vehicle-treated BALB/c tumours. An AUCell score enrichment was calculated for each clone and for each experiment by comparing cells of a specific clonal lineage of interest to all assigned tumour cells within the same experiment. All gene sets which showed consistent and statistically significant enrichment in one of the six most abundant clones across experiments are illustrated.
Aav Sgrna Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/pmc12824223-514-10-15?v=Addgene+inc
Average 93 stars, based on 1 article reviews
aav sgrna plasmid - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

94
Addgene inc aav itr u6 621 sgrna backbone pcbh cre wpre hghpa itr
a. Lentiviral construct design. A PGK promoter drives expression of a transcript encoding zsGreen harbouring a WILD-seq <t>barcode</t> sequence in the 3’UTR. A spacer sequence and polyadenylation signal ensure that that the barcode is detectable as part of a standard oligo dT single cell RNA library preparation and sequencing pipeline. The barcode cassette comprises 2 distinct 12 nucleotide barcode sequences separated by a constant 20 nucleotide linker region. The library of barcode sequences was designed with Hamming distance 5 to allow for sequencing error correction. b. Schematic of WILD-seq method. Tumour cells are infected with the WILD-seq lentiviral library and an appropriate size population of zsGreen positive cells isolated, each of which will express a single unique WILD-seq barcode. This WILD-seq barcoded, heterogenous cell pool is then subjected to an intervention of interest (such as in vivo treatment of the implanted pool with a therapeutic agent) and subsequently analysed by single cell RNA sequencing using the 10X Genomics platform. An additional PCR amplification step is included that specifically enriches for the barcode sequence to increase the number of cells to which a WILD-seq barcode can be conclusively assigned. c. scRNA-seq of in vitro 4T1 WILD-seq cell pool. UMAP plot of in vitro cultured 4T1 WILD-seq cells. Cells for which a WILD-seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to five selected clonal lineages are highlighted. d. scRNA-seq of 4T1 WILD-seq tumours. UMAP plots of vehicle-treated 4T1 WILD-seq tumours generated by injecting the 4T1 WILD-seq pool into the mammary fatpad of BALB/c mice. Four independent experiments were performed each involving injection into 3 separate host animals. Six animals from experiments A and B received vehicle 1 (10% DMSO, 0.9%β- cyclodextrin) and six animals from experiments C and D received vehicle 2 (12.5%ethanol, 12.5% Kolliphor). e. Clonal representation. Proportion of tumour cells assigned to each clonal lineage based on the WILD-seq barcode (n = 1 for in vitro cultured cells, n = 6 for tumours from NSG mice, n = 12 for vehicle-treated tumours from BALB/c mice). Selected clones from the most abundant lineages are plotted. Data represents mean ± SEM. f. Principal component analysis of clonal transcriptomes. Pseudo-bulk analysis was performed by summing counts for all tumour cells expressing the same WILD-seq clonal barcode within an independent experiment. For in vivo tumour samples each point represents the combined cells from 3 animals. Principal component analysis of normalized pseudo-bulk count data showed separation of samples by origin with PC1 and PC2 and separation by clonality with PC3. g. Transcriptomic programs associated with principal components. The top/bottom 50 gene loadings of PC1, PC2 and PC3 were analysed using Enrichr – . h. Clonal transcriptomic signatures from vehicle-treated BALB/c tumours. An AUCell score enrichment was calculated for each clone and for each experiment by comparing cells of a specific clonal lineage of interest to all assigned tumour cells within the same experiment. All gene sets which showed consistent and statistically significant enrichment in one of the six most abundant clones across experiments are illustrated.
Aav Itr U6 621 Sgrna Backbone Pcbh Cre Wpre Hghpa Itr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/10__1016_slash_j__isci__2026__115554-312-33-35?v=Addgene+inc
Average 94 stars, based on 1 article reviews
aav itr u6 621 sgrna backbone pcbh cre wpre hghpa itr - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

91
Addgene inc hla a
a. Lentiviral construct design. A PGK promoter drives expression of a transcript encoding zsGreen harbouring a WILD-seq <t>barcode</t> sequence in the 3’UTR. A spacer sequence and polyadenylation signal ensure that that the barcode is detectable as part of a standard oligo dT single cell RNA library preparation and sequencing pipeline. The barcode cassette comprises 2 distinct 12 nucleotide barcode sequences separated by a constant 20 nucleotide linker region. The library of barcode sequences was designed with Hamming distance 5 to allow for sequencing error correction. b. Schematic of WILD-seq method. Tumour cells are infected with the WILD-seq lentiviral library and an appropriate size population of zsGreen positive cells isolated, each of which will express a single unique WILD-seq barcode. This WILD-seq barcoded, heterogenous cell pool is then subjected to an intervention of interest (such as in vivo treatment of the implanted pool with a therapeutic agent) and subsequently analysed by single cell RNA sequencing using the 10X Genomics platform. An additional PCR amplification step is included that specifically enriches for the barcode sequence to increase the number of cells to which a WILD-seq barcode can be conclusively assigned. c. scRNA-seq of in vitro 4T1 WILD-seq cell pool. UMAP plot of in vitro cultured 4T1 WILD-seq cells. Cells for which a WILD-seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to five selected clonal lineages are highlighted. d. scRNA-seq of 4T1 WILD-seq tumours. UMAP plots of vehicle-treated 4T1 WILD-seq tumours generated by injecting the 4T1 WILD-seq pool into the mammary fatpad of BALB/c mice. Four independent experiments were performed each involving injection into 3 separate host animals. Six animals from experiments A and B received vehicle 1 (10% DMSO, 0.9%β- cyclodextrin) and six animals from experiments C and D received vehicle 2 (12.5%ethanol, 12.5% Kolliphor). e. Clonal representation. Proportion of tumour cells assigned to each clonal lineage based on the WILD-seq barcode (n = 1 for in vitro cultured cells, n = 6 for tumours from NSG mice, n = 12 for vehicle-treated tumours from BALB/c mice). Selected clones from the most abundant lineages are plotted. Data represents mean ± SEM. f. Principal component analysis of clonal transcriptomes. Pseudo-bulk analysis was performed by summing counts for all tumour cells expressing the same WILD-seq clonal barcode within an independent experiment. For in vivo tumour samples each point represents the combined cells from 3 animals. Principal component analysis of normalized pseudo-bulk count data showed separation of samples by origin with PC1 and PC2 and separation by clonality with PC3. g. Transcriptomic programs associated with principal components. The top/bottom 50 gene loadings of PC1, PC2 and PC3 were analysed using Enrichr – . h. Clonal transcriptomic signatures from vehicle-treated BALB/c tumours. An AUCell score enrichment was calculated for each clone and for each experiment by comparing cells of a specific clonal lineage of interest to all assigned tumour cells within the same experiment. All gene sets which showed consistent and statistically significant enrichment in one of the six most abundant clones across experiments are illustrated.
Hla A, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/backbone/pmc06755906__NIHMS1516810___supplement___4-21-3-25?v=Addgene+inc
Average 91 stars, based on 1 article reviews
hla a - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

Image Search Results


a. Lentiviral construct design. A PGK promoter drives expression of a transcript encoding zsGreen harbouring a WILD-seq barcode sequence in the 3’UTR. A spacer sequence and polyadenylation signal ensure that that the barcode is detectable as part of a standard oligo dT single cell RNA library preparation and sequencing pipeline. The barcode cassette comprises 2 distinct 12 nucleotide barcode sequences separated by a constant 20 nucleotide linker region. The library of barcode sequences was designed with Hamming distance 5 to allow for sequencing error correction. b. Schematic of WILD-seq method. Tumour cells are infected with the WILD-seq lentiviral library and an appropriate size population of zsGreen positive cells isolated, each of which will express a single unique WILD-seq barcode. This WILD-seq barcoded, heterogenous cell pool is then subjected to an intervention of interest (such as in vivo treatment of the implanted pool with a therapeutic agent) and subsequently analysed by single cell RNA sequencing using the 10X Genomics platform. An additional PCR amplification step is included that specifically enriches for the barcode sequence to increase the number of cells to which a WILD-seq barcode can be conclusively assigned. c. scRNA-seq of in vitro 4T1 WILD-seq cell pool. UMAP plot of in vitro cultured 4T1 WILD-seq cells. Cells for which a WILD-seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to five selected clonal lineages are highlighted. d. scRNA-seq of 4T1 WILD-seq tumours. UMAP plots of vehicle-treated 4T1 WILD-seq tumours generated by injecting the 4T1 WILD-seq pool into the mammary fatpad of BALB/c mice. Four independent experiments were performed each involving injection into 3 separate host animals. Six animals from experiments A and B received vehicle 1 (10% DMSO, 0.9%β- cyclodextrin) and six animals from experiments C and D received vehicle 2 (12.5%ethanol, 12.5% Kolliphor). e. Clonal representation. Proportion of tumour cells assigned to each clonal lineage based on the WILD-seq barcode (n = 1 for in vitro cultured cells, n = 6 for tumours from NSG mice, n = 12 for vehicle-treated tumours from BALB/c mice). Selected clones from the most abundant lineages are plotted. Data represents mean ± SEM. f. Principal component analysis of clonal transcriptomes. Pseudo-bulk analysis was performed by summing counts for all tumour cells expressing the same WILD-seq clonal barcode within an independent experiment. For in vivo tumour samples each point represents the combined cells from 3 animals. Principal component analysis of normalized pseudo-bulk count data showed separation of samples by origin with PC1 and PC2 and separation by clonality with PC3. g. Transcriptomic programs associated with principal components. The top/bottom 50 gene loadings of PC1, PC2 and PC3 were analysed using Enrichr – . h. Clonal transcriptomic signatures from vehicle-treated BALB/c tumours. An AUCell score enrichment was calculated for each clone and for each experiment by comparing cells of a specific clonal lineage of interest to all assigned tumour cells within the same experiment. All gene sets which showed consistent and statistically significant enrichment in one of the six most abundant clones across experiments are illustrated.

Journal: bioRxiv

Article Title: WILD-seq: Clonal deconvolution of transcriptomic signatures of sensitivity and resistance to cancer therapeutics in vivo

doi: 10.1101/2021.12.09.471927

Figure Lengend Snippet: a. Lentiviral construct design. A PGK promoter drives expression of a transcript encoding zsGreen harbouring a WILD-seq barcode sequence in the 3’UTR. A spacer sequence and polyadenylation signal ensure that that the barcode is detectable as part of a standard oligo dT single cell RNA library preparation and sequencing pipeline. The barcode cassette comprises 2 distinct 12 nucleotide barcode sequences separated by a constant 20 nucleotide linker region. The library of barcode sequences was designed with Hamming distance 5 to allow for sequencing error correction. b. Schematic of WILD-seq method. Tumour cells are infected with the WILD-seq lentiviral library and an appropriate size population of zsGreen positive cells isolated, each of which will express a single unique WILD-seq barcode. This WILD-seq barcoded, heterogenous cell pool is then subjected to an intervention of interest (such as in vivo treatment of the implanted pool with a therapeutic agent) and subsequently analysed by single cell RNA sequencing using the 10X Genomics platform. An additional PCR amplification step is included that specifically enriches for the barcode sequence to increase the number of cells to which a WILD-seq barcode can be conclusively assigned. c. scRNA-seq of in vitro 4T1 WILD-seq cell pool. UMAP plot of in vitro cultured 4T1 WILD-seq cells. Cells for which a WILD-seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to five selected clonal lineages are highlighted. d. scRNA-seq of 4T1 WILD-seq tumours. UMAP plots of vehicle-treated 4T1 WILD-seq tumours generated by injecting the 4T1 WILD-seq pool into the mammary fatpad of BALB/c mice. Four independent experiments were performed each involving injection into 3 separate host animals. Six animals from experiments A and B received vehicle 1 (10% DMSO, 0.9%β- cyclodextrin) and six animals from experiments C and D received vehicle 2 (12.5%ethanol, 12.5% Kolliphor). e. Clonal representation. Proportion of tumour cells assigned to each clonal lineage based on the WILD-seq barcode (n = 1 for in vitro cultured cells, n = 6 for tumours from NSG mice, n = 12 for vehicle-treated tumours from BALB/c mice). Selected clones from the most abundant lineages are plotted. Data represents mean ± SEM. f. Principal component analysis of clonal transcriptomes. Pseudo-bulk analysis was performed by summing counts for all tumour cells expressing the same WILD-seq clonal barcode within an independent experiment. For in vivo tumour samples each point represents the combined cells from 3 animals. Principal component analysis of normalized pseudo-bulk count data showed separation of samples by origin with PC1 and PC2 and separation by clonality with PC3. g. Transcriptomic programs associated with principal components. The top/bottom 50 gene loadings of PC1, PC2 and PC3 were analysed using Enrichr – . h. Clonal transcriptomic signatures from vehicle-treated BALB/c tumours. An AUCell score enrichment was calculated for each clone and for each experiment by comparing cells of a specific clonal lineage of interest to all assigned tumour cells within the same experiment. All gene sets which showed consistent and statistically significant enrichment in one of the six most abundant clones across experiments are illustrated.

Article Snippet: The pHSW8 lentiviral backbone was constructed using a four-way Gibson Assembly (NEB) by inserting a reverse expression cassette, consisting of a PGK promoter, the zsGreen ORF, a cloning site for high-diversity barcode libraries and a synthetic polyA signal, into an empty pCCL-c-MNDU3-X backbone (#81071 Addgene).

Techniques: Construct, Expressing, Sequencing, RNA Library Preparation, Infection, Isolation, In Vivo, RNA Sequencing, Amplification, In Vitro, Cell Culture, Generated, Injection, Clone Assay

4T1 WILD-seq tumours were treated with the BET bromodomain inhibitor JQ1 or vehicle from 7 days post-implantation until endpoint (n = 4 mice per condition). Data represents mean ± SEM. b. scRNA-seq of JQ1-treated 4T1 WILD-seq tumours. UMAP plots of vehicle- or JQ1-treated 4T1 WILD-seq tumours. Combined cells from 2 independent experiments, each with 3 mice per condition are shown. Cells for which a WILD-seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to four selected clonal lineages are highlighted. c. JQ1-treatment results in a reduction in Cd8+ tumour-associated T-cells. Cells belonging to the T- cell compartment were computationally extracted from the single cell data and reclustered. Upper panels show combined UMAP plots from experiments A and B with Cd8a expression per cell illustrated enabling identification of the Cd8+ T cell cluster. Lower panels show neighborhood graphs of the results from differential abundance testing using Milo . Coloured nodes represent neighbourhoods with significantly different cell numbers between conditions (FDR < 0.05) and the layout of nodes is determined by the position of the neighborhood index cell in the UMAP panel above. Experiments A and B were analysed separately due to differences in cell numbers. d. Differential gene expression between JQ1- and vehicle-treated tumour cells. Single cell heatmap of expression for genes which are significantly and consistently down-regulated across clonal lineages (combined fisher p-value < 0.05 and mean logFC < −0.2 for both experiments).1600 cells are represented (400 per experiment/condition), grouped according to their clonal lineage. e. Differential gene set expression between JQ1 and vehicle-treated tumour cells. Median AUCell score per experiment/condition for selected gene sets. The 5 clonal lineages with the highest representation across experiments are shown. f. Clonal representation. Proportion of tumour cells assigned to each clonal lineage in experiment A based on the WILD-seq barcode (n = 3 tumours per condition). Clones which make up at least 2% of the assigned tumour cells under at least one condition are plotted. The most sensitive clone 473 is highlighted in blue and the most resistant clones 93, 439, 264 are highlighted in red. Data represents mean ± SEM. g. Clonal response to JQ1-treatment. Log 2 fold change in clonal proportions upon JQ1 treatment across experiments A and B. Fold change was calculated by comparing each JQ1- treated sample with the mean of the 3 corresponding vehicle-treated samples from the same experiment. p-value calculated by one-sample t-test vs a theoretical mean of 0. Data represents mean ± SEM. h. and i. Correlation of JQ1-response with baseline clonal transcriptomic signatures. Clonal gene set enrichment scores for vehicle-treated tumours were calculated by comparing cells of a specific clonal lineage of interest to all assigned tumour cells within the same experiment. Correlation between these scores and JQ1-treatment response (mean log 2 fold change clonal proportion JQ1 vs vehicle) was then calculated for each gene set. Selected gene sets with the highest positive or negative correlation values (Pearson correlation test) are shown. A positive correlation indicates a higher expression in resistant clones, whereas a negative correlation indicates a higher expression in sensitive clones. Resistant clonal lineages identified by barcodes 93, 264 and 439 were combined for the purpose of this analysis to have enough cells for analysis within the vehicle-treated samples.

Journal: bioRxiv

Article Title: WILD-seq: Clonal deconvolution of transcriptomic signatures of sensitivity and resistance to cancer therapeutics in vivo

doi: 10.1101/2021.12.09.471927

Figure Lengend Snippet: 4T1 WILD-seq tumours were treated with the BET bromodomain inhibitor JQ1 or vehicle from 7 days post-implantation until endpoint (n = 4 mice per condition). Data represents mean ± SEM. b. scRNA-seq of JQ1-treated 4T1 WILD-seq tumours. UMAP plots of vehicle- or JQ1-treated 4T1 WILD-seq tumours. Combined cells from 2 independent experiments, each with 3 mice per condition are shown. Cells for which a WILD-seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to four selected clonal lineages are highlighted. c. JQ1-treatment results in a reduction in Cd8+ tumour-associated T-cells. Cells belonging to the T- cell compartment were computationally extracted from the single cell data and reclustered. Upper panels show combined UMAP plots from experiments A and B with Cd8a expression per cell illustrated enabling identification of the Cd8+ T cell cluster. Lower panels show neighborhood graphs of the results from differential abundance testing using Milo . Coloured nodes represent neighbourhoods with significantly different cell numbers between conditions (FDR < 0.05) and the layout of nodes is determined by the position of the neighborhood index cell in the UMAP panel above. Experiments A and B were analysed separately due to differences in cell numbers. d. Differential gene expression between JQ1- and vehicle-treated tumour cells. Single cell heatmap of expression for genes which are significantly and consistently down-regulated across clonal lineages (combined fisher p-value < 0.05 and mean logFC < −0.2 for both experiments).1600 cells are represented (400 per experiment/condition), grouped according to their clonal lineage. e. Differential gene set expression between JQ1 and vehicle-treated tumour cells. Median AUCell score per experiment/condition for selected gene sets. The 5 clonal lineages with the highest representation across experiments are shown. f. Clonal representation. Proportion of tumour cells assigned to each clonal lineage in experiment A based on the WILD-seq barcode (n = 3 tumours per condition). Clones which make up at least 2% of the assigned tumour cells under at least one condition are plotted. The most sensitive clone 473 is highlighted in blue and the most resistant clones 93, 439, 264 are highlighted in red. Data represents mean ± SEM. g. Clonal response to JQ1-treatment. Log 2 fold change in clonal proportions upon JQ1 treatment across experiments A and B. Fold change was calculated by comparing each JQ1- treated sample with the mean of the 3 corresponding vehicle-treated samples from the same experiment. p-value calculated by one-sample t-test vs a theoretical mean of 0. Data represents mean ± SEM. h. and i. Correlation of JQ1-response with baseline clonal transcriptomic signatures. Clonal gene set enrichment scores for vehicle-treated tumours were calculated by comparing cells of a specific clonal lineage of interest to all assigned tumour cells within the same experiment. Correlation between these scores and JQ1-treatment response (mean log 2 fold change clonal proportion JQ1 vs vehicle) was then calculated for each gene set. Selected gene sets with the highest positive or negative correlation values (Pearson correlation test) are shown. A positive correlation indicates a higher expression in resistant clones, whereas a negative correlation indicates a higher expression in sensitive clones. Resistant clonal lineages identified by barcodes 93, 264 and 439 were combined for the purpose of this analysis to have enough cells for analysis within the vehicle-treated samples.

Article Snippet: The pHSW8 lentiviral backbone was constructed using a four-way Gibson Assembly (NEB) by inserting a reverse expression cassette, consisting of a PGK promoter, the zsGreen ORF, a cloning site for high-diversity barcode libraries and a synthetic polyA signal, into an empty pCCL-c-MNDU3-X backbone (#81071 Addgene).

Techniques: Expressing, Gene Expression, Clone Assay

a. Tumour growth curves with docetaxel treatment. 4T1 WILD-seq tumours were treated with docetaxel or vehicle (12.5% ethanol, 12.5% Kolliphor) from 7 days post-implantation for 2 weeks (n = 5 mice per condition). Dosing regimen was 12.5 mg/Kg docetaxel three times per week. Data represents mean ± SEM. b. scRNA-seq of docetaxel-treated 4T1 WILD- seq tumours. UMAP plots of vehicle- or docetaxel-treated 4T1 WILD-seq tumours. Combined cells from 2 independent experiments, each with 3 mice per condition are shown. Cells for which a WILD- seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to three selected clonal lineages are highlighted. c. Clonal representation. Proportion of tumour cells assigned to each clonal lineage in experiment C based on the WILD-seq barcode (n = 3 tumours per condition). Clones which make up at least 2% of the assigned tumour cells under at least one condition are plotted. The most sensitive clone 238 is highlighted in blue and the most resistant clone 679 is highlighted in red. Data represents mean ± SEM. d. Clonal response to docetaxel-treatment. Log 2 fold change in clonal proportions upon docetaxel treatment across experiments C and D. Fold change was calculated by comparing each docetaxel-treated sample with the mean of the 3 corresponding vehicle-treated samples from the same experiment. p-values calculated by one-sample t-test vs a theoretical mean of 0. Data represents mean ± SEM. e. and f. Correlation of docetaxel-response with baseline clonal transcriptomic signatures. Clonal gene set enrichment scores for vehicle-treated tumours were calculated by comparing cells of a specific clonal lineage of interest to all assigned tumour cells within the same experiment. Correlation between these scores and docetaxel-treatment response (mean log 2 fold change clonal proportion docetaxel vs vehicle) was then calculated for each gene set. Selected gene sets with the highest positive or negative correlation values (Pearson correlation test) are shown. A positive correlation indicates a higher expression in resistant clones, whereas a negative correlation indicates a higher expression in sensitive clones.

Journal: bioRxiv

Article Title: WILD-seq: Clonal deconvolution of transcriptomic signatures of sensitivity and resistance to cancer therapeutics in vivo

doi: 10.1101/2021.12.09.471927

Figure Lengend Snippet: a. Tumour growth curves with docetaxel treatment. 4T1 WILD-seq tumours were treated with docetaxel or vehicle (12.5% ethanol, 12.5% Kolliphor) from 7 days post-implantation for 2 weeks (n = 5 mice per condition). Dosing regimen was 12.5 mg/Kg docetaxel three times per week. Data represents mean ± SEM. b. scRNA-seq of docetaxel-treated 4T1 WILD- seq tumours. UMAP plots of vehicle- or docetaxel-treated 4T1 WILD-seq tumours. Combined cells from 2 independent experiments, each with 3 mice per condition are shown. Cells for which a WILD- seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to three selected clonal lineages are highlighted. c. Clonal representation. Proportion of tumour cells assigned to each clonal lineage in experiment C based on the WILD-seq barcode (n = 3 tumours per condition). Clones which make up at least 2% of the assigned tumour cells under at least one condition are plotted. The most sensitive clone 238 is highlighted in blue and the most resistant clone 679 is highlighted in red. Data represents mean ± SEM. d. Clonal response to docetaxel-treatment. Log 2 fold change in clonal proportions upon docetaxel treatment across experiments C and D. Fold change was calculated by comparing each docetaxel-treated sample with the mean of the 3 corresponding vehicle-treated samples from the same experiment. p-values calculated by one-sample t-test vs a theoretical mean of 0. Data represents mean ± SEM. e. and f. Correlation of docetaxel-response with baseline clonal transcriptomic signatures. Clonal gene set enrichment scores for vehicle-treated tumours were calculated by comparing cells of a specific clonal lineage of interest to all assigned tumour cells within the same experiment. Correlation between these scores and docetaxel-treatment response (mean log 2 fold change clonal proportion docetaxel vs vehicle) was then calculated for each gene set. Selected gene sets with the highest positive or negative correlation values (Pearson correlation test) are shown. A positive correlation indicates a higher expression in resistant clones, whereas a negative correlation indicates a higher expression in sensitive clones.

Article Snippet: The pHSW8 lentiviral backbone was constructed using a four-way Gibson Assembly (NEB) by inserting a reverse expression cassette, consisting of a PGK promoter, the zsGreen ORF, a cloning site for high-diversity barcode libraries and a synthetic polyA signal, into an empty pCCL-c-MNDU3-X backbone (#81071 Addgene).

Techniques: Clone Assay, Expressing

a. D2A1 WILD-seq tumour growth curves with docetaxel treatment. D2A1 WILD-seq tumours were treated with docetaxel or vehicle from 7 days post-implantation for 2 weeks (n = 5 vehicle-treated mice, n = 4 docetaxel-treated mice). Data represents mean ± SEM. b. scRNA-seq of docetaxel-treated D2A1 WILD-seq tumours. UMAP plots of vehicle-treated D2A1 WILD-seq D2A1 tumours and reclustered barcoded-tumour cells from vehicle- and docetaxel-treated tumours. Combined cells from 3 mice per condition are shown. Cells for which a WILD-seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to five selected clonal lineages are highlighted. c. Comparison of EMT status of major 4T1 and D2A1 WILD-seq clones. Violin plot of AUCell scores from vehicle-treated tumour cells generated using the HOLLERN_EMT_BREAST_TUMOR_DN gene set, a set of genes that have low expression in murine mammary tumours of mesenchymal histology. 4T1 WILD-seq clones exhibit varying levels of expression of this geneset whereas D2A1 WILD-seq clones have consistently low levels of expression of these genes. d. Clonal representation. Proportion of tumour cells assigned to each clonal lineage based on the WILD-seq barcode (n = 3 tumours per condition). Clones which make up at least 2% of the assigned tumour cells under at least one condition are plotted. The most sensitive clones to docetaxel treatment 118, 2874 and 1072 are highlighted in blue and the most resistant clones 1240, 1197 and 751 are highlighted in red. Data represents mean ± SEM. e. Clonal transcriptomic signatures from vehicle-treated tumours. Heatmap of median AUCell scores per sample for each of the five most abundant clones. All gene sets which showed consistent and statistically significant enrichment (combined fisher p-value < 0.01 & mean log 2 enrichment > 0.1) in at least one of these clones are illustrated. f. Selected gene sets whose expression is associated with sensitivity to docetaxel. Median AUCell scores per sample for each of the five most abundant clones is plotted. g. Transcriptomic signatures associated with resistance to docetaxel. For vehicle-treated tumours, resistant clonal lineages identified by barcodes 1197, 751 and 1240 were combined to have enough cells for analysis. Gene sets with significantly enriched expression in these resistant clones in vehicle-treated tumours were determined (adjusted p-value < 0.01 & log 2 enrichment > 0.1). A heatmap of median AUCell scores per clone, per condition of these resistance-associated gene sets is plotted. h. Selected gene sets whose expression is enriched or depleted in resistant clones. Median AUCell scores per clone, per sample are plotted for samples with at least 20 cells per clone. Due to changes in clonal abundance with treatment some clones can only be assessed under vehicle- or docetaxel- treated conditions.

Journal: bioRxiv

Article Title: WILD-seq: Clonal deconvolution of transcriptomic signatures of sensitivity and resistance to cancer therapeutics in vivo

doi: 10.1101/2021.12.09.471927

Figure Lengend Snippet: a. D2A1 WILD-seq tumour growth curves with docetaxel treatment. D2A1 WILD-seq tumours were treated with docetaxel or vehicle from 7 days post-implantation for 2 weeks (n = 5 vehicle-treated mice, n = 4 docetaxel-treated mice). Data represents mean ± SEM. b. scRNA-seq of docetaxel-treated D2A1 WILD-seq tumours. UMAP plots of vehicle-treated D2A1 WILD-seq D2A1 tumours and reclustered barcoded-tumour cells from vehicle- and docetaxel-treated tumours. Combined cells from 3 mice per condition are shown. Cells for which a WILD-seq clonal barcode is identified are shown as dark grey or coloured spots. Cells which belong to five selected clonal lineages are highlighted. c. Comparison of EMT status of major 4T1 and D2A1 WILD-seq clones. Violin plot of AUCell scores from vehicle-treated tumour cells generated using the HOLLERN_EMT_BREAST_TUMOR_DN gene set, a set of genes that have low expression in murine mammary tumours of mesenchymal histology. 4T1 WILD-seq clones exhibit varying levels of expression of this geneset whereas D2A1 WILD-seq clones have consistently low levels of expression of these genes. d. Clonal representation. Proportion of tumour cells assigned to each clonal lineage based on the WILD-seq barcode (n = 3 tumours per condition). Clones which make up at least 2% of the assigned tumour cells under at least one condition are plotted. The most sensitive clones to docetaxel treatment 118, 2874 and 1072 are highlighted in blue and the most resistant clones 1240, 1197 and 751 are highlighted in red. Data represents mean ± SEM. e. Clonal transcriptomic signatures from vehicle-treated tumours. Heatmap of median AUCell scores per sample for each of the five most abundant clones. All gene sets which showed consistent and statistically significant enrichment (combined fisher p-value < 0.01 & mean log 2 enrichment > 0.1) in at least one of these clones are illustrated. f. Selected gene sets whose expression is associated with sensitivity to docetaxel. Median AUCell scores per sample for each of the five most abundant clones is plotted. g. Transcriptomic signatures associated with resistance to docetaxel. For vehicle-treated tumours, resistant clonal lineages identified by barcodes 1197, 751 and 1240 were combined to have enough cells for analysis. Gene sets with significantly enriched expression in these resistant clones in vehicle-treated tumours were determined (adjusted p-value < 0.01 & log 2 enrichment > 0.1). A heatmap of median AUCell scores per clone, per condition of these resistance-associated gene sets is plotted. h. Selected gene sets whose expression is enriched or depleted in resistant clones. Median AUCell scores per clone, per sample are plotted for samples with at least 20 cells per clone. Due to changes in clonal abundance with treatment some clones can only be assessed under vehicle- or docetaxel- treated conditions.

Article Snippet: The pHSW8 lentiviral backbone was constructed using a four-way Gibson Assembly (NEB) by inserting a reverse expression cassette, consisting of a PGK promoter, the zsGreen ORF, a cloning site for high-diversity barcode libraries and a synthetic polyA signal, into an empty pCCL-c-MNDU3-X backbone (#81071 Addgene).

Techniques: Comparison, Clone Assay, Generated, Expressing