Journal: Journal of Biological Chemistry

Article Title: ATP-binding Cassette Transporter A1 Mediates the Beneficial Effects of the Liver X Receptor Agonist GW3965 on Object Recognition Memory and Amyloid Burden in Amyloid Precursor Protein/Presenilin 1 Mice*

doi: 10.1074/jbc.m110.108100

Figure Lengend Snippet: FIGURE 2. High dose GW3965 is required for elevated apoE levels in tissue. Cortical and hippocampal extracts from APP/PS1 untreated (: white), APP/PS1 treated (: dark gray), APP/PS1 ABCA1/ untreated (: light gray), and APP/PS1 ABCA1/ treated (: black) mice were immunoblotted for apoE. Left panels are representative blots using undiluted samples from individual mice from the following cohorts: APP/PS1 untreated control: n 7 (cortex), n 8 (hippocampus); APP/PS1 prophylactic: n 8 (cortex) n 8 (hippocam- pus); APP/PS1 low dose therapeutic: n 8 (cortex), n 8 (hippocampus); APP/PS1 high dose therapeutic: n 10 (cortex), n 9 (hippocampus); ABCA1/ APP/PS1 untreated control: n 4 (cortex), n 4 (hippocampus); ABCA1/ APP/PS1 prophylactic: n 8 (cortex) n 8 (hippocampus): ABCA1/ APP/PS1 low dose therapeu- tic: n 7 (cortex), n 6 (hippocampus); ABCA1/ APP/PS1 high dose therapeutic: n 4 (cortex), n 4 (hippocampus). Samples from each mouse were blotted at least twice, normalized to actin, and expressed as fold-difference compared with apoE levels in untreated APP/PS1 controls. Data represent mean S.E., where * represents p 0.05 and ** represents p 0.01 by one-way analysis of variance followed by Tukey post test.

Article Snippet: Western Blot Analysis of ABCA1, ApoE, APP, and APP-CTF— For analysis ofABCA1, apoE, andAPP, 50–100 g of carbonate lysate was electrophoresed through 10% SDS-polyacrylamide gels, transferred to PVDFmembrane (Millipore), and immunodetected using a monoclonal anti-ABCA1 antibody, AC10 (1:1000, a kind gift from Dr. M. R. Hayden), a murine-specific apoE antibody (1:1000, Santa Cruz Biotechnology), an antiAPP antibody that recognizes both murine and human APP (clone 22C11, 1:2000, Chemicon), or an anti-actin antibody (1:5000, Chemicon) as a loading control.

Techniques: Control

Journal: Journal of Biological Chemistry

Article Title: ATP-binding Cassette Transporter A1 Mediates the Beneficial Effects of the Liver X Receptor Agonist GW3965 on Object Recognition Memory and Amyloid Burden in Amyloid Precursor Protein/Presenilin 1 Mice*

doi: 10.1074/jbc.m110.108100

Figure Lengend Snippet: FIGURE 3. ABCA1 is required for increased CSF apoE levels in response to GW3965. Equal volumes of CSF from individual mice from untreated control (C), prophylactic (P), low dose therapeutic (T), and high dose therapeutic (TH) groups of APP/PS1 and APP/PS1 ABCA1/ mice were pooled, separated by 6% native PAGE, and immunoblotted for apoE and albumin. Stokes diameter markers are shown on the right.

Article Snippet: Western Blot Analysis of ABCA1, ApoE, APP, and APP-CTF— For analysis ofABCA1, apoE, andAPP, 50–100 g of carbonate lysate was electrophoresed through 10% SDS-polyacrylamide gels, transferred to PVDFmembrane (Millipore), and immunodetected using a monoclonal anti-ABCA1 antibody, AC10 (1:1000, a kind gift from Dr. M. R. Hayden), a murine-specific apoE antibody (1:1000, Santa Cruz Biotechnology), an antiAPP antibody that recognizes both murine and human APP (clone 22C11, 1:2000, Chemicon), or an anti-actin antibody (1:5000, Chemicon) as a loading control.

Techniques: Control, Clear Native PAGE

Journal: Cell reports

Article Title: Aging disrupts sympathetic innervation of the thymus

doi: 10.1016/j.celrep.2026.117126

Figure Lengend Snippet: (A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( Apoe ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).

Article Snippet: qPCR Primer – Apoe FW: GAACCGCTTCTGGGATTACCTG Rev: GCCTTTACTTCCGTCATAGTGTC , Origene , SKU: MP200816.

Techniques: Labeling, MANN-WHITNEY