api system Search Results


90
ATCC gentamicin
Gentamicin, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gentamicin/product/ATCC
Average 90 stars, based on 1 article reviews
gentamicin - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

94
Delsys Inc delsys api
Delsys Api, supplied by Delsys Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/delsys api/product/Delsys Inc
Average 94 stars, based on 1 article reviews
delsys api - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

93
Tocris api 2
Api 2, supplied by Tocris, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/api 2/product/Tocris
Average 93 stars, based on 1 article reviews
api 2 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

92
Tocris api 1
Api 1, supplied by Tocris, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/api 1/product/Tocris
Average 92 stars, based on 1 article reviews
api 1 - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology akt pkb inhibitor
Akt Pkb Inhibitor, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/akt pkb inhibitor/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
akt pkb inhibitor - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

92
OriGene serpinf2
Proteomic analysis of EV protein payloads isolated from WT vs. db/db donors. a A heatmap of protein expression in WT and db/db EVs showing protein levels elevated in WT EVs compared to db/db EVs, and protein levels in WT EVs that are lower than db/db EVs. n = 3 independent animals of each genotype. b Volcano plot showing that the standard deviation of EV proteins identified and magnitude of fold-changes that support the high statistical significance of EV proteins identified. n = 3 biological replicates for each genotype. c String analysis of predicted proteins that may interact with SERPINA1 (red symbol), d <t>SERPINF2</t> (red symbol), and e SERPING1 (red symbol). All representative images showed as observed in three independent experiments
Serpinf2, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/serpinf2/product/OriGene
Average 92 stars, based on 1 article reviews
serpinf2 - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

90
ATCC b14579 p4cr catatgcaactcggttacccactccc b14579 z1fc ggaggtagattagtggtggag
Proteomic analysis of EV protein payloads isolated from WT vs. db/db donors. a A heatmap of protein expression in WT and db/db EVs showing protein levels elevated in WT EVs compared to db/db EVs, and protein levels in WT EVs that are lower than db/db EVs. n = 3 independent animals of each genotype. b Volcano plot showing that the standard deviation of EV proteins identified and magnitude of fold-changes that support the high statistical significance of EV proteins identified. n = 3 biological replicates for each genotype. c String analysis of predicted proteins that may interact with SERPINA1 (red symbol), d <t>SERPINF2</t> (red symbol), and e SERPING1 (red symbol). All representative images showed as observed in three independent experiments
B14579 P4cr Catatgcaactcggttacccactccc B14579 Z1fc Ggaggtagattagtggtggag, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/b14579 p4cr catatgcaactcggttacccactccc b14579 z1fc ggaggtagattagtggtggag/product/ATCC
Average 90 stars, based on 1 article reviews
b14579 p4cr catatgcaactcggttacccactccc b14579 z1fc ggaggtagattagtggtggag - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
ATCC lactobacillus casei atcc 334
Proteomic analysis of EV protein payloads isolated from WT vs. db/db donors. a A heatmap of protein expression in WT and db/db EVs showing protein levels elevated in WT EVs compared to db/db EVs, and protein levels in WT EVs that are lower than db/db EVs. n = 3 independent animals of each genotype. b Volcano plot showing that the standard deviation of EV proteins identified and magnitude of fold-changes that support the high statistical significance of EV proteins identified. n = 3 biological replicates for each genotype. c String analysis of predicted proteins that may interact with SERPINA1 (red symbol), d <t>SERPINF2</t> (red symbol), and e SERPING1 (red symbol). All representative images showed as observed in three independent experiments
Lactobacillus Casei Atcc 334, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lactobacillus casei atcc 334/product/ATCC
Average 90 stars, based on 1 article reviews
lactobacillus casei atcc 334 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

94
ATCC e faecalis atcc 15021
Proteomic analysis of EV protein payloads isolated from WT vs. db/db donors. a A heatmap of protein expression in WT and db/db EVs showing protein levels elevated in WT EVs compared to db/db EVs, and protein levels in WT EVs that are lower than db/db EVs. n = 3 independent animals of each genotype. b Volcano plot showing that the standard deviation of EV proteins identified and magnitude of fold-changes that support the high statistical significance of EV proteins identified. n = 3 biological replicates for each genotype. c String analysis of predicted proteins that may interact with SERPINA1 (red symbol), d <t>SERPINF2</t> (red symbol), and e SERPING1 (red symbol). All representative images showed as observed in three independent experiments
E Faecalis Atcc 15021, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e faecalis atcc 15021/product/ATCC
Average 94 stars, based on 1 article reviews
e faecalis atcc 15021 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

95
Chem Impex International sodium chloride
Proteomic analysis of EV protein payloads isolated from WT vs. db/db donors. a A heatmap of protein expression in WT and db/db EVs showing protein levels elevated in WT EVs compared to db/db EVs, and protein levels in WT EVs that are lower than db/db EVs. n = 3 independent animals of each genotype. b Volcano plot showing that the standard deviation of EV proteins identified and magnitude of fold-changes that support the high statistical significance of EV proteins identified. n = 3 biological replicates for each genotype. c String analysis of predicted proteins that may interact with SERPINA1 (red symbol), d <t>SERPINF2</t> (red symbol), and e SERPING1 (red symbol). All representative images showed as observed in three independent experiments
Sodium Chloride, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sodium chloride/product/Chem Impex International
Average 95 stars, based on 1 article reviews
sodium chloride - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

Image Search Results


Proteomic analysis of EV protein payloads isolated from WT vs. db/db donors. a A heatmap of protein expression in WT and db/db EVs showing protein levels elevated in WT EVs compared to db/db EVs, and protein levels in WT EVs that are lower than db/db EVs. n = 3 independent animals of each genotype. b Volcano plot showing that the standard deviation of EV proteins identified and magnitude of fold-changes that support the high statistical significance of EV proteins identified. n = 3 biological replicates for each genotype. c String analysis of predicted proteins that may interact with SERPINA1 (red symbol), d SERPINF2 (red symbol), and e SERPING1 (red symbol). All representative images showed as observed in three independent experiments

Journal: Journal of Nanobiotechnology

Article Title: Serpin-loaded extracellular vesicles promote tissue repair in a mouse model of impaired wound healing

doi: 10.1186/s12951-022-01656-7

Figure Lengend Snippet: Proteomic analysis of EV protein payloads isolated from WT vs. db/db donors. a A heatmap of protein expression in WT and db/db EVs showing protein levels elevated in WT EVs compared to db/db EVs, and protein levels in WT EVs that are lower than db/db EVs. n = 3 independent animals of each genotype. b Volcano plot showing that the standard deviation of EV proteins identified and magnitude of fold-changes that support the high statistical significance of EV proteins identified. n = 3 biological replicates for each genotype. c String analysis of predicted proteins that may interact with SERPINA1 (red symbol), d SERPINF2 (red symbol), and e SERPING1 (red symbol). All representative images showed as observed in three independent experiments

Article Snippet: Primer design tools from TAKARA ( https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ) were used to amplify SERPIN genes from cDNAs (Origene) encoding human SERPINA1 (#RC202082), SERPINF2 (#RC228342) or SERPING1 (#RC203767) flanked by Xho I and NotI restriction enzyme sites for cloning into pLenti-XPack-MCS vector.

Techniques: Isolation, Expressing, Standard Deviation

Testing of Serpin-loaded EV activity in vitro. a Fusions of an amino terminal myristoylation sequence with each Serpin were cloned into lentiviral vectors. b-d Validation of three Serpin-loaded EVs by immunoblotting in cultured media. Sham is PBS and Empty is the empty vector used for the myristoylation fusions. e Representative images of HaCaT cell closure kinetics. f Gap closure quantification of HaCaT cells treated with SERPINA1-EVs, SERPINF2-EVs, SERPING1-EVs, vs. empty vector, and sham (PBS). ( p -value: *** < 0.001, n = 6). Statistical analysis of scratch assay on HaCaT cells by SERPIN-loaded EVs enriched from HEK293 donor cells on g 2 h, h 4 h, i 24 h ( p -value: ** < 0.005, * < 0.05)

Journal: Journal of Nanobiotechnology

Article Title: Serpin-loaded extracellular vesicles promote tissue repair in a mouse model of impaired wound healing

doi: 10.1186/s12951-022-01656-7

Figure Lengend Snippet: Testing of Serpin-loaded EV activity in vitro. a Fusions of an amino terminal myristoylation sequence with each Serpin were cloned into lentiviral vectors. b-d Validation of three Serpin-loaded EVs by immunoblotting in cultured media. Sham is PBS and Empty is the empty vector used for the myristoylation fusions. e Representative images of HaCaT cell closure kinetics. f Gap closure quantification of HaCaT cells treated with SERPINA1-EVs, SERPINF2-EVs, SERPING1-EVs, vs. empty vector, and sham (PBS). ( p -value: *** < 0.001, n = 6). Statistical analysis of scratch assay on HaCaT cells by SERPIN-loaded EVs enriched from HEK293 donor cells on g 2 h, h 4 h, i 24 h ( p -value: ** < 0.005, * < 0.05)

Article Snippet: Primer design tools from TAKARA ( https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ) were used to amplify SERPIN genes from cDNAs (Origene) encoding human SERPINA1 (#RC202082), SERPINF2 (#RC228342) or SERPING1 (#RC203767) flanked by Xho I and NotI restriction enzyme sites for cloning into pLenti-XPack-MCS vector.

Techniques: Activity Assay, In Vitro, Sequencing, Clone Assay, Western Blot, Cell Culture, Plasmid Preparation, Wound Healing Assay

Testing of Serpin-loaded EV activity in vivo. a In vivo strategy to transduce cells infiltrating PVA sponge implants and enrich their EVs for assessment of wound closure activity following the expression, release and enrichment of EVs loaded with SERPINA1, SERPINF2, SERPING1, and empty vector controls. b-d Validation of Serpin expression in engineered EVs by immunoblotting EVs recovered from implants, with densitometric quantification shown on the blot. e Quantification of wound closure kinetics following adoptive transfer in the db/db mouse model of impaired wound healing. (2-way ANOVA, p -value < 0.0001 for SERPINA1 and SERPIN G1 vs. empty vector control, n = 6 in each arm) f Representative images of splinted wounds treated with Serpin-loaded EVs. Statical analysis of wound closure efficiency in vivo using SERPINA1-EVs, SERPINF2-EVs, and SERPING1-EVs on g Day 3, h Day 5, i Day 7, j Day 10, and k Day 14 ( p -value:**** < 0.0001, *** < 0.001, ** < 0.005, * < 0.05). l Representative images of immunostaining at each time point to demonstrate expression of cytokeratin 14 at Day 5 and 10 post-injury. Statistical analysis of cytokeratin staining is shown in Fig. S7

Journal: Journal of Nanobiotechnology

Article Title: Serpin-loaded extracellular vesicles promote tissue repair in a mouse model of impaired wound healing

doi: 10.1186/s12951-022-01656-7

Figure Lengend Snippet: Testing of Serpin-loaded EV activity in vivo. a In vivo strategy to transduce cells infiltrating PVA sponge implants and enrich their EVs for assessment of wound closure activity following the expression, release and enrichment of EVs loaded with SERPINA1, SERPINF2, SERPING1, and empty vector controls. b-d Validation of Serpin expression in engineered EVs by immunoblotting EVs recovered from implants, with densitometric quantification shown on the blot. e Quantification of wound closure kinetics following adoptive transfer in the db/db mouse model of impaired wound healing. (2-way ANOVA, p -value < 0.0001 for SERPINA1 and SERPIN G1 vs. empty vector control, n = 6 in each arm) f Representative images of splinted wounds treated with Serpin-loaded EVs. Statical analysis of wound closure efficiency in vivo using SERPINA1-EVs, SERPINF2-EVs, and SERPING1-EVs on g Day 3, h Day 5, i Day 7, j Day 10, and k Day 14 ( p -value:**** < 0.0001, *** < 0.001, ** < 0.005, * < 0.05). l Representative images of immunostaining at each time point to demonstrate expression of cytokeratin 14 at Day 5 and 10 post-injury. Statistical analysis of cytokeratin staining is shown in Fig. S7

Article Snippet: Primer design tools from TAKARA ( https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ) were used to amplify SERPIN genes from cDNAs (Origene) encoding human SERPINA1 (#RC202082), SERPINF2 (#RC228342) or SERPING1 (#RC203767) flanked by Xho I and NotI restriction enzyme sites for cloning into pLenti-XPack-MCS vector.

Techniques: Activity Assay, In Vivo, Transduction, Expressing, Plasmid Preparation, Western Blot, Adoptive Transfer Assay, Immunostaining, Staining

Model for Serpin-loaded EV action in accelerating a pro-resolution phenotype. (Top) In diabetic wounds, we propose that increased elastase activity increases degradation of the extracellular matrix (ECM) that can be reversed by delivery of SERPINA1-EVs to promote healthy ECM. (Middle) Decreases in plasmin inhibitor of diabetic wounds increases plasmin activity and degradation of fibrin that can be reversed by delivery of SERPINF2-EVs leading to formation of a beneficial fibrin scaffold. (Bottom) The loss of the inhibitor of the Complement C1 protease activity (C1) in diabetic mice that increases production of complement cascade products, which can be reversed by delivery of SERPING1-EVs that suppress the activation of complement cascade, activation of neutrophils, and promotes the resolution of the inflammation phase of wound repair. Created with Biorender.com

Journal: Journal of Nanobiotechnology

Article Title: Serpin-loaded extracellular vesicles promote tissue repair in a mouse model of impaired wound healing

doi: 10.1186/s12951-022-01656-7

Figure Lengend Snippet: Model for Serpin-loaded EV action in accelerating a pro-resolution phenotype. (Top) In diabetic wounds, we propose that increased elastase activity increases degradation of the extracellular matrix (ECM) that can be reversed by delivery of SERPINA1-EVs to promote healthy ECM. (Middle) Decreases in plasmin inhibitor of diabetic wounds increases plasmin activity and degradation of fibrin that can be reversed by delivery of SERPINF2-EVs leading to formation of a beneficial fibrin scaffold. (Bottom) The loss of the inhibitor of the Complement C1 protease activity (C1) in diabetic mice that increases production of complement cascade products, which can be reversed by delivery of SERPING1-EVs that suppress the activation of complement cascade, activation of neutrophils, and promotes the resolution of the inflammation phase of wound repair. Created with Biorender.com

Article Snippet: Primer design tools from TAKARA ( https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ) were used to amplify SERPIN genes from cDNAs (Origene) encoding human SERPINA1 (#RC202082), SERPINF2 (#RC228342) or SERPING1 (#RC203767) flanked by Xho I and NotI restriction enzyme sites for cloning into pLenti-XPack-MCS vector.

Techniques: Activity Assay, Activation Assay