antigenicity prediction a blast search Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    ATCC t denticola strain atcc 35405
    T Denticola Strain Atcc 35405, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t denticola strain atcc 35405/product/ATCC
    Average 99 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    t denticola strain atcc 35405 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Millipore s1133 sigma c protein structure
    Conserved and variable regions of predicted antigenic epitopes of the <t>Sigma</t> C protein shown on the modelled Sigma C carboxy terminus receptor binding domain trimeric structure. ( a and b ) Conserved proposed receptor binding residues. The conserved residues are highlighted in red as “cartoons”. ( c to h ) The conserved amino acid residues on the predicted antigenic epitopes between the <t>S1133</t> vaccine strain and our isolates which grouped into different cluster “C” groups are shown in green as “surface” on the carobxy terminus receptor binding domain model structure of the Sigma C protein. The variable regions are shown in yellow. * 194 DV substituted by 194 VM, ** 260 M substituted by I, *** 294 T substituted by N or A and **** 294 A substituted by N or D in some cases.
    S1133 Sigma C Protein Structure, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/s1133 sigma c protein structure/product/Millipore
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    s1133 sigma c protein structure - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    94
    Biotechnology Information biotechnology information ncbi
    Conserved and variable regions of predicted antigenic epitopes of the <t>Sigma</t> C protein shown on the modelled Sigma C carboxy terminus receptor binding domain trimeric structure. ( a and b ) Conserved proposed receptor binding residues. The conserved residues are highlighted in red as “cartoons”. ( c to h ) The conserved amino acid residues on the predicted antigenic epitopes between the <t>S1133</t> vaccine strain and our isolates which grouped into different cluster “C” groups are shown in green as “surface” on the carobxy terminus receptor binding domain model structure of the Sigma C protein. The variable regions are shown in yellow. * 194 DV substituted by 194 VM, ** 260 M substituted by I, *** 294 T substituted by N or A and **** 294 A substituted by N or D in some cases.
    Biotechnology Information Ncbi, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 94/100, based on 67242 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotechnology information ncbi/product/Biotechnology Information
    Average 94 stars, based on 67242 article reviews
    Price from $9.99 to $1999.99
    biotechnology information ncbi - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    94
    Immune Epitope Database & Analysis Resource epitopes
    Conserved and variable regions of predicted antigenic epitopes of the <t>Sigma</t> C protein shown on the modelled Sigma C carboxy terminus receptor binding domain trimeric structure. ( a and b ) Conserved proposed receptor binding residues. The conserved residues are highlighted in red as “cartoons”. ( c to h ) The conserved amino acid residues on the predicted antigenic epitopes between the <t>S1133</t> vaccine strain and our isolates which grouped into different cluster “C” groups are shown in green as “surface” on the carobxy terminus receptor binding domain model structure of the Sigma C protein. The variable regions are shown in yellow. * 194 DV substituted by 194 VM, ** 260 M substituted by I, *** 294 T substituted by N or A and **** 294 A substituted by N or D in some cases.
    Epitopes, supplied by Immune Epitope Database & Analysis Resource, used in various techniques. Bioz Stars score: 94/100, based on 376 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/epitopes/product/Immune Epitope Database & Analysis Resource
    Average 94 stars, based on 376 article reviews
    Price from $9.99 to $1999.99
    epitopes - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    94
    Illumina Inc illumina hiseq2000 instrument
    Conserved and variable regions of predicted antigenic epitopes of the <t>Sigma</t> C protein shown on the modelled Sigma C carboxy terminus receptor binding domain trimeric structure. ( a and b ) Conserved proposed receptor binding residues. The conserved residues are highlighted in red as “cartoons”. ( c to h ) The conserved amino acid residues on the predicted antigenic epitopes between the <t>S1133</t> vaccine strain and our isolates which grouped into different cluster “C” groups are shown in green as “surface” on the carobxy terminus receptor binding domain model structure of the Sigma C protein. The variable regions are shown in yellow. * 194 DV substituted by 194 VM, ** 260 M substituted by I, *** 294 T substituted by N or A and **** 294 A substituted by N or D in some cases.
    Illumina Hiseq2000 Instrument, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 2577 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina hiseq2000 instrument/product/Illumina Inc
    Average 94 stars, based on 2577 article reviews
    Price from $9.99 to $1999.99
    illumina hiseq2000 instrument - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    92
    GL Biochem position 216 229 iseqldsenktkli
    Conserved and variable regions of predicted antigenic epitopes of the <t>Sigma</t> C protein shown on the modelled Sigma C carboxy terminus receptor binding domain trimeric structure. ( a and b ) Conserved proposed receptor binding residues. The conserved residues are highlighted in red as “cartoons”. ( c to h ) The conserved amino acid residues on the predicted antigenic epitopes between the <t>S1133</t> vaccine strain and our isolates which grouped into different cluster “C” groups are shown in green as “surface” on the carobxy terminus receptor binding domain model structure of the Sigma C protein. The variable regions are shown in yellow. * 194 DV substituted by 194 VM, ** 260 M substituted by I, *** 294 T substituted by N or A and **** 294 A substituted by N or D in some cases.
    Position 216 229 Iseqldsenktkli, supplied by GL Biochem, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/position 216 229 iseqldsenktkli/product/GL Biochem
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    position 216 229 iseqldsenktkli - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    93
    Immune Epitope Database & Analysis Resource analysis resource software
    Conserved and variable regions of predicted antigenic epitopes of the <t>Sigma</t> C protein shown on the modelled Sigma C carboxy terminus receptor binding domain trimeric structure. ( a and b ) Conserved proposed receptor binding residues. The conserved residues are highlighted in red as “cartoons”. ( c to h ) The conserved amino acid residues on the predicted antigenic epitopes between the <t>S1133</t> vaccine strain and our isolates which grouped into different cluster “C” groups are shown in green as “surface” on the carobxy terminus receptor binding domain model structure of the Sigma C protein. The variable regions are shown in yellow. * 194 DV substituted by 194 VM, ** 260 M substituted by I, *** 294 T substituted by N or A and **** 294 A substituted by N or D in some cases.
    Analysis Resource Software, supplied by Immune Epitope Database & Analysis Resource, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/analysis resource software/product/Immune Epitope Database & Analysis Resource
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    analysis resource software - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    88
    Unigene uniprot swiss prot
    Number of entries in PubMed, <t>UniProt/Swiss-Prot,</t> and COSMIC . Entries in PubMed were filtered by the search term
    Uniprot Swiss Prot, supplied by Unigene, used in various techniques. Bioz Stars score: 88/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/uniprot swiss prot/product/Unigene
    Average 88 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    uniprot swiss prot - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    91
    Immune Epitope Database & Analysis Resource hla binding prediction online tools
    Number of entries in PubMed, <t>UniProt/Swiss-Prot,</t> and COSMIC . Entries in PubMed were filtered by the search term
    Hla Binding Prediction Online Tools, supplied by Immune Epitope Database & Analysis Resource, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hla binding prediction online tools/product/Immune Epitope Database & Analysis Resource
    Average 91 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    hla binding prediction online tools - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    85
    Immune Epitope Database & Analysis Resource bepipred linear epitope prediction
    Number of entries in PubMed, <t>UniProt/Swiss-Prot,</t> and COSMIC . Entries in PubMed were filtered by the search term
    Bepipred Linear Epitope Prediction, supplied by Immune Epitope Database & Analysis Resource, used in various techniques. Bioz Stars score: 85/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bepipred linear epitope prediction/product/Immune Epitope Database & Analysis Resource
    Average 85 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    bepipred linear epitope prediction - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    88
    CLC Bio clc main workbench 6 software
    Number of entries in PubMed, <t>UniProt/Swiss-Prot,</t> and COSMIC . Entries in PubMed were filtered by the search term
    Clc Main Workbench 6 Software, supplied by CLC Bio, used in various techniques. Bioz Stars score: 88/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/clc main workbench 6 software/product/CLC Bio
    Average 88 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    clc main workbench 6 software - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    92
    Sigma-Genosys rabbit antibodies
    Number of entries in PubMed, <t>UniProt/Swiss-Prot,</t> and COSMIC . Entries in PubMed were filtered by the search term
    Rabbit Antibodies, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit antibodies/product/Sigma-Genosys
    Average 92 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    rabbit antibodies - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    85
    4Gene uncharacterized ovine nectin 4 gene
    Ovine <t>Nectin-4</t> can function as a receptor for PPRV. (A) Schematic representation of the lentivirus constructs encoding ovine SLAM or Nectin-4 ORFs. The bicistronic constructs encoded the encephalomyocarditis virus internal ribosome entry site (IRES) and a puromycin resistance gene. (B) Oligo(dT)-primed RT-PCR analysis of total cell RNA extracted from transduced or wild-type (wt) PO cell lines confirming SLAM or Nectin-4 mRNA expression. (C) PPRV infection in PO cell lines. Wild-type or lentivirus-transduced cells were infected at high MOI (4) with PPRV (Ivory Coast 1989 strain). Cytopathic effect was observed by phase-contrast microscopy at 48 h p.i. All images were equally manipulated for brightness and contrast using MS Powerpoint. (D) High-MOI single-step growth curve of PPRV in PO cell lines. Wild-type or transduced PO cells were infected at an MOI of 4. Virus was harvested at 0, 6, 12, 24, 48, and 72 h p.i. by freeze-thawing. PPRV replication rates were compared using an unpaired two-tailed t test comparison of the mean rates of viral exponential growth (12 to 48 h p.i.). Individual slopes were calculated by fitting a first order polynomial straight line to each data set; *, P
    Uncharacterized Ovine Nectin 4 Gene, supplied by 4Gene, used in various techniques. Bioz Stars score: 85/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/uncharacterized ovine nectin 4 gene/product/4Gene
    Average 85 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    uncharacterized ovine nectin 4 gene - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    Image Search Results


    Conserved and variable regions of predicted antigenic epitopes of the Sigma C protein shown on the modelled Sigma C carboxy terminus receptor binding domain trimeric structure. ( a and b ) Conserved proposed receptor binding residues. The conserved residues are highlighted in red as “cartoons”. ( c to h ) The conserved amino acid residues on the predicted antigenic epitopes between the S1133 vaccine strain and our isolates which grouped into different cluster “C” groups are shown in green as “surface” on the carobxy terminus receptor binding domain model structure of the Sigma C protein. The variable regions are shown in yellow. * 194 DV substituted by 194 VM, ** 260 M substituted by I, *** 294 T substituted by N or A and **** 294 A substituted by N or D in some cases.

    Journal: Scientific Reports

    Article Title: Phenotypic, genotypic and antigenic characterization of emerging avian reoviruses isolated from clinical cases of arthritis in broilers in Saskatchewan, Canada

    doi: 10.1038/s41598-017-02743-8

    Figure Lengend Snippet: Conserved and variable regions of predicted antigenic epitopes of the Sigma C protein shown on the modelled Sigma C carboxy terminus receptor binding domain trimeric structure. ( a and b ) Conserved proposed receptor binding residues. The conserved residues are highlighted in red as “cartoons”. ( c to h ) The conserved amino acid residues on the predicted antigenic epitopes between the S1133 vaccine strain and our isolates which grouped into different cluster “C” groups are shown in green as “surface” on the carobxy terminus receptor binding domain model structure of the Sigma C protein. The variable regions are shown in yellow. * 194 DV substituted by 194 VM, ** 260 M substituted by I, *** 294 T substituted by N or A and **** 294 A substituted by N or D in some cases.

    Article Snippet: Structure modelling and antigenicity prediction A blast search in PDB protein data bank using Sigma C protein sequences of our ARV isolates produced the S1133 Sigma C protein structure [PDB 2jjl] as the first hit and was chosen as a template structure.

    Techniques: Binding Assay

    ( a ) A multiple amino acid sequence alignment of the common American vaccine strain S1133 and the 28 ARV field isolates. The alignment was made by a ClustalW alignment with BLOSUM cost matrix technique. Disagreements to the consensus sequence are highlighted. ( b ) Mapping of Dde I, Hinc II, Taq aI, Bcn I and Hae III restriction sites on Sigma C sequences of the ARV isolates (i.e. one isolate from each cluster group SK-R23 [Cluster II], SK-R16 [Cluster IV], SK-R10 [Cluster V], SK-R3 [Cluster VI]).

    Journal: Scientific Reports

    Article Title: Phenotypic, genotypic and antigenic characterization of emerging avian reoviruses isolated from clinical cases of arthritis in broilers in Saskatchewan, Canada

    doi: 10.1038/s41598-017-02743-8

    Figure Lengend Snippet: ( a ) A multiple amino acid sequence alignment of the common American vaccine strain S1133 and the 28 ARV field isolates. The alignment was made by a ClustalW alignment with BLOSUM cost matrix technique. Disagreements to the consensus sequence are highlighted. ( b ) Mapping of Dde I, Hinc II, Taq aI, Bcn I and Hae III restriction sites on Sigma C sequences of the ARV isolates (i.e. one isolate from each cluster group SK-R23 [Cluster II], SK-R16 [Cluster IV], SK-R10 [Cluster V], SK-R3 [Cluster VI]).

    Article Snippet: Structure modelling and antigenicity prediction A blast search in PDB protein data bank using Sigma C protein sequences of our ARV isolates produced the S1133 Sigma C protein structure [PDB 2jjl] as the first hit and was chosen as a template structure.

    Techniques: Sequencing

    Number of entries in PubMed, UniProt/Swiss-Prot, and COSMIC . Entries in PubMed were filtered by the search term

    Journal: BMC Genomics

    Article Title: Literature classification for semi-automated updating of biological knowledgebases

    doi: 10.1186/1471-2164-14-S5-S14

    Figure Lengend Snippet: Number of entries in PubMed, UniProt/Swiss-Prot, and COSMIC . Entries in PubMed were filtered by the search term "(tumor OR cancer) AND (antigen OR epitope)" .

    Article Snippet: Each antigen entry contains detailed information about somatic mutations from the Catalogue of Somatic Mutations in Cancer (COSMIC) [ ], splice isoforms from UniProt/Swiss-Prot, gene expression profiles from UniGene, and known T-cell epitopes from secondary databases or literature.

    Techniques:

    Ovine Nectin-4 can function as a receptor for PPRV. (A) Schematic representation of the lentivirus constructs encoding ovine SLAM or Nectin-4 ORFs. The bicistronic constructs encoded the encephalomyocarditis virus internal ribosome entry site (IRES) and a puromycin resistance gene. (B) Oligo(dT)-primed RT-PCR analysis of total cell RNA extracted from transduced or wild-type (wt) PO cell lines confirming SLAM or Nectin-4 mRNA expression. (C) PPRV infection in PO cell lines. Wild-type or lentivirus-transduced cells were infected at high MOI (4) with PPRV (Ivory Coast 1989 strain). Cytopathic effect was observed by phase-contrast microscopy at 48 h p.i. All images were equally manipulated for brightness and contrast using MS Powerpoint. (D) High-MOI single-step growth curve of PPRV in PO cell lines. Wild-type or transduced PO cells were infected at an MOI of 4. Virus was harvested at 0, 6, 12, 24, 48, and 72 h p.i. by freeze-thawing. PPRV replication rates were compared using an unpaired two-tailed t test comparison of the mean rates of viral exponential growth (12 to 48 h p.i.). Individual slopes were calculated by fitting a first order polynomial straight line to each data set; *, P

    Journal: Journal of Virology

    Article Title: Characterization of Ovine Nectin-4, a Novel Peste des Petits Ruminants Virus Receptor

    doi: 10.1128/JVI.02792-12

    Figure Lengend Snippet: Ovine Nectin-4 can function as a receptor for PPRV. (A) Schematic representation of the lentivirus constructs encoding ovine SLAM or Nectin-4 ORFs. The bicistronic constructs encoded the encephalomyocarditis virus internal ribosome entry site (IRES) and a puromycin resistance gene. (B) Oligo(dT)-primed RT-PCR analysis of total cell RNA extracted from transduced or wild-type (wt) PO cell lines confirming SLAM or Nectin-4 mRNA expression. (C) PPRV infection in PO cell lines. Wild-type or lentivirus-transduced cells were infected at high MOI (4) with PPRV (Ivory Coast 1989 strain). Cytopathic effect was observed by phase-contrast microscopy at 48 h p.i. All images were equally manipulated for brightness and contrast using MS Powerpoint. (D) High-MOI single-step growth curve of PPRV in PO cell lines. Wild-type or transduced PO cells were infected at an MOI of 4. Virus was harvested at 0, 6, 12, 24, 48, and 72 h p.i. by freeze-thawing. PPRV replication rates were compared using an unpaired two-tailed t test comparison of the mean rates of viral exponential growth (12 to 48 h p.i.). Individual slopes were calculated by fitting a first order polynomial straight line to each data set; *, P

    Article Snippet: The ORF of the previously uncharacterized ovine Nectin-4 gene ( ) was sequenced, and the predicted amino acid sequence was shown to be closely related to both bovine ( Bos taurus ) and human Nectin-4 proteins (98% and 92% identity, respectively).

    Techniques: Construct, Reverse Transcription Polymerase Chain Reaction, Expressing, Infection, Microscopy, Mass Spectrometry, Two Tailed Test

    Endogenous mRNA expression profile of ovine SLAM and Nectin-4 in various Ovis aries tissues. A total of 49 separate tissues were isolated from a 2-year-old ewe (Texel/North Country Mule cross). Total cell RNA was extracted from tissue, and 100 ng of this RNA was used to generate an oligo(dT)-primed cDNA library. mRNA copies of SLAM (red) and Nectin-4 (green) were calculated by duplicate TaqMan qPCR analysis of these cDNA libraries (using standard curve quantification). The detection limit of this qPCR was set at 10 copies. The data were normalized to copies/μg RNA and grouped anatomically, as follows: the head (upper respiratory and digestive system) (A), the lower respiratory system (B), the lower digestive system (C), and the other major organs (D). (E) Heat map of the mRNA data in panels A to D representing the relative levels of SLAM (red) and Nectin-4 (green) expression in the 49 tissues (darker shading indicates higher expression). Abbreviations: LN, lymph nodes; DSP, dorsal surface of the soft palate; VSP, ventral surface of the soft palate; Asc′, ascending; Des′, descending. This data set is representative of 3 individually performed RT-qPCR analyses.

    Journal: Journal of Virology

    Article Title: Characterization of Ovine Nectin-4, a Novel Peste des Petits Ruminants Virus Receptor

    doi: 10.1128/JVI.02792-12

    Figure Lengend Snippet: Endogenous mRNA expression profile of ovine SLAM and Nectin-4 in various Ovis aries tissues. A total of 49 separate tissues were isolated from a 2-year-old ewe (Texel/North Country Mule cross). Total cell RNA was extracted from tissue, and 100 ng of this RNA was used to generate an oligo(dT)-primed cDNA library. mRNA copies of SLAM (red) and Nectin-4 (green) were calculated by duplicate TaqMan qPCR analysis of these cDNA libraries (using standard curve quantification). The detection limit of this qPCR was set at 10 copies. The data were normalized to copies/μg RNA and grouped anatomically, as follows: the head (upper respiratory and digestive system) (A), the lower respiratory system (B), the lower digestive system (C), and the other major organs (D). (E) Heat map of the mRNA data in panels A to D representing the relative levels of SLAM (red) and Nectin-4 (green) expression in the 49 tissues (darker shading indicates higher expression). Abbreviations: LN, lymph nodes; DSP, dorsal surface of the soft palate; VSP, ventral surface of the soft palate; Asc′, ascending; Des′, descending. This data set is representative of 3 individually performed RT-qPCR analyses.

    Article Snippet: The ORF of the previously uncharacterized ovine Nectin-4 gene ( ) was sequenced, and the predicted amino acid sequence was shown to be closely related to both bovine ( Bos taurus ) and human Nectin-4 proteins (98% and 92% identity, respectively).

    Techniques: Expressing, Isolation, cDNA Library Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    Genomic structure, polymorphisms, unrooted median-joining network, and effects of allelic variants of ovine Nectin-4 . (A) Genomic map of Nectin-4 : white arrows, 5′ and 3′ UTR of exons; black arrows, exon coding regions; gray rectangles, introns or intergenic regions; small diamonds, positions and minor allele frequencies (MAF) of SNPs in an international panel of 75 sheep; large squares, position of Nectin-4 missense polymorphisms and 47-bp indel in the 3′ UTR. The codon polymorphism sequences are as follows: G75S, GGC→AGC; P102L, CCC→CTC; A319V, GCA→GTA. The major and minor alleles for the 47-bp indel in the 3′ UTR are 5′-TAACA[AGAGGACAAGTAAGGTCCTTGGCCTTGCGGTTCCTCGGCTCTTCCCC]TAGGC-3′ and 5′-TAACA[]TAGGC-3′, respectively. (B) Unrooted median-joining network of haplotypes comprising G75S, P102L, A319V, and 47-bp 3′ UTR indel variants. The areas of circles are proportional to the frequencies in the 75 ISGC sheep (see Table S1 in the supplemental material). The predicted sequence of variable sites for the most frequent haplotype (1) was G75, P102, and A319 and contained the 47-bp insertion in the 3′ UTR. The difference from and relationship to haplotype 1 are indicated for each additional haplotype. The delta symbol indicates the deleted form of the 47-bp indel polymorphism. (C) PPRV infection of transduced PO cell lines overexpressing Nectin-4 haplotype isoforms. Abbreviations for cell lines: C, control line overexpressing the most common Nectin-4 haplotype in domestic sheep (haplotype 1: G75, P102, and A319); S75, line with S75, P102, and A319; L102, line with haplotype 3 (G75, L102, and A319); 319V, line with haplotype 5 (G75, P102, and V319). All four cell lines were infected at an MOI of 4 with PPRV (Ivory Coast 1989 strain). Virus was harvested at 48 h p.i. by freeze-thawing. Virus titration was performed on Vero cells expressing canine SLAM with a detection limit of 10 TCID 50 . All infections were performed in triplicate; the error bars denote standard deviations from the means. PPRV replication rates were compared using an unpaired two-tailed t test (ns, nonsignificant).

    Journal: Journal of Virology

    Article Title: Characterization of Ovine Nectin-4, a Novel Peste des Petits Ruminants Virus Receptor

    doi: 10.1128/JVI.02792-12

    Figure Lengend Snippet: Genomic structure, polymorphisms, unrooted median-joining network, and effects of allelic variants of ovine Nectin-4 . (A) Genomic map of Nectin-4 : white arrows, 5′ and 3′ UTR of exons; black arrows, exon coding regions; gray rectangles, introns or intergenic regions; small diamonds, positions and minor allele frequencies (MAF) of SNPs in an international panel of 75 sheep; large squares, position of Nectin-4 missense polymorphisms and 47-bp indel in the 3′ UTR. The codon polymorphism sequences are as follows: G75S, GGC→AGC; P102L, CCC→CTC; A319V, GCA→GTA. The major and minor alleles for the 47-bp indel in the 3′ UTR are 5′-TAACA[AGAGGACAAGTAAGGTCCTTGGCCTTGCGGTTCCTCGGCTCTTCCCC]TAGGC-3′ and 5′-TAACA[]TAGGC-3′, respectively. (B) Unrooted median-joining network of haplotypes comprising G75S, P102L, A319V, and 47-bp 3′ UTR indel variants. The areas of circles are proportional to the frequencies in the 75 ISGC sheep (see Table S1 in the supplemental material). The predicted sequence of variable sites for the most frequent haplotype (1) was G75, P102, and A319 and contained the 47-bp insertion in the 3′ UTR. The difference from and relationship to haplotype 1 are indicated for each additional haplotype. The delta symbol indicates the deleted form of the 47-bp indel polymorphism. (C) PPRV infection of transduced PO cell lines overexpressing Nectin-4 haplotype isoforms. Abbreviations for cell lines: C, control line overexpressing the most common Nectin-4 haplotype in domestic sheep (haplotype 1: G75, P102, and A319); S75, line with S75, P102, and A319; L102, line with haplotype 3 (G75, L102, and A319); 319V, line with haplotype 5 (G75, P102, and V319). All four cell lines were infected at an MOI of 4 with PPRV (Ivory Coast 1989 strain). Virus was harvested at 48 h p.i. by freeze-thawing. Virus titration was performed on Vero cells expressing canine SLAM with a detection limit of 10 TCID 50 . All infections were performed in triplicate; the error bars denote standard deviations from the means. PPRV replication rates were compared using an unpaired two-tailed t test (ns, nonsignificant).

    Article Snippet: The ORF of the previously uncharacterized ovine Nectin-4 gene ( ) was sequenced, and the predicted amino acid sequence was shown to be closely related to both bovine ( Bos taurus ) and human Nectin-4 proteins (98% and 92% identity, respectively).

    Techniques: Countercurrent Chromatography, Sequencing, Infection, Titration, Expressing, Two Tailed Test