Journal:

Article Title: Noncoupled NADH:Ubiquinone Oxidoreductase of Azotobacter vinelandii Is Required for Diazotrophic Growth at High Oxygen Concentrations

doi: 10.1128/JB.183.23.6869-6874.2001

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: E. coli cells were routinely grown in Luria-Bertani (LB) medium. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strains and plasmids Characteristic(s) Reference or source A. vinelandii UW136 Rif r 15 A. vinelandii MK8 UW136 cydR ::Tn 5 Rif r Km r 15 A. vinelandii DN165 UW136 ndh ::ΩTc Rif r Tc r This work A. vinelandii N24 UW136 ndh ::pNDT6 Rif r Tc r Amp r This work E. coli TG1 F′ traD36 lacI q Z ΔM15 proAB + / supE Δ( hsdM - mcrB ) 5 (r K − m K + msrB ) thi Δ( lac-pro AB) Promega pGEM-T PCR product cloning vector; Amp r Promega pHP45ΩTc Tetracycline resistance 9 pND7 pGEM-T with 400-bp fragment of A. vinelandii ndh ; Amp r This work pNDT6 pND7 with ΩTc inserted in Sma I site of ndh fragment; Amp r Tc r This work Open in a separate window Bacterial strains and plasmids used in this study K Lα .

Techniques: Clone Assay, Plasmid Preparation

Journal:

Article Title: The Hfq-Dependent Small Noncoding RNA NrrF Directly Mediates Fur-Dependent Positive Regulation of Succinate Dehydrogenase in Neisseria meningitidis ▿

doi: 10.1128/JB.00849-08

Figure Lengend Snippet: (A) Diagrammatic representation of the locus containing the nrrF gene in MC58. The Fur-regulated promoter is indicated in gray, the orientation of the sRNA is indicated with a black arrow, and the relative position of the rho-independent transcriptional terminator is marked with a hairpin loop. (B) Mapping of the 5′ end of the nrrF transcript by primer extension. Portions (20 μg) of total RNA prepared from cultures of the wild type (MC58) and Fur-null mutant (MC-Fko) grown to mid-logarithmic phase under iron-replete conditions were hybridized with the sR-p7 primer (Table ​(Table1)1) and elongated with reverse transcriptase. The elongated primer band mapping the 5′ end of the sRNA transcript is indicated. Sequence reactions (G, A, T, and C) were performed with the same primer on plasmid pGemsRNA1/2 as a template. The corresponding +1 nucleotide of transcriptional initiation and the upstream promoter sequences are indicated on the left. (C) DNase I footprinting analysis with purified meningococcal Fur protein and a radioactively labeled 245-bp DNA probe, 5′ end labeled at the EcoRI site, corresponding to the nrrF promoter region. The probe was incubated with increasing concentrations of Fur protein: lanes 1 to 6 correspond to concentrations of 0, 14 nM, 44 nM, 130 nM, 392 nM, and 1.2 μM concentrations of Fur protein. A G+A sequencing reaction (19) of the probe was performed and run in parallel as a molecular weight ladder. The box and arrow to the left show the position and the direction of the Fur-box and nrrF gene, respectively. The Fur-protected region is indicated to the right as a vertical black bar, and the numbers indicate the boundaries of the binding site with respect to the +1 transcriptional initiation site. (D) Regulation of NrrF transcription. Total RNA was prepared from the wild type (MC58), the Fur-null mutant (MC-Fko), its complemented derivative (MC-Fko-C), the Hfq mutant (Δhfq), and the Fur and Hfq double mutant (Fko-Δhfq) grown to mid-log phase under iron-replete conditions before (+) and after (−) 15 min of treatment with iron chelator (2,2′-dipyridyl). Then, 10 μg of RNA from each strain was reverse transcribed with the sR-p7 primer, and the relative quantities of extended primer product are shown from a single representative experiment. (E) Time course experiment in which cultures of MC58 and MC-Fko strains were grown in iron-replete conditions and total RNA was extracted after 1, 2, and 3 h (logarithmic phase) and 5 and 7 h (stationary phase). The relative quantities of NrrF and tbp2 transcripts were analyzed from 10 μg of each total RNA sample by quantitative primer extension and S1 nuclease assay, respectively.

Article Snippet: In order to study the implications of this sRNA in Fur-mediated regulation, we selected the sdhCDAB operon as a probable target for the sRNA and selected sodB for the detailed analysis of Fur-mediated positive regulation. table ft1 table-wrap mode="anchored" t5 TABLE 2. caption a7 Strain or plasmid Relevant characteristics a Source or reference Strains N. meningitidis MC58 Clinical isolate, sequenced strain 35 MC-Fko Fur-null mutant derivative of MC58, Km r 5 MC-Fko-C Complemented Fur mutant, Km r Cm r 5 Δ hfq Hfq-null mutant of MC58, Cm r This study Fko-Δ hfq Fur and Hfq double mutant of MC58, Km r Cm r This study MC-sRN2 NrrF null of MC58, Ery r This study Fko-sRN2 Fur and NrrF double mutant of MC58, Km r Ery r This study E. coli DH5-α supE44 hsdR17 recA1 endA1 gyrA96 thi-1 relA1 13 BL21(DE3) hsdS gal (λ c I ts 857 ind1 S am7 nin-5 lac UV5-T7 gene 1 ) 33 Plasmids pGEM-T Cloning vector, Amp r Promega pGEMsrna1/2 pGEM-T derivative containing the promoter of the nrrF gene amplified with primers sRNA1 and sRNA2 This study pGem-SDH pGEM-T derivative containing the promoter of the succinate dehydrogenase operon amplified with the primers SDH-1 and SDH-2 This study psRN2ko:Erm Construct for generating knockout of the nrrF gene This study pΔhfqko:Cm Construct for generating knockout of the hfq gene This study pET15b Expression vector for N-terminal His-tagged proteins Invitrogen pET15hfq pET15b derivative containing the hfq gene amplified from the MC58 genome with primers Hfq-F/Hfq-R and cloned as an NdeI-XhoI fragment for expression of recombinant Hfq protein This study pGemSOD pGEM-T derivative containing promoter of the sodB gene amplified with the primers sod-1 and sod-2 This study pGemSdA pGEMT- derivative containing a cloned region of the sdhA gene, spanning from positions 64 to 267 with respect to the ATG start site, amplified with the primers sdA-F and sdA-R This study Open in a separate window a Cm r , chloramphenicol resistance; Amp r , ampicillin resistance; Ery r , erythromycin resistance; Km r , kanamycin resistance.

Techniques: Mutagenesis, Sequencing, Plasmid Preparation, Footprinting, Purification, Labeling, Incubation, Molecular Weight, Binding Assay, Nuclease Assay

Journal: Bioengineered Bugs

Article Title: Homologous expression of aspartokinase ( ask ) gene in Streptomyces clavuligerus and its hom -deleted mutant

doi: 10.4161/bbug.1.3.11244

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: Table 1 Strains & plasmids Description Source or reference Strains S. clavuligerus NRRL 3585 Wild type, cephamycin C and clavulanic acid producer Higgins and Kastner 32 AK39 Null mutant of S. clavuligerus NRRL 3585, hom::kan Yilmaz et al. 17 TB3585 S. clavuligerus NRRL 3585 carrying pTB486, Thio R This study BA39 S. clavuligerus AK39 carrying pTB486, Thio R , Kan R This study TBV S. clavuligerus NRRL 3585 carrying pIJ486, Thio R This study BAV S. clavuligerus AK39 carrying pIJ486, Thio R , Kan R This study E. coli ESS β-lactam supersensitive E. coli strain Aharonowitz and Demain 18 ET12567 F − , dam 13::Tn 9 dcm-6 hsdM hsdR lacYI Prof. K. Chater, John Innes Centre, Colney, Norwich, UK Plasmids pGEM-T Amp R , lacZ′ Promega pBluescript II KS (+) pBluescript II KS (+) Stratagene pTBKS pBluescript II KS carrying 1,506 bp S. clavuligerus ask gene This study pIJ486 Streptomyces plasmid vector, pIJ101 replicon, Thio R Prof. K. Chater, John Innes Centre, Colney, Norwich, UK pNST102 pBluescript II KS carrying 3,500 bp S. clavuligerus ask-asd cluster Tunca et al. 11 pTB486 pIJ486 carrying 1,506 bp S. clavuligerus ask gene This study Open in a separate window Bacterial strains and plasmids used in this study.

Techniques: Mutagenesis, Plasmid Preparation

Journal:

Article Title: YycH and YycI Interact To Regulate the Essential YycFG Two-Component System in Bacillus subtilis ▿ †

doi: 10.1128/JB.01936-06

Figure Lengend Snippet: Plasmids used in this study

Article Snippet: pUT18-c , T18 expressing two-hybrid vector; Amp r , Hybrigenics.

Techniques: Clone Assay, Plasmid Preparation, Expressing

Journal: International Journal of Molecular Sciences

Article Title: Functional Identification of Proteus mirabilis eptC Gene Encoding a Core Lipopolysaccharide Phosphoethanolamine Transferase

doi: 10.3390/ijms15046689

Figure Lengend Snippet: PCR amplification using oligonucleotides pair F1 eptC -R1 eptC and DNA template from P. mirabilis strains R110 (Lane 2), 50/57 (Lane 3), 51/57 (Lane 4), and TG83 (Lane 5). Lane 1, molecular weight standard.

Article Snippet: pGEMT easy , PCR generated DNA fragment cloning vector Amp R , Promega .

Techniques: Amplification, Molecular Weight

Journal: International Journal of Molecular Sciences

Article Title: Functional Identification of Proteus mirabilis eptC Gene Encoding a Core Lipopolysaccharide Phosphoethanolamine Transferase

doi: 10.3390/ijms15046689

Figure Lengend Snippet: Bacterial strains and plasmids used.

Article Snippet: pGEMT easy , PCR generated DNA fragment cloning vector Amp R , Promega .

Techniques: Plasmid Preparation, Mutagenesis, Generated, Clone Assay, Expressing

Journal: Frontiers in Cellular and Infection Microbiology

Article Title: Implication of the Type IV Secretion System in the Pathogenicity of Vibrio tapetis , the Etiological Agent of Brown Ring Disease Affecting the Manila Clam Ruditapes philippinarum

doi: 10.3389/fcimb.2021.634427

Figure Lengend Snippet: Plasmids used in this study.

Article Snippet: pGEM-T® Promega , Amp R , lacZ , Promega.

Techniques: Plasmid Preparation, Derivative Assay, Conjugation Assay

Journal: mSphere

Article Title: A PorX/PorY and σ P Feedforward Regulatory Loop Controls Gene Expression Essential for Porphyromonas gingivalis Virulence

doi: 10.1128/mSphere.00428-21

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: pGEM-T-Easy , rep pMB1 , f1 Amp R lacZ-α , Promega.

Techniques: Plasmid Preparation

Journal:

Article Title: A Second [2Fe-2S] Ferredoxin from Sphingomonas sp. Strain RW1 Can Function as an Electron Donor for the Dioxin Dioxygenase

doi:

Figure Lengend Snippet: E. coli strains and plasmids used in this study

Article Snippet: The bacterial strains, plasmids, and oligonucleotides used in this study are listed in Table and . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant genotype or characteristics Source or reference Strains BL21(DE3) F − ompT [ lon ] hsdS B (r B − m B − ; an E. coli B strain) with DE3 prophage Novagen DH5α F − endA1 hsdR17 (r K − m K + ) supE44 thi-1 λ − recA1 gyrA96 relA1 Δ( argF-lacZYA ) U169 φ80d lacZ ΔM15 Gibco BRL Plasmids pBluescript II KS Amp r lac′IPOZ′ , expression vector Stratagene pET9a Km r , T7 RNA polymerase promoter, expression vector Novagen pGEM-T Amp r , T7 RNA polymerase promoter, T-cloning vector Promega pAJ104 Km r , expression vector derived from pET9a encompassing fdx1 4 pAJ108 Tc r , cosmid vector derived from pLARF3 encompassing redA2 5 pAJ111 Km r , expression vector derived from pET9a encompassing redA2 5 pAJ114 Tc r , cosmid vector derived from pLARF3 encompassing fdx3 2 pAJ127 Km r , expression vector derived from pBBR1-MCS encompassing dxnA1A2 2 pAJ128 1.29-kb redA2 Eco RI- Not I PCR-amplified fragment into pGEM-T 2 pAJ129 0.33-kb fdx1 Not I- Bam HI PCR-amplified fragment into pGEM-T 2 pAJ130 Inserts from pAJ129 and pAJ128 cloned into pBluescript 2 pAJ146 0.34-kb fdx3 Nde I- Bam HI PCR-amplified fragment into pGEM-T This study pAJ147 0.33-kb fdx3 Nde I- Bam HI fragment from pAJ146 cloned into pET9a This study pAJ148 0.56-kb fdx3 Not I- Bam HI PCR-amplified fragment into pGEM-T This study pAJ149 Inserts from pAJ148 and pAJ128 cloned into pBluescript This study Open in a separate window E. coli strains and plasmids used in this study table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Oligonucleotide Primer sequence a Hybridization region AJ286 cggg catATG CCCAAAGTAATTTATG 5′ end of fdx3 Nde I AJ287 gcgc ggatcc GTTCAATCAAGATTGTTG 3′ end of fdx3 Bam HI AJ316 cccc ggatcc atgat gcggccGC CAGATTCTAGACCGGGATCAG 3′ end of redA2 Bam HI Not I AJ317 cgcg gaaTTC TGGAAGAGAAGGAAAG 5′ end of redA2 Eco RI AJ320 ccgg gcggccGC TCAATCTGATGCACCA 5′ end of fdx3 Not I AJ321 cgcc ggaTCC CATTAGAGATTACATCT 3′ end of fdx3 Bam HI Open in a separate window a Relevant recognition sequences for the restriction enzymes are underlined, and lowercase characters indicate the nonhomologous sequences to the corresponding DNA region from Sphingomonas sp. strain RW1.

Techniques: Plasmid Preparation, Expressing, Derivative Assay, Clone Assay