alg2 Search Results


92
Thermo Fisher gene exp alg2 hs00263798 m1
List of predicted target genes of the 8‐miRNA signature with significant prognostic impact. Cox univariate regression model outcomes using OS and gene expression data of predicted target genes as continuous variables in 63 NENs are shown. Hazard ratios (HR) and P ‐values are shown as well as the adjusted statistical significance (FDR). Twenty‐eight predicted target genes had significant prognostic impact ( P < 0.05): 12 were associated with a poorer prognosis and 16 were associated with better outcome.
Gene Exp Alg2 Hs00263798 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp alg2 hs00263798 m1/product/Thermo Fisher
Average 92 stars, based on 1 article reviews
gene exp alg2 hs00263798 m1 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

93
R&D Systems anti alg2
List of predicted target genes of the 8‐miRNA signature with significant prognostic impact. Cox univariate regression model outcomes using OS and gene expression data of predicted target genes as continuous variables in 63 NENs are shown. Hazard ratios (HR) and P ‐values are shown as well as the adjusted statistical significance (FDR). Twenty‐eight predicted target genes had significant prognostic impact ( P < 0.05): 12 were associated with a poorer prognosis and 16 were associated with better outcome.
Anti Alg2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti alg2/product/R&D Systems
Average 93 stars, based on 1 article reviews
anti alg2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

94
Proteintech alg2 pdcd6
List of predicted target genes of the 8‐miRNA signature with significant prognostic impact. Cox univariate regression model outcomes using OS and gene expression data of predicted target genes as continuous variables in 63 NENs are shown. Hazard ratios (HR) and P ‐values are shown as well as the adjusted statistical significance (FDR). Twenty‐eight predicted target genes had significant prognostic impact ( P < 0.05): 12 were associated with a poorer prognosis and 16 were associated with better outcome.
Alg2 Pdcd6, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/alg2 pdcd6/product/Proteintech
Average 94 stars, based on 1 article reviews
alg2 pdcd6 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

96
Proteintech tbst
List of predicted target genes of the 8‐miRNA signature with significant prognostic impact. Cox univariate regression model outcomes using OS and gene expression data of predicted target genes as continuous variables in 63 NENs are shown. Hazard ratios (HR) and P ‐values are shown as well as the adjusted statistical significance (FDR). Twenty‐eight predicted target genes had significant prognostic impact ( P < 0.05): 12 were associated with a poorer prognosis and 16 were associated with better outcome.
Tbst, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tbst/product/Proteintech
Average 96 stars, based on 1 article reviews
tbst - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

92
Santa Cruz Biotechnology anti alg 2 antibodies
List of predicted target genes of the 8‐miRNA signature with significant prognostic impact. Cox univariate regression model outcomes using OS and gene expression data of predicted target genes as continuous variables in 63 NENs are shown. Hazard ratios (HR) and P ‐values are shown as well as the adjusted statistical significance (FDR). Twenty‐eight predicted target genes had significant prognostic impact ( P < 0.05): 12 were associated with a poorer prognosis and 16 were associated with better outcome.
Anti Alg 2 Antibodies, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti alg 2 antibodies/product/Santa Cruz Biotechnology
Average 92 stars, based on 1 article reviews
anti alg 2 antibodies - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

88
Santa Cruz Biotechnology human alg 2 sirna
List of predicted target genes of the 8‐miRNA signature with significant prognostic impact. Cox univariate regression model outcomes using OS and gene expression data of predicted target genes as continuous variables in 63 NENs are shown. Hazard ratios (HR) and P ‐values are shown as well as the adjusted statistical significance (FDR). Twenty‐eight predicted target genes had significant prognostic impact ( P < 0.05): 12 were associated with a poorer prognosis and 16 were associated with better outcome.
Human Alg 2 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human alg 2 sirna/product/Santa Cruz Biotechnology
Average 88 stars, based on 1 article reviews
human alg 2 sirna - by Bioz Stars, 2026-03
88/100 stars
  Buy from Supplier

95
Thermo Fisher gene exp alg2 hs00904548 m1
Expression level of selected genes with the most changed activity profile after 1, 24 and 48 h treatment with 0.05% DMSO of HDFa. Normalised to untreated cells, relative genome microarray values ± standard deviation from n = 3 denote differences for samples incubated with 0.05% DMSO. Alterations in mRNA levels of genes are referred to FC ≤ 0.7 ( A ) and FC ≥ 1.3 ( B ) with the p -value < 0.05.
Gene Exp Alg2 Hs00904548 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp alg2 hs00904548 m1/product/Thermo Fisher
Average 95 stars, based on 1 article reviews
gene exp alg2 hs00904548 m1 - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

86
Aviva Systems antibody against alg2
( A ) Graphical representation of homozygous regions shared by Cases 3, 4 and 5 (autozygosity analysis performed before the birth of Case 6) generated using the AutoSNPa program. Shared blocks of homozygous single nucleotide polymorphisms are shown as red bars. The most significant homozygous region is on 9q31.1 (genomic location 100114051–105435311) is 27 Mb long and contains 283 genes (denoted by asterisk). ( B ) Sequence analysis in the c.214_226delGGGGACTGGCTGCinsAGTCCCCGGC p.72_75delGDWLinsSPR region for members of Family 2. Cases 3–6 are homozygous for this indel, whereas their parents (second cousins) and unaffected siblings are heterozygous. Asterisk denotes the individual in which exome sequencing was performed (Case 5). ( C ) Location of mutations for Families 2 and 3 in <t>ALG2.</t> ALG2 amino acid residues p.Val68 and p.72_75GDWL are conserved across species. Alignment of protein sequence flanking p.72_75GDWL from several species was carried out using ClustalW. Colours indicate per cent identity and were introduced using JalView. Residue numbering is according to the human protein.
Antibody Against Alg2, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody against alg2/product/Aviva Systems
Average 86 stars, based on 1 article reviews
antibody against alg2 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

92
Proteintech anti alg2 antibody
( A ) Graphical representation of homozygous regions shared by Cases 3, 4 and 5 (autozygosity analysis performed before the birth of Case 6) generated using the AutoSNPa program. Shared blocks of homozygous single nucleotide polymorphisms are shown as red bars. The most significant homozygous region is on 9q31.1 (genomic location 100114051–105435311) is 27 Mb long and contains 283 genes (denoted by asterisk). ( B ) Sequence analysis in the c.214_226delGGGGACTGGCTGCinsAGTCCCCGGC p.72_75delGDWLinsSPR region for members of Family 2. Cases 3–6 are homozygous for this indel, whereas their parents (second cousins) and unaffected siblings are heterozygous. Asterisk denotes the individual in which exome sequencing was performed (Case 5). ( C ) Location of mutations for Families 2 and 3 in <t>ALG2.</t> ALG2 amino acid residues p.Val68 and p.72_75GDWL are conserved across species. Alignment of protein sequence flanking p.72_75GDWL from several species was carried out using ClustalW. Colours indicate per cent identity and were introduced using JalView. Residue numbering is according to the human protein.
Anti Alg2 Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti alg2 antibody/product/Proteintech
Average 92 stars, based on 1 article reviews
anti alg2 antibody - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

95
Proteintech alix
( A ) Graphical representation of homozygous regions shared by Cases 3, 4 and 5 (autozygosity analysis performed before the birth of Case 6) generated using the AutoSNPa program. Shared blocks of homozygous single nucleotide polymorphisms are shown as red bars. The most significant homozygous region is on 9q31.1 (genomic location 100114051–105435311) is 27 Mb long and contains 283 genes (denoted by asterisk). ( B ) Sequence analysis in the c.214_226delGGGGACTGGCTGCinsAGTCCCCGGC p.72_75delGDWLinsSPR region for members of Family 2. Cases 3–6 are homozygous for this indel, whereas their parents (second cousins) and unaffected siblings are heterozygous. Asterisk denotes the individual in which exome sequencing was performed (Case 5). ( C ) Location of mutations for Families 2 and 3 in <t>ALG2.</t> ALG2 amino acid residues p.Val68 and p.72_75GDWL are conserved across species. Alignment of protein sequence flanking p.72_75GDWL from several species was carried out using ClustalW. Colours indicate per cent identity and were introduced using JalView. Residue numbering is according to the human protein.
Alix, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/alix/product/Proteintech
Average 95 stars, based on 1 article reviews
alix - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

93
Novus Biologicals recombinant human alg2 protein
( A ) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with either scrambled siRNA as control (SCR) or ALIX siRNA for knockdown (ALIX KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified G3BP1 puncta. ( B ) Immunoblot analysis of phosphorylation of eIF2α (S51) and PKR (T446) in U2OS cells transfected with either scrambled siRNA as control (SCR) or ALIX siRNA for knockdown (ALIX KD ). Cells were treated with 2 mM LLOMe for 30 min. The level of phosphorylation of eIF2α (S51) and PKR (T446) was quantified based on three independent experiments. ( C ) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with scrambled siRNA as control (SCR), ALIX siRNA for knockdown (ALIX KD ) or TSG101 siRNA for knockdown (TSG101 KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. ( D ) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells transfected with scrambled siRNA as control (SCR), ALIX siRNA for knockdown (ALIX KD ) or TSG101 siRNA for knockdown (TSG101 KD ). Cells were treated with 2 mM LLOMe for 30 min. The level of phosphorylation of eIF2α (S51) was quantified based on three independent experiments. ( E ) (i) Quantification by HCM of G3BP1 puncta in U2OS cells pre-treated with 15 µM BAPTA-AM for 1 h, subjected to 2 mM LLOMe treatment for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. (ii) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells as described in (i) and was quantified based on three independent experiments. ( F ) (i) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with scrambled siRNA as control (SCR), or <t>ALG2</t> siRNA for knockdown (ALG2 KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. (ii) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells as described in (i) and was quantified based on three independent experiments. ( G ) Schematic summary of the findings in Figs. 4 and . NT, untreated cells. CTR, control. Data, means ± SEM ( n = 3); HCM: n ≥ 3 (each experiment: 500 valid primary objects/cells per well, ≥5 wells/sample). † p ≥ 0.05 (not significant), ** p < 0.01, ANOVA. See also Fig. . .
Recombinant Human Alg2 Protein, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant human alg2 protein/product/Novus Biologicals
Average 93 stars, based on 1 article reviews
recombinant human alg2 protein - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
OriGene human alg 2
( A and B ) Representative images of immunohistochemical staining of <t>ALG-2</t> expression in breast cancer tissues (A) and adjacent tissues (B). Samples were classified into four groups based on ALG-2 staining intensity and the percentage of stained cells. ( C ) Quantification of ALG-2 expression in 95 breast cancer tissue samples and 46 adjacent tissue samples. ( D – J ) Analysis of correlations between ALG-2 expression and clinicopathological parameters, including the pTNM stage (D), histological grade (E), c-erb2 expression (F), lymph node metastasis (G), estrogen receptor positivity (H), progesterone receptor positivity (I), and p53 positivity (J). Error bars indicate means ± SEM.
Human Alg 2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human alg 2/product/OriGene
Average 90 stars, based on 1 article reviews
human alg 2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


List of predicted target genes of the 8‐miRNA signature with significant prognostic impact. Cox univariate regression model outcomes using OS and gene expression data of predicted target genes as continuous variables in 63 NENs are shown. Hazard ratios (HR) and P ‐values are shown as well as the adjusted statistical significance (FDR). Twenty‐eight predicted target genes had significant prognostic impact ( P < 0.05): 12 were associated with a poorer prognosis and 16 were associated with better outcome.

Journal: Molecular Oncology

Article Title: MicroRNA signature and integrative omics analyses define prognostic clusters and key pathways driving prognosis in patients with neuroendocrine neoplasms

doi: 10.1002/1878-0261.13393

Figure Lengend Snippet: List of predicted target genes of the 8‐miRNA signature with significant prognostic impact. Cox univariate regression model outcomes using OS and gene expression data of predicted target genes as continuous variables in 63 NENs are shown. Hazard ratios (HR) and P ‐values are shown as well as the adjusted statistical significance (FDR). Twenty‐eight predicted target genes had significant prognostic impact ( P < 0.05): 12 were associated with a poorer prognosis and 16 were associated with better outcome.

Article Snippet: Selected miRNA target genes were analysed in transiently transfected cell lines by RT of 1000 ng of RNA using the High‐Capacity cDNA Reverse Transcription Kit (Thermo Scientific) according to the manufacturer's instructions. cDNA was amplified using TaqMan Universal PCR mix (Thermo Scientific) and ALG2 (ref. Hs00263798_m1), RHOB (ref. Hs05051455_s1), REEP3 (ref. Hs00416535_m1), CRY2 (ref. Hs00901393_m1), AGFG2 (ref. Hs00968746_m1) and MINK1 (ref. Hs01093259_m1).

Techniques: Gene Expression

Validation of target genes of the eight prognostic miRNAs. (A) MiR‐17‐5p and miR‐19a‐3p regulate the expression of their predicted target genes in NENs cell lines. MiR‐17‐5p inhibitor was transfected for 48 into H727 and BON‐1 cell lines using lipofectamine ( n = 3). Treated BON‐1 and H727 cells showed a reduced expression of miR‐17‐5p at 48 h upon transfection. Accordingly, expression of candidate target genes CRY2 and AGFG2 was significantly increased in H727 cells and expression of MINK1 was significantly increased in BON‐1 cells. A nonsignificant increase of MINK1 and of CRY2 and AGFG2 was observed in H727 and BON‐1 cell lines, respectively. Similarly, miR‐19a‐3p inhibitor was transfected for 48 h into H727 and BON‐1 cell lines using lipofectamine ( n = 3). Treated BON‐1 and H727 cells showed a reduced expression of miR‐19a‐3p at 48 h upon transfection. Accordingly, the expression of candidate target genes ALG2 and REEP3 was increased in the BON‐1 and H727 cell line, although it did not reach statistical significance for REEP3 . No differences were observed in RHOB . MiRNA or target gene expression levels are expressed as 2 − Δ Δ C t on the y ‐axis using the negative control at each time as reference. The dotted line represents the NC (Negative Control) value. Mean ± SEM (Standard Error of the Mean) is shown. Student's t ‐tests between the negative control and inhibitor‐transfected cells at each time point were performed to evaluate differences, with P ‐values <0.05 considered statistically significant (* P < 0.05; *** P < 0.001; ns, nonsignificant). (B) Correlations between miRNAs and target gene expression were validated in silico in different solid tumours. We performed Pearson's correlation analyses for each miRNA/target gene pair in seven solid tumour TCGA cohorts. Heatmaps represent the miRNA‐target gene coefficient of our NEN cohort and of the seven TCGA cohorts. Inversely (left panel) and directly (right panel) correlated miRNA‐target genes are shown in the two heatmaps. The seven TCGA databases and our NEN cohort are shown in columns and miRNA‐target genes are shown in rows. Individual Pearson's correlation coefficient values are colour‐coded, ranging from red (positive correlation; max = 1) to green (negative correlation; min = −1). Overall, negatively correlated genes from our study were also negatively correlated in the TCGA samples (in green), and directly correlated genes from our study were also positively correlated in the TCGA (red). OV, ovarian serous cystadenocarcinoma; BRCA, breast invasive carcinoma; GBM, glioblastoma; KIRC, kidney renal clear cell carcinoma; LUSC, lung squamous cell carcinoma; COAD, colorectal adenocarcinoma; MRT, malignant rhabdoid tumor.

Journal: Molecular Oncology

Article Title: MicroRNA signature and integrative omics analyses define prognostic clusters and key pathways driving prognosis in patients with neuroendocrine neoplasms

doi: 10.1002/1878-0261.13393

Figure Lengend Snippet: Validation of target genes of the eight prognostic miRNAs. (A) MiR‐17‐5p and miR‐19a‐3p regulate the expression of their predicted target genes in NENs cell lines. MiR‐17‐5p inhibitor was transfected for 48 into H727 and BON‐1 cell lines using lipofectamine ( n = 3). Treated BON‐1 and H727 cells showed a reduced expression of miR‐17‐5p at 48 h upon transfection. Accordingly, expression of candidate target genes CRY2 and AGFG2 was significantly increased in H727 cells and expression of MINK1 was significantly increased in BON‐1 cells. A nonsignificant increase of MINK1 and of CRY2 and AGFG2 was observed in H727 and BON‐1 cell lines, respectively. Similarly, miR‐19a‐3p inhibitor was transfected for 48 h into H727 and BON‐1 cell lines using lipofectamine ( n = 3). Treated BON‐1 and H727 cells showed a reduced expression of miR‐19a‐3p at 48 h upon transfection. Accordingly, the expression of candidate target genes ALG2 and REEP3 was increased in the BON‐1 and H727 cell line, although it did not reach statistical significance for REEP3 . No differences were observed in RHOB . MiRNA or target gene expression levels are expressed as 2 − Δ Δ C t on the y ‐axis using the negative control at each time as reference. The dotted line represents the NC (Negative Control) value. Mean ± SEM (Standard Error of the Mean) is shown. Student's t ‐tests between the negative control and inhibitor‐transfected cells at each time point were performed to evaluate differences, with P ‐values <0.05 considered statistically significant (* P < 0.05; *** P < 0.001; ns, nonsignificant). (B) Correlations between miRNAs and target gene expression were validated in silico in different solid tumours. We performed Pearson's correlation analyses for each miRNA/target gene pair in seven solid tumour TCGA cohorts. Heatmaps represent the miRNA‐target gene coefficient of our NEN cohort and of the seven TCGA cohorts. Inversely (left panel) and directly (right panel) correlated miRNA‐target genes are shown in the two heatmaps. The seven TCGA databases and our NEN cohort are shown in columns and miRNA‐target genes are shown in rows. Individual Pearson's correlation coefficient values are colour‐coded, ranging from red (positive correlation; max = 1) to green (negative correlation; min = −1). Overall, negatively correlated genes from our study were also negatively correlated in the TCGA samples (in green), and directly correlated genes from our study were also positively correlated in the TCGA (red). OV, ovarian serous cystadenocarcinoma; BRCA, breast invasive carcinoma; GBM, glioblastoma; KIRC, kidney renal clear cell carcinoma; LUSC, lung squamous cell carcinoma; COAD, colorectal adenocarcinoma; MRT, malignant rhabdoid tumor.

Article Snippet: Selected miRNA target genes were analysed in transiently transfected cell lines by RT of 1000 ng of RNA using the High‐Capacity cDNA Reverse Transcription Kit (Thermo Scientific) according to the manufacturer's instructions. cDNA was amplified using TaqMan Universal PCR mix (Thermo Scientific) and ALG2 (ref. Hs00263798_m1), RHOB (ref. Hs05051455_s1), REEP3 (ref. Hs00416535_m1), CRY2 (ref. Hs00901393_m1), AGFG2 (ref. Hs00968746_m1) and MINK1 (ref. Hs01093259_m1).

Techniques: Biomarker Discovery, Expressing, Transfection, Targeted Gene Expression, Negative Control, In Silico

Expression level of selected genes with the most changed activity profile after 1, 24 and 48 h treatment with 0.05% DMSO of HDFa. Normalised to untreated cells, relative genome microarray values ± standard deviation from n = 3 denote differences for samples incubated with 0.05% DMSO. Alterations in mRNA levels of genes are referred to FC ≤ 0.7 ( A ) and FC ≥ 1.3 ( B ) with the p -value < 0.05.

Journal: International Journal of Molecular Sciences

Article Title: The Role of Dimethyl Sulfoxide (DMSO) in Gene Expression Modulation and Glycosaminoglycan Metabolism in Lysosomal Storage Disorders on an Example of Mucopolysaccharidosis

doi: 10.3390/ijms20020304

Figure Lengend Snippet: Expression level of selected genes with the most changed activity profile after 1, 24 and 48 h treatment with 0.05% DMSO of HDFa. Normalised to untreated cells, relative genome microarray values ± standard deviation from n = 3 denote differences for samples incubated with 0.05% DMSO. Alterations in mRNA levels of genes are referred to FC ≤ 0.7 ( A ) and FC ≥ 1.3 ( B ) with the p -value < 0.05.

Article Snippet: Real-time qRT-PCR was carried out with TaqMan Gene Expression Assays (Thermo Fisher Scientific, Foster City, CA, USA) with catalog numbers as follows: #4426961 (Hs00904548_m1, ALG2 ), #4331182 (Hs00970128_m1, ALG12 ), #4331182 (Hs00406036_m1, ARSK ), #4331182 (Hs00155245_m1, B4GALT1 ), #4331182 (Hs01921028_s1, CHST2 ), #4331182 (Hs00248144_m1, CHST15 ), #4331182 (Hs00609162_m1, EXT1 ), #4331182 (Hs00975732_m1, GALNS ), #4331182 (Hs00189537_m1, GALNT2 ), #4331182 (Hs00559726_s1, GALNT4 ), #4331182 (Hs99999909_m1, GALNT6 ), #4331182 (Hs00226436_m1, GALNT12 ), #4448892 (Hs00166197_m1, GM2A ), #4331182 (Hs00428900_m1, MAN2C1 ), #4331182 (Hs01100653_m1, MCOLN1 ), #4331182 (Hs00393705_m1, SGPL1 ), #4331182 (Hs01001189_m1, SLC7A5 ), #4331182 (Hs01027014_m1, SPTLC2 ), #4331182 (Hs00217867_m1, SPTLC3 ), #4331182 (Hs01105377_m1, ST3GAL5 ), #4331182 (Hs00383244_m1, ZKSCAN3 ), using the Light Cycler 480 II detection system (Roche Applied Science, Indianapolis, IN, USA).

Techniques: Expressing, Activity Assay, Microarray, Standard Deviation, Incubation, Gene Expression

Expression patterns of GAG metabolism- and lysosome-associated genes in HDFa treated with 0.05% DMSO for 1, 24 and 48 h, identified in microarray and real-time qRT-PCR analyses (bolded are values of FC ≤ 0.7 and FC ≥ 1.3, n = 3, with the p -value < 0.05).

Journal: International Journal of Molecular Sciences

Article Title: The Role of Dimethyl Sulfoxide (DMSO) in Gene Expression Modulation and Glycosaminoglycan Metabolism in Lysosomal Storage Disorders on an Example of Mucopolysaccharidosis

doi: 10.3390/ijms20020304

Figure Lengend Snippet: Expression patterns of GAG metabolism- and lysosome-associated genes in HDFa treated with 0.05% DMSO for 1, 24 and 48 h, identified in microarray and real-time qRT-PCR analyses (bolded are values of FC ≤ 0.7 and FC ≥ 1.3, n = 3, with the p -value < 0.05).

Article Snippet: Real-time qRT-PCR was carried out with TaqMan Gene Expression Assays (Thermo Fisher Scientific, Foster City, CA, USA) with catalog numbers as follows: #4426961 (Hs00904548_m1, ALG2 ), #4331182 (Hs00970128_m1, ALG12 ), #4331182 (Hs00406036_m1, ARSK ), #4331182 (Hs00155245_m1, B4GALT1 ), #4331182 (Hs01921028_s1, CHST2 ), #4331182 (Hs00248144_m1, CHST15 ), #4331182 (Hs00609162_m1, EXT1 ), #4331182 (Hs00975732_m1, GALNS ), #4331182 (Hs00189537_m1, GALNT2 ), #4331182 (Hs00559726_s1, GALNT4 ), #4331182 (Hs99999909_m1, GALNT6 ), #4331182 (Hs00226436_m1, GALNT12 ), #4448892 (Hs00166197_m1, GM2A ), #4331182 (Hs00428900_m1, MAN2C1 ), #4331182 (Hs01100653_m1, MCOLN1 ), #4331182 (Hs00393705_m1, SGPL1 ), #4331182 (Hs01001189_m1, SLC7A5 ), #4331182 (Hs01027014_m1, SPTLC2 ), #4331182 (Hs00217867_m1, SPTLC3 ), #4331182 (Hs01105377_m1, ST3GAL5 ), #4331182 (Hs00383244_m1, ZKSCAN3 ), using the Light Cycler 480 II detection system (Roche Applied Science, Indianapolis, IN, USA).

Techniques: Expressing, Microarray, Glycoproteomics

( A ) Graphical representation of homozygous regions shared by Cases 3, 4 and 5 (autozygosity analysis performed before the birth of Case 6) generated using the AutoSNPa program. Shared blocks of homozygous single nucleotide polymorphisms are shown as red bars. The most significant homozygous region is on 9q31.1 (genomic location 100114051–105435311) is 27 Mb long and contains 283 genes (denoted by asterisk). ( B ) Sequence analysis in the c.214_226delGGGGACTGGCTGCinsAGTCCCCGGC p.72_75delGDWLinsSPR region for members of Family 2. Cases 3–6 are homozygous for this indel, whereas their parents (second cousins) and unaffected siblings are heterozygous. Asterisk denotes the individual in which exome sequencing was performed (Case 5). ( C ) Location of mutations for Families 2 and 3 in ALG2. ALG2 amino acid residues p.Val68 and p.72_75GDWL are conserved across species. Alignment of protein sequence flanking p.72_75GDWL from several species was carried out using ClustalW. Colours indicate per cent identity and were introduced using JalView. Residue numbering is according to the human protein.

Journal: Brain

Article Title: Congenital myasthenic syndromes due to mutations in ALG2 and ALG14

doi: 10.1093/brain/awt010

Figure Lengend Snippet: ( A ) Graphical representation of homozygous regions shared by Cases 3, 4 and 5 (autozygosity analysis performed before the birth of Case 6) generated using the AutoSNPa program. Shared blocks of homozygous single nucleotide polymorphisms are shown as red bars. The most significant homozygous region is on 9q31.1 (genomic location 100114051–105435311) is 27 Mb long and contains 283 genes (denoted by asterisk). ( B ) Sequence analysis in the c.214_226delGGGGACTGGCTGCinsAGTCCCCGGC p.72_75delGDWLinsSPR region for members of Family 2. Cases 3–6 are homozygous for this indel, whereas their parents (second cousins) and unaffected siblings are heterozygous. Asterisk denotes the individual in which exome sequencing was performed (Case 5). ( C ) Location of mutations for Families 2 and 3 in ALG2. ALG2 amino acid residues p.Val68 and p.72_75GDWL are conserved across species. Alignment of protein sequence flanking p.72_75GDWL from several species was carried out using ClustalW. Colours indicate per cent identity and were introduced using JalView. Residue numbering is according to the human protein.

Article Snippet: Figure 7 Reduced expression of the ALG2p.Val68Gly variant. ( A ) Proteins in lysates from two controls muscles biopsies with no N-glycosylation defect or from a muscle biopsy from Case 7 were subject to western blot analysis probed with an antibody against ALG2 (Aviva Systems Biology). ( B ) HEK 293 cells transfected with wild-type or mutant ALG2 were subject to similar western blot analysis.

Techniques: Generated, Sequencing, Residue

Segregation of ALG2 c.203 T > G with disease within the pedigree of Family 3. Only the index case is homozygous for the variant. Sequence analysis in the c.203C > T region of five unaffected family members is shown. The index case (Case 7) and homozygous mutated nucleotide are indicated with arrows.

Journal: Brain

Article Title: Congenital myasthenic syndromes due to mutations in ALG2 and ALG14

doi: 10.1093/brain/awt010

Figure Lengend Snippet: Segregation of ALG2 c.203 T > G with disease within the pedigree of Family 3. Only the index case is homozygous for the variant. Sequence analysis in the c.203C > T region of five unaffected family members is shown. The index case (Case 7) and homozygous mutated nucleotide are indicated with arrows.

Article Snippet: Figure 7 Reduced expression of the ALG2p.Val68Gly variant. ( A ) Proteins in lysates from two controls muscles biopsies with no N-glycosylation defect or from a muscle biopsy from Case 7 were subject to western blot analysis probed with an antibody against ALG2 (Aviva Systems Biology). ( B ) HEK 293 cells transfected with wild-type or mutant ALG2 were subject to similar western blot analysis.

Techniques: Variant Assay, Sequencing

Reduced expression of the ALG2p.Val68Gly variant. ( A ) Proteins in lysates from two controls muscles biopsies with no N-glycosylation defect or from a muscle biopsy from Case 7 were subject to western blot analysis probed with an antibody against ALG2 (Aviva Systems Biology). ( B ) HEK 293 cells transfected with wild-type or mutant ALG2 were subject to similar western blot analysis. Transfection efficiency was normalized by co-transfection with EGFP. ( C ) Quantification of the data from transfected HEK 293 cells ( P = 0.0197, t -test, n = 3).

Journal: Brain

Article Title: Congenital myasthenic syndromes due to mutations in ALG2 and ALG14

doi: 10.1093/brain/awt010

Figure Lengend Snippet: Reduced expression of the ALG2p.Val68Gly variant. ( A ) Proteins in lysates from two controls muscles biopsies with no N-glycosylation defect or from a muscle biopsy from Case 7 were subject to western blot analysis probed with an antibody against ALG2 (Aviva Systems Biology). ( B ) HEK 293 cells transfected with wild-type or mutant ALG2 were subject to similar western blot analysis. Transfection efficiency was normalized by co-transfection with EGFP. ( C ) Quantification of the data from transfected HEK 293 cells ( P = 0.0197, t -test, n = 3).

Article Snippet: Figure 7 Reduced expression of the ALG2p.Val68Gly variant. ( A ) Proteins in lysates from two controls muscles biopsies with no N-glycosylation defect or from a muscle biopsy from Case 7 were subject to western blot analysis probed with an antibody against ALG2 (Aviva Systems Biology). ( B ) HEK 293 cells transfected with wild-type or mutant ALG2 were subject to similar western blot analysis.

Techniques: Expressing, Variant Assay, Muscles, Glycoproteomics, Western Blot, Transfection, Mutagenesis, Cotransfection

Alg14 and Alg2 are enriched at endplate regions in mouse muscle sections. ( A ) Mouse muscle sections were stained with an anti-Alg14 antibody (Abgent), or ( B ) with an anti-Alg2 antibody (Santa Cruz Biotechnology). Secondary antibodies were Alexa Fluor®488 conjugated anti-rabbit from Invitrogen (green). AChRs at the neuromuscular junctions were visualized by staining with an Alexa Fluor®594 conjugated α-Bungarotoxin (red).

Journal: Brain

Article Title: Congenital myasthenic syndromes due to mutations in ALG2 and ALG14

doi: 10.1093/brain/awt010

Figure Lengend Snippet: Alg14 and Alg2 are enriched at endplate regions in mouse muscle sections. ( A ) Mouse muscle sections were stained with an anti-Alg14 antibody (Abgent), or ( B ) with an anti-Alg2 antibody (Santa Cruz Biotechnology). Secondary antibodies were Alexa Fluor®488 conjugated anti-rabbit from Invitrogen (green). AChRs at the neuromuscular junctions were visualized by staining with an Alexa Fluor®594 conjugated α-Bungarotoxin (red).

Article Snippet: Figure 7 Reduced expression of the ALG2p.Val68Gly variant. ( A ) Proteins in lysates from two controls muscles biopsies with no N-glycosylation defect or from a muscle biopsy from Case 7 were subject to western blot analysis probed with an antibody against ALG2 (Aviva Systems Biology). ( B ) HEK 293 cells transfected with wild-type or mutant ALG2 were subject to similar western blot analysis.

Techniques: Staining

( A ) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with either scrambled siRNA as control (SCR) or ALIX siRNA for knockdown (ALIX KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified G3BP1 puncta. ( B ) Immunoblot analysis of phosphorylation of eIF2α (S51) and PKR (T446) in U2OS cells transfected with either scrambled siRNA as control (SCR) or ALIX siRNA for knockdown (ALIX KD ). Cells were treated with 2 mM LLOMe for 30 min. The level of phosphorylation of eIF2α (S51) and PKR (T446) was quantified based on three independent experiments. ( C ) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with scrambled siRNA as control (SCR), ALIX siRNA for knockdown (ALIX KD ) or TSG101 siRNA for knockdown (TSG101 KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. ( D ) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells transfected with scrambled siRNA as control (SCR), ALIX siRNA for knockdown (ALIX KD ) or TSG101 siRNA for knockdown (TSG101 KD ). Cells were treated with 2 mM LLOMe for 30 min. The level of phosphorylation of eIF2α (S51) was quantified based on three independent experiments. ( E ) (i) Quantification by HCM of G3BP1 puncta in U2OS cells pre-treated with 15 µM BAPTA-AM for 1 h, subjected to 2 mM LLOMe treatment for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. (ii) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells as described in (i) and was quantified based on three independent experiments. ( F ) (i) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with scrambled siRNA as control (SCR), or ALG2 siRNA for knockdown (ALG2 KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. (ii) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells as described in (i) and was quantified based on three independent experiments. ( G ) Schematic summary of the findings in Figs. 4 and . NT, untreated cells. CTR, control. Data, means ± SEM ( n = 3); HCM: n ≥ 3 (each experiment: 500 valid primary objects/cells per well, ≥5 wells/sample). † p ≥ 0.05 (not significant), ** p < 0.01, ANOVA. See also Fig. . .

Journal: The EMBO Journal

Article Title: Calcium signaling from damaged lysosomes induces cytoprotective stress granules

doi: 10.1038/s44318-024-00292-1

Figure Lengend Snippet: ( A ) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with either scrambled siRNA as control (SCR) or ALIX siRNA for knockdown (ALIX KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified G3BP1 puncta. ( B ) Immunoblot analysis of phosphorylation of eIF2α (S51) and PKR (T446) in U2OS cells transfected with either scrambled siRNA as control (SCR) or ALIX siRNA for knockdown (ALIX KD ). Cells were treated with 2 mM LLOMe for 30 min. The level of phosphorylation of eIF2α (S51) and PKR (T446) was quantified based on three independent experiments. ( C ) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with scrambled siRNA as control (SCR), ALIX siRNA for knockdown (ALIX KD ) or TSG101 siRNA for knockdown (TSG101 KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. ( D ) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells transfected with scrambled siRNA as control (SCR), ALIX siRNA for knockdown (ALIX KD ) or TSG101 siRNA for knockdown (TSG101 KD ). Cells were treated with 2 mM LLOMe for 30 min. The level of phosphorylation of eIF2α (S51) was quantified based on three independent experiments. ( E ) (i) Quantification by HCM of G3BP1 puncta in U2OS cells pre-treated with 15 µM BAPTA-AM for 1 h, subjected to 2 mM LLOMe treatment for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. (ii) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells as described in (i) and was quantified based on three independent experiments. ( F ) (i) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with scrambled siRNA as control (SCR), or ALG2 siRNA for knockdown (ALG2 KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. (ii) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells as described in (i) and was quantified based on three independent experiments. ( G ) Schematic summary of the findings in Figs. 4 and . NT, untreated cells. CTR, control. Data, means ± SEM ( n = 3); HCM: n ≥ 3 (each experiment: 500 valid primary objects/cells per well, ≥5 wells/sample). † p ≥ 0.05 (not significant), ** p < 0.01, ANOVA. See also Fig. . .

Article Snippet: Recombinant Human ALIX protein (ab132534) from Abcam; Recombinant Human ALG2 Protein (H00085365-P01), Recombinant GST Epitope Tag Protein (NBC1-18537), Recombinant Human PACT His Protein (NBP2-51787) from NOVUS; Recombinant Human PKR Protein (LS-G22902-20) from LSBio.

Techniques: Transfection, Control, Knockdown, Western Blot

( A ) Quantification by HCM of LAMP2 in U2OS cells transfected with scrambled siRNA as control (SCR), or ALIX siRNA for knockdown (ALIX KD ). White masks, algorithm-defined cell boundaries; green masks, computer-identified LAMP2 puncta. ( B ) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with scrambled siRNA as control (SCR), CHMP2B siRNA for knockdown (CHMP2B KD ) or CHMP4B siRNA for knockdown (CHMP4B KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. ( C ) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS transfected with scrambled siRNA as control (SCR), CHMP2B siRNA for knockdown (CHMP2B KD ) or CHMP4B siRNA for knockdown (CHMP4B KD ), subjected to 2 mM LLOMe treatment for 30 min. ( D ) Quantification by HCM of ALIX puncta in U2OS cells transfected with scrambled siRNA as control (SCR), or ALG2 siRNA for knockdown (ALG2 KD ), or pre-treated with 15 µM BAPTA-AM for 1 h. Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified ALIX puncta. ( E ) (i) Quantification by HCM of G3BP1 puncta in U2OS ALIX knockdown cells (ALIX KD ) overexpressing FLAG or FLAG-ALIX. Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified G3BP1 puncta. (ii) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells as described in (i). ( F ) (i) Quantification by HCM of G3BP1 puncta in U2OS ALG2 knockdown cells (ALG2 KD ) overexpressing FLAG or FLAG-ALG2. Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified G3BP1 puncta. (ii) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells as described in (i). NT, untreated cells. Data, means ± SEM ( n = 3); HCM: n ≥ 3 (each experiment: 500 valid primary objects/cells per well, ≥5 wells/sample). † p ≥ 0.05 (not significant), ** p < 0.01, ANOVA. See also Fig. .

Journal: The EMBO Journal

Article Title: Calcium signaling from damaged lysosomes induces cytoprotective stress granules

doi: 10.1038/s44318-024-00292-1

Figure Lengend Snippet: ( A ) Quantification by HCM of LAMP2 in U2OS cells transfected with scrambled siRNA as control (SCR), or ALIX siRNA for knockdown (ALIX KD ). White masks, algorithm-defined cell boundaries; green masks, computer-identified LAMP2 puncta. ( B ) Quantification by HCM of G3BP1 puncta in U2OS cells transfected with scrambled siRNA as control (SCR), CHMP2B siRNA for knockdown (CHMP2B KD ) or CHMP4B siRNA for knockdown (CHMP4B KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; red masks, computer-identified G3BP1 puncta. ( C ) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS transfected with scrambled siRNA as control (SCR), CHMP2B siRNA for knockdown (CHMP2B KD ) or CHMP4B siRNA for knockdown (CHMP4B KD ), subjected to 2 mM LLOMe treatment for 30 min. ( D ) Quantification by HCM of ALIX puncta in U2OS cells transfected with scrambled siRNA as control (SCR), or ALG2 siRNA for knockdown (ALG2 KD ), or pre-treated with 15 µM BAPTA-AM for 1 h. Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified ALIX puncta. ( E ) (i) Quantification by HCM of G3BP1 puncta in U2OS ALIX knockdown cells (ALIX KD ) overexpressing FLAG or FLAG-ALIX. Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified G3BP1 puncta. (ii) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells as described in (i). ( F ) (i) Quantification by HCM of G3BP1 puncta in U2OS ALG2 knockdown cells (ALG2 KD ) overexpressing FLAG or FLAG-ALG2. Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified G3BP1 puncta. (ii) Immunoblot analysis of phosphorylation of eIF2α (S51) in U2OS cells as described in (i). NT, untreated cells. Data, means ± SEM ( n = 3); HCM: n ≥ 3 (each experiment: 500 valid primary objects/cells per well, ≥5 wells/sample). † p ≥ 0.05 (not significant), ** p < 0.01, ANOVA. See also Fig. .

Article Snippet: Recombinant Human ALIX protein (ab132534) from Abcam; Recombinant Human ALG2 Protein (H00085365-P01), Recombinant GST Epitope Tag Protein (NBC1-18537), Recombinant Human PACT His Protein (NBP2-51787) from NOVUS; Recombinant Human PKR Protein (LS-G22902-20) from LSBio.

Techniques: Transfection, Control, Knockdown, Western Blot

( A ) Co-IP analysis of interactions among ALIX, PKR and PACT during lysosomal damage. HEK293T cells expressing FLAG (control) or FLAG-ALIX were treated with 1 mM LLOMe for 30 min. Cell lysates were immunoprecipitated with anti-FLAG antibody and immunoblotted for indicated proteins. Quantification of IP analysis based on three independent experiments. ( B ) (i) Schematic diagram of ALIX mutants used in this study. FL (full length); Bro1 (Bro1 domain); V domain; PRD (proline-rich domain). Numbers, residue positions. (ii) Schematic illustration of the Ca 2+ /ALG-2-induced open conformation of ALIX. ( C ) Co-IP analysis of interactions among ALIX mutants, PKR and PACT during lysosomal damage. HEK293T cells expressing FLAG tagged ALIX mutants and Myc-PKR were treated with 1 mM LLOMe for 30 min. Cell lysates were immunoprecipitated with anti-FLAG antibody and immunoblotted for indicated proteins. Quantification of IP analysis based on three independent experiments. ( D ) GST pulldown assay of in vitro translated His-tagged PKR and His-tagged PACT with GST, GST-tagged ALIX, with or without GST-tagged ALG2 in the presence of 10 μM CaCl 2 . Quantification of the GST pulldown (the corresponding protein relative to its input) was performed based on three independent experiments. ( E ) Co-IP analysis of interactions between FLAG-PKR and PACT in HEK293T cells transfected with scrambled siRNA as control (SCR), or ALIX siRNA for knockdown (ALIX KD ) during lysosomal damage. Cells were treated with 1 mM LLOMe for 30 min. Cell lysates were immunoprecipitated with anti-FLAG antibody and immunoblotted for indicated proteins. Quantification of IP analysis based on three independent experiments. ( F ) Co-IP analysis of interactions between PKR and GFP-PACT in HEK293T cells transfected with FLAG, or FLAG-ALIX during lysosomal damage. Cells were treated with 1 mM LLOMe for 30 min. Cell lysates were immunoprecipitated with anti-GFP antibody and immunoblotted for indicated proteins. Quantification of IP analysis based on three independent experiments. ( G ) Analysis of proteins associated with purified lysosomes (LysoIP; TMEM192-3xHA) from HEK293T cells transfected with scrambled siRNA as control (SCR), or ALIX siRNA for knockdown (ALIX KD ). Cells were treated with 1 mM LLOMe for 30 min. Quantification of LysoIP analysis based on three independent experiments. ( H ) Schematic summary of the findings in Figs. 5 and . See also Fig. . † p ≥ 0.05 (not significant), * p < 0.05, ** p < 0.01, ANOVA. .

Journal: The EMBO Journal

Article Title: Calcium signaling from damaged lysosomes induces cytoprotective stress granules

doi: 10.1038/s44318-024-00292-1

Figure Lengend Snippet: ( A ) Co-IP analysis of interactions among ALIX, PKR and PACT during lysosomal damage. HEK293T cells expressing FLAG (control) or FLAG-ALIX were treated with 1 mM LLOMe for 30 min. Cell lysates were immunoprecipitated with anti-FLAG antibody and immunoblotted for indicated proteins. Quantification of IP analysis based on three independent experiments. ( B ) (i) Schematic diagram of ALIX mutants used in this study. FL (full length); Bro1 (Bro1 domain); V domain; PRD (proline-rich domain). Numbers, residue positions. (ii) Schematic illustration of the Ca 2+ /ALG-2-induced open conformation of ALIX. ( C ) Co-IP analysis of interactions among ALIX mutants, PKR and PACT during lysosomal damage. HEK293T cells expressing FLAG tagged ALIX mutants and Myc-PKR were treated with 1 mM LLOMe for 30 min. Cell lysates were immunoprecipitated with anti-FLAG antibody and immunoblotted for indicated proteins. Quantification of IP analysis based on three independent experiments. ( D ) GST pulldown assay of in vitro translated His-tagged PKR and His-tagged PACT with GST, GST-tagged ALIX, with or without GST-tagged ALG2 in the presence of 10 μM CaCl 2 . Quantification of the GST pulldown (the corresponding protein relative to its input) was performed based on three independent experiments. ( E ) Co-IP analysis of interactions between FLAG-PKR and PACT in HEK293T cells transfected with scrambled siRNA as control (SCR), or ALIX siRNA for knockdown (ALIX KD ) during lysosomal damage. Cells were treated with 1 mM LLOMe for 30 min. Cell lysates were immunoprecipitated with anti-FLAG antibody and immunoblotted for indicated proteins. Quantification of IP analysis based on three independent experiments. ( F ) Co-IP analysis of interactions between PKR and GFP-PACT in HEK293T cells transfected with FLAG, or FLAG-ALIX during lysosomal damage. Cells were treated with 1 mM LLOMe for 30 min. Cell lysates were immunoprecipitated with anti-GFP antibody and immunoblotted for indicated proteins. Quantification of IP analysis based on three independent experiments. ( G ) Analysis of proteins associated with purified lysosomes (LysoIP; TMEM192-3xHA) from HEK293T cells transfected with scrambled siRNA as control (SCR), or ALIX siRNA for knockdown (ALIX KD ). Cells were treated with 1 mM LLOMe for 30 min. Quantification of LysoIP analysis based on three independent experiments. ( H ) Schematic summary of the findings in Figs. 5 and . See also Fig. . † p ≥ 0.05 (not significant), * p < 0.05, ** p < 0.01, ANOVA. .

Article Snippet: Recombinant Human ALIX protein (ab132534) from Abcam; Recombinant Human ALG2 Protein (H00085365-P01), Recombinant GST Epitope Tag Protein (NBC1-18537), Recombinant Human PACT His Protein (NBP2-51787) from NOVUS; Recombinant Human PKR Protein (LS-G22902-20) from LSBio.

Techniques: Co-Immunoprecipitation Assay, Expressing, Control, Immunoprecipitation, Residue, GST Pulldown Assay, In Vitro, Transfection, Knockdown, Purification

( A ) AlphaFold 2 predicted the interaction between PKR and ALIX, with the C-terminal PRD domain removed. ( B ) AlphaFold 2 predicted the interaction between PACT and ALIX, with the C-terminal PRD domain removed. ( C ) GST pulldown assay of in vitro translated His-tagged PKR with GST or GST-tagged ALIX (i) or ALG2 (ii) in the presence of 10 μM CaCl 2 . ( D ) GST pulldown assay of in vitro translated His-tagged PACT with GST or GST-tagged ALIX (i) or ALG2 (ii) in the presence of 10 μM CaCl 2 . ( E ) Confocal microscopy imaging of GFP-PKR/PACT and ALIX in U2OS cells treated with 2 mM LLOMe for 30 min. Scale bar, 5 μm. ( F ) Quantification by HCM of ALIX puncta in U2OS cells transfected with scrambled siRNA as control (SCR), PKR siRNA for knockdown (PKR KD ), or PACT siRNA for knockdown (PACT KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified ALIX puncta. ( G ) Analysis of proteins associated with purified lysosomes (LysoIP; TMEM192-3xHA) from HEK293T ALIX knockdown cells (ALIX KD ) overexpressing FLAG or FLAG-ALIX. Cells were treated with 1 mM LLOMe for 1 h. NT, untreated cells. Data, means ± SEM ( n = 3); HCM: n ≥ 3 (each experiment: 500 valid primary objects/cells per well, ≥5 wells/sample). † p ≥ 0.05 (not significant), ANOVA. See also Fig. .

Journal: The EMBO Journal

Article Title: Calcium signaling from damaged lysosomes induces cytoprotective stress granules

doi: 10.1038/s44318-024-00292-1

Figure Lengend Snippet: ( A ) AlphaFold 2 predicted the interaction between PKR and ALIX, with the C-terminal PRD domain removed. ( B ) AlphaFold 2 predicted the interaction between PACT and ALIX, with the C-terminal PRD domain removed. ( C ) GST pulldown assay of in vitro translated His-tagged PKR with GST or GST-tagged ALIX (i) or ALG2 (ii) in the presence of 10 μM CaCl 2 . ( D ) GST pulldown assay of in vitro translated His-tagged PACT with GST or GST-tagged ALIX (i) or ALG2 (ii) in the presence of 10 μM CaCl 2 . ( E ) Confocal microscopy imaging of GFP-PKR/PACT and ALIX in U2OS cells treated with 2 mM LLOMe for 30 min. Scale bar, 5 μm. ( F ) Quantification by HCM of ALIX puncta in U2OS cells transfected with scrambled siRNA as control (SCR), PKR siRNA for knockdown (PKR KD ), or PACT siRNA for knockdown (PACT KD ). Cells were treated with 2 mM LLOMe for 30 min. White masks, algorithm-defined cell boundaries; green masks, computer-identified ALIX puncta. ( G ) Analysis of proteins associated with purified lysosomes (LysoIP; TMEM192-3xHA) from HEK293T ALIX knockdown cells (ALIX KD ) overexpressing FLAG or FLAG-ALIX. Cells were treated with 1 mM LLOMe for 1 h. NT, untreated cells. Data, means ± SEM ( n = 3); HCM: n ≥ 3 (each experiment: 500 valid primary objects/cells per well, ≥5 wells/sample). † p ≥ 0.05 (not significant), ANOVA. See also Fig. .

Article Snippet: Recombinant Human ALIX protein (ab132534) from Abcam; Recombinant Human ALG2 Protein (H00085365-P01), Recombinant GST Epitope Tag Protein (NBC1-18537), Recombinant Human PACT His Protein (NBP2-51787) from NOVUS; Recombinant Human PKR Protein (LS-G22902-20) from LSBio.

Techniques: GST Pulldown Assay, In Vitro, Confocal Microscopy, Imaging, Transfection, Control, Knockdown, Purification

Reagents and tools table

Journal: The EMBO Journal

Article Title: Calcium signaling from damaged lysosomes induces cytoprotective stress granules

doi: 10.1038/s44318-024-00292-1

Figure Lengend Snippet: Reagents and tools table

Article Snippet: Recombinant Human ALIX protein (ab132534) from Abcam; Recombinant Human ALG2 Protein (H00085365-P01), Recombinant GST Epitope Tag Protein (NBC1-18537), Recombinant Human PACT His Protein (NBP2-51787) from NOVUS; Recombinant Human PKR Protein (LS-G22902-20) from LSBio.

Techniques: Recombinant, Sequencing, Mutagenesis, Control, CRISPR, Staining, Magnetic Beads, Transfection, Lysis, Cytotoxicity Assay, Protease Inhibitor, Software

( A and B ) Representative images of immunohistochemical staining of ALG-2 expression in breast cancer tissues (A) and adjacent tissues (B). Samples were classified into four groups based on ALG-2 staining intensity and the percentage of stained cells. ( C ) Quantification of ALG-2 expression in 95 breast cancer tissue samples and 46 adjacent tissue samples. ( D – J ) Analysis of correlations between ALG-2 expression and clinicopathological parameters, including the pTNM stage (D), histological grade (E), c-erb2 expression (F), lymph node metastasis (G), estrogen receptor positivity (H), progesterone receptor positivity (I), and p53 positivity (J). Error bars indicate means ± SEM.

Journal: Oncotarget

Article Title: Apoptosis-linked gene 2 promotes breast cancer growth and metastasis by regulating the cytoskeleton

doi: 10.18632/oncotarget.13740

Figure Lengend Snippet: ( A and B ) Representative images of immunohistochemical staining of ALG-2 expression in breast cancer tissues (A) and adjacent tissues (B). Samples were classified into four groups based on ALG-2 staining intensity and the percentage of stained cells. ( C ) Quantification of ALG-2 expression in 95 breast cancer tissue samples and 46 adjacent tissue samples. ( D – J ) Analysis of correlations between ALG-2 expression and clinicopathological parameters, including the pTNM stage (D), histological grade (E), c-erb2 expression (F), lymph node metastasis (G), estrogen receptor positivity (H), progesterone receptor positivity (I), and p53 positivity (J). Error bars indicate means ± SEM.

Article Snippet: The retroviral plasmid for shRNA-mediated knockdown of human ALG-2, pGFP-V-RS-shALG-2, was constructed by insertion of the sequence CAGTGACTGTCAGGTCGATCATATCCATG (Origene) into the pGFP-V-RS vector.

Techniques: Immunohistochemical staining, Staining, Expressing

( A ) Immunoblot analysis of ALG-2 and α-tubulin in MDA-MB-231/shALG-2 and MDA-MB-231/shScramble cells. ( B ) MDA-MB-231/shALG-2 or MDA-MB-231/shScramble cells were injected subcutaneously into athymic nude mice, and photographs were taken 30 days later. ( C and D ) Mouse weight (C) and tumor volume (D) were measured every 5 days. ( E and F ) Tumors were isolated from mice sacrificed 30 days post-injection. Tumors were photographed (E), and tumor weight was measured (F). ( G ) Immunohistochemical staining of ALG-2 and Ki67 expression and HE staining of xenograft tumor sections. ( H ) Immunoblot analysis of mALG-2 and α-tubulin in 4T1-luc cells transfected with control or mALG-2 siRNAs. ( I ) 4T1-luc cells transfected with control or mALG-2 siRNAs were injected into BALB/c mice (5 per group). Luciferin was injected intraperitoneally to detect lung metastasis by bioluminescence imaging 6 days later. ( J ) Analysis of the luminescence photon flux. Error bars indicate means ± SEM. * p < 0.05.

Journal: Oncotarget

Article Title: Apoptosis-linked gene 2 promotes breast cancer growth and metastasis by regulating the cytoskeleton

doi: 10.18632/oncotarget.13740

Figure Lengend Snippet: ( A ) Immunoblot analysis of ALG-2 and α-tubulin in MDA-MB-231/shALG-2 and MDA-MB-231/shScramble cells. ( B ) MDA-MB-231/shALG-2 or MDA-MB-231/shScramble cells were injected subcutaneously into athymic nude mice, and photographs were taken 30 days later. ( C and D ) Mouse weight (C) and tumor volume (D) were measured every 5 days. ( E and F ) Tumors were isolated from mice sacrificed 30 days post-injection. Tumors were photographed (E), and tumor weight was measured (F). ( G ) Immunohistochemical staining of ALG-2 and Ki67 expression and HE staining of xenograft tumor sections. ( H ) Immunoblot analysis of mALG-2 and α-tubulin in 4T1-luc cells transfected with control or mALG-2 siRNAs. ( I ) 4T1-luc cells transfected with control or mALG-2 siRNAs were injected into BALB/c mice (5 per group). Luciferin was injected intraperitoneally to detect lung metastasis by bioluminescence imaging 6 days later. ( J ) Analysis of the luminescence photon flux. Error bars indicate means ± SEM. * p < 0.05.

Article Snippet: The retroviral plasmid for shRNA-mediated knockdown of human ALG-2, pGFP-V-RS-shALG-2, was constructed by insertion of the sequence CAGTGACTGTCAGGTCGATCATATCCATG (Origene) into the pGFP-V-RS vector.

Techniques: Western Blot, Injection, Isolation, Immunohistochemical staining, Staining, Expressing, Transfection, Imaging

( A and D ) Immunoblot analysis of ALG-2 and β-actin in MDA-MB-231 (A) and BT549 (D) cells. ( B and E ) Silencing of ALG-2 inhibits the proliferation of MDA-MB-231 (B) and BT549 (E) cells as determined by MTT and SRB assays. ( C and F ) Colony formation by control or ALG-2 siRNA-transfected MDA-MB-231 (C) and BT549 (F) cells cultured for 2 weeks. ( G and J ) Flow cytometric analysis of apoptosis in MDA-MB-231 (G) and BT549 (J) cells 72 hours after transfection with control or ALG-2 siRNAs. ( H and I ) Experiments were performed as in G, and the percentages of early apoptotic cells (annexin V-FITC+, propidium iodide-) and late apoptotic cells (annexin V-FITC+, propidium iodide+) were quantified. For each group, 1 × 10 5 cells were counted. ( K and L ) Experiments were performed as in J, and the percentages of early and late apoptotic cells were quantified. For each group, 1 × 10 5 cells were counted. Error bars indicate means ± SEM. * p < 0.05; ** p < 0.01; ns, not significant.

Journal: Oncotarget

Article Title: Apoptosis-linked gene 2 promotes breast cancer growth and metastasis by regulating the cytoskeleton

doi: 10.18632/oncotarget.13740

Figure Lengend Snippet: ( A and D ) Immunoblot analysis of ALG-2 and β-actin in MDA-MB-231 (A) and BT549 (D) cells. ( B and E ) Silencing of ALG-2 inhibits the proliferation of MDA-MB-231 (B) and BT549 (E) cells as determined by MTT and SRB assays. ( C and F ) Colony formation by control or ALG-2 siRNA-transfected MDA-MB-231 (C) and BT549 (F) cells cultured for 2 weeks. ( G and J ) Flow cytometric analysis of apoptosis in MDA-MB-231 (G) and BT549 (J) cells 72 hours after transfection with control or ALG-2 siRNAs. ( H and I ) Experiments were performed as in G, and the percentages of early apoptotic cells (annexin V-FITC+, propidium iodide-) and late apoptotic cells (annexin V-FITC+, propidium iodide+) were quantified. For each group, 1 × 10 5 cells were counted. ( K and L ) Experiments were performed as in J, and the percentages of early and late apoptotic cells were quantified. For each group, 1 × 10 5 cells were counted. Error bars indicate means ± SEM. * p < 0.05; ** p < 0.01; ns, not significant.

Article Snippet: The retroviral plasmid for shRNA-mediated knockdown of human ALG-2, pGFP-V-RS-shALG-2, was constructed by insertion of the sequence CAGTGACTGTCAGGTCGATCATATCCATG (Origene) into the pGFP-V-RS vector.

Techniques: Western Blot, Transfection, Cell Culture

( A and B ) MDA-MB-231 cells were transfected with RFP-ALG-2 or empty RFP vector (RFP-V) and stained with anti-γ-tubulin and anti-α-tubulin antibodies and DAPI. Arrows indicate unattached (A) or missegregated (B) chromosomes. ( C and D ) Experiments were performed as in A and B, and the percentages of cells with abnormal spindles (C) and abnormal chromosomes (D) were quantified. For each group, 100 mitotic cells were quantified. ( E and F ) MDA-MB-231 cells were transfected with RFP-ALG-2 or RFP-V and stained with anti-γ-tubulin (E) or anti-pericentrin antibodies (F) and DAPI. ( G and H ) Experiments were performed as in E and F, and the percentage of cells with abnormal localization of γ-tubulin (G) or pericentrin (H) was quantified. For each group, 300 cells were quantified. ( I and J ) MCF-10A cells were transfected with HA-ALG-2 or empty HA vector (HA-V) and stained with anti-γ-tubulin (I) or anti-pericentrin (J) antibodies and DAPI. ( K and L ) Experiments were performed as in I and J, and the percentage of cells with abnormal localization of γ-tubulin (K) or pericentrin (L) was quantified. For each group, 100 cells were quantified. ( M ) Immunofluorescence images of human breast cancer tissues stained with anti-γ-tubulin and anti-ALG-2 antibodies and DAPI. Dashed lines indicate cells with high ALG-2 expression. Error bars indicate means ± SEM. * p < 0.05; ** p < 0.01; *** p < 0.001.

Journal: Oncotarget

Article Title: Apoptosis-linked gene 2 promotes breast cancer growth and metastasis by regulating the cytoskeleton

doi: 10.18632/oncotarget.13740

Figure Lengend Snippet: ( A and B ) MDA-MB-231 cells were transfected with RFP-ALG-2 or empty RFP vector (RFP-V) and stained with anti-γ-tubulin and anti-α-tubulin antibodies and DAPI. Arrows indicate unattached (A) or missegregated (B) chromosomes. ( C and D ) Experiments were performed as in A and B, and the percentages of cells with abnormal spindles (C) and abnormal chromosomes (D) were quantified. For each group, 100 mitotic cells were quantified. ( E and F ) MDA-MB-231 cells were transfected with RFP-ALG-2 or RFP-V and stained with anti-γ-tubulin (E) or anti-pericentrin antibodies (F) and DAPI. ( G and H ) Experiments were performed as in E and F, and the percentage of cells with abnormal localization of γ-tubulin (G) or pericentrin (H) was quantified. For each group, 300 cells were quantified. ( I and J ) MCF-10A cells were transfected with HA-ALG-2 or empty HA vector (HA-V) and stained with anti-γ-tubulin (I) or anti-pericentrin (J) antibodies and DAPI. ( K and L ) Experiments were performed as in I and J, and the percentage of cells with abnormal localization of γ-tubulin (K) or pericentrin (L) was quantified. For each group, 100 cells were quantified. ( M ) Immunofluorescence images of human breast cancer tissues stained with anti-γ-tubulin and anti-ALG-2 antibodies and DAPI. Dashed lines indicate cells with high ALG-2 expression. Error bars indicate means ± SEM. * p < 0.05; ** p < 0.01; *** p < 0.001.

Article Snippet: The retroviral plasmid for shRNA-mediated knockdown of human ALG-2, pGFP-V-RS-shALG-2, was constructed by insertion of the sequence CAGTGACTGTCAGGTCGATCATATCCATG (Origene) into the pGFP-V-RS vector.

Techniques: Transfection, Plasmid Preparation, Staining, Immunofluorescence, Expressing

( A ) Wound healing assays using MDA-MB-231 and BT549 cells transfected with control or ALG-2 siRNAs. Wound margins were imaged 16 hours after wounding. ( B ) Experiments were performed as in A, and the percentage of wound closure was quantified. ( C ) Wound healing assays using 4T1-luc cells transfected with control or mALG-2 siRNAs. ( D ) Experiments were performed as in C, and the percentage of wound closure was quantified. ( E ) Wound healing assays using BT549 cells transfected with RFP-V or RFP-ALG-2. ( F ) Experiments were performed as in E, and the percentage of wound closure was quantified. ( G ) Transwell migration assays using MDA-MB-231 and BT549 cells transfected with control or ALG-2 siRNAs. ( H ) Experiments were performed as in G, and the extent of transwell migration was quantified. ( I ) Transwell migration assays using 4T1-luc cells transfected with control or mALG-2 siRNAs. ( J ) Experiments were performed as in I, and the extent of transwell migration was quantified. ( K – M ) Analysis of random migration of MDA-MB-231 cells. Cell movement paths were tracked (K), and the velocity of cell movement (L) and the accumulated distance were analyzed (M). Error bars indicate means ± SEM. * p < 0.05; ** p < 0.01; ns, not significant.

Journal: Oncotarget

Article Title: Apoptosis-linked gene 2 promotes breast cancer growth and metastasis by regulating the cytoskeleton

doi: 10.18632/oncotarget.13740

Figure Lengend Snippet: ( A ) Wound healing assays using MDA-MB-231 and BT549 cells transfected with control or ALG-2 siRNAs. Wound margins were imaged 16 hours after wounding. ( B ) Experiments were performed as in A, and the percentage of wound closure was quantified. ( C ) Wound healing assays using 4T1-luc cells transfected with control or mALG-2 siRNAs. ( D ) Experiments were performed as in C, and the percentage of wound closure was quantified. ( E ) Wound healing assays using BT549 cells transfected with RFP-V or RFP-ALG-2. ( F ) Experiments were performed as in E, and the percentage of wound closure was quantified. ( G ) Transwell migration assays using MDA-MB-231 and BT549 cells transfected with control or ALG-2 siRNAs. ( H ) Experiments were performed as in G, and the extent of transwell migration was quantified. ( I ) Transwell migration assays using 4T1-luc cells transfected with control or mALG-2 siRNAs. ( J ) Experiments were performed as in I, and the extent of transwell migration was quantified. ( K – M ) Analysis of random migration of MDA-MB-231 cells. Cell movement paths were tracked (K), and the velocity of cell movement (L) and the accumulated distance were analyzed (M). Error bars indicate means ± SEM. * p < 0.05; ** p < 0.01; ns, not significant.

Article Snippet: The retroviral plasmid for shRNA-mediated knockdown of human ALG-2, pGFP-V-RS-shALG-2, was constructed by insertion of the sequence CAGTGACTGTCAGGTCGATCATATCCATG (Origene) into the pGFP-V-RS vector.

Techniques: Transfection, Migration

( A ) MDA-MB-231 cells were transfected with control or ALG-2 siRNAs, and wound healing assays were performed. Cells were stained 3 hours after wounding with phalloidin (red), anti-α-tubulin antibody (green), and DAPI (blue). ( B ) Experiments were performed as in A, and the percentage of cells with typical lamellipodia was quantified. ( C ) Cells transfected with control or ALG-2 siRNAs were stained 3 hours after wounding with anti-γ-tubulin (red) and anti-α-tubulin (green) antibodies and DAPI (blue). ( D ) Experiments were performed as in C, and the percentage of cells at the wound margin with centrosomes localized in the forward-facing one-third of the cell was analyzed. ( E – H ) MDA-MB-231 cells transfected with control or ALG-2 siRNAs for 48 hours were incubated on ice to depolymerize microtubules. The intensity of the remaining microtubules was examined by staining with anti-α-tubulin antibody (E) and quantified using the Image J software (F). After complete microtubule depolymerization, cells were placed back at 37°C for the indicated time, and the intensity of microtubule regrowth was examined by staining with anti-α-tubulin antibody (G) and quantified using Image J (H). Error bars indicate means ± SEM. * p < 0.05; *** p < 0.001; ns, not significant.

Journal: Oncotarget

Article Title: Apoptosis-linked gene 2 promotes breast cancer growth and metastasis by regulating the cytoskeleton

doi: 10.18632/oncotarget.13740

Figure Lengend Snippet: ( A ) MDA-MB-231 cells were transfected with control or ALG-2 siRNAs, and wound healing assays were performed. Cells were stained 3 hours after wounding with phalloidin (red), anti-α-tubulin antibody (green), and DAPI (blue). ( B ) Experiments were performed as in A, and the percentage of cells with typical lamellipodia was quantified. ( C ) Cells transfected with control or ALG-2 siRNAs were stained 3 hours after wounding with anti-γ-tubulin (red) and anti-α-tubulin (green) antibodies and DAPI (blue). ( D ) Experiments were performed as in C, and the percentage of cells at the wound margin with centrosomes localized in the forward-facing one-third of the cell was analyzed. ( E – H ) MDA-MB-231 cells transfected with control or ALG-2 siRNAs for 48 hours were incubated on ice to depolymerize microtubules. The intensity of the remaining microtubules was examined by staining with anti-α-tubulin antibody (E) and quantified using the Image J software (F). After complete microtubule depolymerization, cells were placed back at 37°C for the indicated time, and the intensity of microtubule regrowth was examined by staining with anti-α-tubulin antibody (G) and quantified using Image J (H). Error bars indicate means ± SEM. * p < 0.05; *** p < 0.001; ns, not significant.

Article Snippet: The retroviral plasmid for shRNA-mediated knockdown of human ALG-2, pGFP-V-RS-shALG-2, was constructed by insertion of the sequence CAGTGACTGTCAGGTCGATCATATCCATG (Origene) into the pGFP-V-RS vector.

Techniques: Transfection, Staining, Incubation, Software