|
Thermo Fisher
ampicillin culture plates Ampicillin Culture Plates, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/Ampicillin/pmc07842800-60-54-77 Average 99 stars, based on 1 article reviews
ampicillin culture plates - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
Addgene inc
parent spcas9 variants Parent Spcas9 Variants, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/SP-Cas9+(Plasmid+%2362731)/pmc10505190__41467_2023_41393_MOESM1_ESM-134-22-25 Average 96 stars, based on 1 article reviews
parent spcas9 variants - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Addgene inc
grna plasmid ![]() Grna Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/MLM3636+(Plasmid+%2343860)/pmc08631662-233-13-18 Average 95 stars, based on 1 article reviews
grna plasmid - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
ATCC
vector pcmv cat t7 sb100 ![]() Vector Pcmv Cat T7 Sb100, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/Filobasidiella+neoformans+Kwon-Chung%2C+teleomorph/pmc07860133-94-39-55 Average 91 stars, based on 1 article reviews
vector pcmv cat t7 sb100 - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
|
Addgene inc
human ria alpha ![]() Human Ria Alpha, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/Human+MAC-1+alpha+(Plasmid+%238631)/pmc04477410-132-4-20 Average 90 stars, based on 1 article reviews
human ria alpha - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Sino Biological
plasmid ![]() Plasmid, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/Mouse+SIRT3+Gene+ORF+cDNA+clone+expression+plasmid%2C+C-HA+tag/pm34386777-270-13-15 Average 94 stars, based on 1 article reviews
plasmid - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Addgene inc
gateway technology ![]() Gateway Technology, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/pDEST2T18ms+(Plasmid+%2372647)/10__1094_slash_mpmi___05___24___0051___r-181-27-36 Average 93 stars, based on 1 article reviews
gateway technology - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Addgene inc
emmprin 2 ![]() Emmprin 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/psiCHECK+RHEBL1+3'UTR+(Plasmid+%2319858)/pmc03976259-87-27-17 Average 93 stars, based on 1 article reviews
emmprin 2 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
ATCC
experimental models mcf 7 p53 mvenus batchelor et ![]() Experimental Models Mcf 7 P53 Mvenus Batchelor Et, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/MCF7/pm40033003-164-12-34 Average 99 stars, based on 1 article reviews
experimental models mcf 7 p53 mvenus batchelor et - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
Addgene inc
f zhang ![]() F Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/lentiCRISPR+v2+(Plasmid+%2352961)/pm29180486-88-6-11 Average 96 stars, based on 1 article reviews
f zhang - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Addgene inc
pcl neo klf6 ![]() Pcl Neo Klf6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/flag-hKLF6+(1006)+(Plasmid+%2349488)/pm40553722-31-1-12 Average 93 stars, based on 1 article reviews
pcl neo klf6 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Addgene inc
full length laci ![]() Full Length Laci, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/addgene+number/pLS1+(Plasmid+%2331490)/pmc06739814-286-6-23 Average 90 stars, based on 1 article reviews
full length laci - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PLoS ONE
Article Title: The cellular prion protein interacts with and promotes the activity of Na,K-ATPases
doi: 10.1371/journal.pone.0258682
Figure Lengend Snippet: (A) Design of gRNA targeting PRNP coding sequence. (B) CRISPR-Cas9-based knockout of PrP in ReN VM cells. (C) Validation of PrP knockout in ReN VM cells. Note that PrP deficiency has no effect on steady-state ATP1A1 levels in this model. (D) PrP knockout diminishes 86 Rb + uptake in ReN VM cells. Depicted are normalized mean plus standard deviation. (E) Increased steady-state ATP1A1 levels in RML-infected Neuro2a cells. (F) Similar to PrP knockout, RML-infection of Neuro2a cells compromises 86 Rb + uptake, albeit to a lesser extent. Statistical analyses in subpanels of this figure were based on the two-tailed t-test applied to three biological replicates.
Article Snippet: Briefly, the selected gRNA human PrP ( CACTGGGGGCAGCCGATACCCGG ) was cloned into the
Techniques: Sequencing, CRISPR, Knock-Out, Biomarker Discovery, Standard Deviation, Infection, Two Tailed Test
Journal: Protein Science : A Publication of the Protein Society
Article Title: Homolog comparisons further reconcile in vitro and in vivo correlations of protein activities by revealing over‐looked physiological factors
doi: 10.1002/pro.3695
Figure Lengend Snippet: Ribbon and cartoon structures of LacI/GalR homologs. (a) The homodimer of the lactose repressor protein (LacI) (PDB ID 1EFA 16) is shown with one subunit as a gray ribbon and the other in green. On the “green” monomer, the linker region is shown in magenta. The DNA‐binding and regulatory domains used to construct the chimeras are indicated on the structure. Note that the regulatory domains mediate the dimerization needed to create a high affinity binding site for one DNA operator (blue ladder),16, 17, 18 as well as binding the allosteric effector (black spheres); below the effector, the position analogous to GalR E230 is indicated with blue spheres. The figure was rendered using UCSF Chimera.19 (b) The LacI protein structure has been rotated and zoomed to show positions 48, 52, 55, 58, and 61 in the linker region. Amino acids nearest the plane of the viewer are shown in magenta ball‐and‐stick; those facing towards the rear of the structure (on the partner linker region) are in green wireframe. (c) The domain structure of the wild‐type LacI homodimer is represented as a green cartoon; the PurR homodimer is represented in purple; and the GalR homodimer is represented in teal. These color schemes are used to indicate the source of the DNA binding domains (small ovals; LacI positions 1–44), linkers (bars; LacI positions 45–61), and regulatory domains (large ovals; PurR positions 60–340 or GalR positions 60–343) in the chimeric repressors “LLhP” and “LLhG.” All variants of LLhG in this manuscript contain the E62K mutation (“+K”), indicated by the yellow asterisk, as well as the “E230K” mutation (which is discussed in Section 3 and Section 4 and indicated on panel a)
Article Snippet: Plasmids expressing the coding regions of
Techniques: Binding Assay, Construct, Mutagenesis
Journal: Protein Science : A Publication of the Protein Society
Article Title: Homolog comparisons further reconcile in vitro and in vivo correlations of protein activities by revealing over‐looked physiological factors
doi: 10.1002/pro.3695
Figure Lengend Snippet: Comparison of LLhP and LLhG+K variants binding operator lacO 1. in vitro binding to lacO 1 versus values from in vivo repression assays for variants of LLhP (magenta squares) and LLhG+K (green circles); data were compiled from References 11, 12, 13, 14, 15. The data for wild‐type, tetrameric LacI (compiled from References 15, 20) are shown with a black triangle. The arrows outside the axes indicate that repression was enhanced as DNA binding affinity became tighter. In addition to altered affinity from amino acid changes, LLhP had enhanced binding in the presence of 0.4 mM corepressor hypoxanthine12, 14; values were determined +/− this effector; “plus” data are indicated with open squares. Solid lines represent the best fit to the data, and correlation coefficients are consistent with the linear relationship expected for the known in vivo concentrations.11, 21 The dashed black line is to aid visual extrapolation of the LLhG+K data to that of wild‐type LacI. Both X and Y error bars represent the standard deviations (std) of averages (avg) determined from at least three separate experiments; to generate this plot from the non‐logarithmic values reported in the cited references, errors were propagated as 0.434*(std)/(avg). Repression data were taken from Reference 15; note that this publication used a different normalization scale than the separate normalizations previously used for LLhP and LLhG+K in References 13, 14 so that data for the different chimeras could be directly compared to each other
Article Snippet: Plasmids expressing the coding regions of
Techniques: Comparison, Binding Assay, In Vitro, In Vivo
Journal: Protein Science : A Publication of the Protein Society
Article Title: Homolog comparisons further reconcile in vitro and in vivo correlations of protein activities by revealing over‐looked physiological factors
doi: 10.1002/pro.3695
Figure Lengend Snippet: Looping in the lac operon. (a) When dimeric repressor is bound to the lacO 1 DNA operator, transcription of the downstream lacZYA genes is repressed. (b) Dimeric repressor protein is capable of binding other sites in the Escherichia coli genome such as lacO 2, lacO 3 and nonspecific genomic DNA. (c) Tetrameric LacI can simultaneously bind two operator sites, leading to DNA looping. The regulatory domains of two wild‐type GalR dimers also have the capability to form protein–protein interactions via its regulatory domains, which provides another means to facilitate tetramerization and DNA looping. (d) Prior experiments indicated that LLhG+K has looping capabilities, similar to its parent protein GalR.10 Since DNA looping depends highly on interoperator spacing (x‐axis), in vivo repression can be altered by changing this distance. In the experiments shown, repression of the reporter gene was assessed using four strains of E. coli, each containing a lacZ gene under control of the lacO sym and lacO 2 operators with varied interoperator spacing (x axis). Values were normalized to a “no repressor” control and higher values represent increased repression. Note that LLhG+K repression was sensitive to changes in operator spacing, whereas LLhP was not
Article Snippet: Plasmids expressing the coding regions of
Techniques: Binding Assay, Protein-Protein interactions, In Vivo, Control
Journal: Protein Science : A Publication of the Protein Society
Article Title: Homolog comparisons further reconcile in vitro and in vivo correlations of protein activities by revealing over‐looked physiological factors
doi: 10.1002/pro.3695
Figure Lengend Snippet: Comparison of in vivo repression and in vitro binding for LLhG+K (top), LacI (middle), and LLhP (bottom) variants binding to various operators. For variant proteins, the K d values for binding to operators lacO sym (black circles), lacO disC (black squares), and lacO 2 (gray diamonds) are plotted against K d values for binding to operator lacO 1 (x axis values). Error bars on both the X and Y parameters represent one standard deviation of the average values. The lines are from linear regression of the data and slopes are shown on the plots. (Top) K d values for nine LLhG+K variants at five linker positions binding to operator lacO 1 are from Reference 11. K d values for lacO sym and lacO 2 are summarized in Table Table2.2. For lacO disC, most K d values were out of range for the binding assay and a lower limit is shown. The large black square (behind a gray diamond) highlights the V52P variant that had tighter lacO disC binding than the other variants. (Middle) K d values for 12 LacI variants at position 52 are from Reference 20. Note that the lacO sym data may be better described by a nonlinear curve and may reflect either a physical or technical limit to tightest possible binding. (Bottom) K d values for seven LLhP variants at three linker positions were determined in the absence (filled) and presence (white middle) of corepressor hypoxanthine (“HX”).12 Two positions had weak binding to lacO sym (“outliers,” gray diamonds”)
Article Snippet: Plasmids expressing the coding regions of
Techniques: Comparison, In Vivo, In Vitro, Binding Assay, Variant Assay, Standard Deviation
Journal: Protein Science : A Publication of the Protein Society
Article Title: Homolog comparisons further reconcile in vitro and in vivo correlations of protein activities by revealing over‐looked physiological factors
doi: 10.1002/pro.3695
Figure Lengend Snippet: Differences between measured and effective in vivo repressor concentrations. Ideal LLhP+HX binding curves were calculated from the lacO 1 K d values reported in Reference 12. The measured in vivo repressor protein concentration10, 15 is shown with the right‐most dashed line. The left‐most dashed lines shows the repressor protein concentration corresponding to the fractional operator occupancy estimated from the LLhP+HX in vivo repression data reported in Reference 15 and shown in Figure Figure22 of this manuscript. These calculations were performed as in Reference 11, using reporter gene levels in the absence of repressor protein to determine zero operator binding and repression by wild‐type tetrameric LacI to estimate 100% operator occupancy. (LacI looping does not alter this estimation; using zero reporter gene activity to estimate 100% occupancy yields similar results.) The center dashed line indicates the prior estimation of effective repressor concentration based on LLhG+K repression values11; this calculation failed to account for looping‐enhanced repression of LLhG+K variants. Binding to nonspecific genomic DNA accounts for some of the difference between measured and effective repressor concentrations11
Article Snippet: Plasmids expressing the coding regions of
Techniques: In Vivo, Binding Assay, Protein Concentration, Activity Assay, Concentration Assay