|
Cytiva Europe
multi adaptor vacuum manifold Multi Adaptor Vacuum Manifold, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/Adaptor/pmc13055399-200-33-36 Average 94 stars, based on 1 article reviews
multi adaptor vacuum manifold - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Eppendorf AG
adaptor primer 5 ggaatcagtcagtaattggagg Adaptor Primer 5 Ggaatcagtcagtaattggagg, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/Adaptor/10__1094_slash_phyto___99___10___1142-119-6-16 Average 96 stars, based on 1 article reviews
adaptor primer 5 ggaatcagtcagtaattggagg - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Bio-Rad
p 11 resin P 11 Resin, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/Flow+Adaptor/pmc07018016-67-30-35 Average 93 stars, based on 1 article reviews
p 11 resin - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Bio-Rad
hepta adaptor Hepta Adaptor, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/Hepta+Adaptor+for+PDS-1000%2FHe+System/pmc04726358-210-34-36 Average 93 stars, based on 1 article reviews
hepta adaptor - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Proteintech
samsn1 Samsn1, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/SAMSN1+Antibody/pmc11585779-115-30-36 Average 92 stars, based on 1 article reviews
samsn1 - by Bioz Stars,
2026-10
92/100 stars
|
Buy from Supplier |
|
MACHEREY NAGEL
quantofix Quantofix, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/Mains+adaptor+for+NANOCOLOR+TIC%E2%80%91Ex%2C+URYXXON+%2F+QUANTOFIX+Relax/pmc11123754-82-19-23 Average 93 stars, based on 1 article reviews
quantofix - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Novus Biologicals
mzb1 22 novus nbp2 90320 Mzb1 22 Novus Nbp2 90320, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/Proapoptotic+Caspase+Adaptor+Protein+Antibody+(022)/pm39438660-647-204-206 Average 93 stars, based on 1 article reviews
mzb1 22 novus nbp2 90320 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Bio-Rad
tube gel adapter Tube Gel Adapter, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/Tube+Gel+Adaptor/pmc02602769-102-22-25 Average 85 stars, based on 1 article reviews
tube gel adapter - by Bioz Stars,
2026-10
85/100 stars
|
Buy from Supplier |
|
Bio-Rad
truview disposable cuvettes Truview Disposable Cuvettes, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/trUView+Cuvette+Height+Adaptor/pm19735274-68-21-24 Average 93 stars, based on 1 article reviews
truview disposable cuvettes - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Proteintech
antibodies to bap31 ![]() Antibodies To Bap31, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/SH2B1+Antibody/pmc12839962-57-0-5 Average 93 stars, based on 1 article reviews
antibodies to bap31 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Bio-Rad
econo pac column adapter ![]() Econo Pac Column Adapter, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/Econo-Pac+Flow+Adaptor/pmc02700657-49-0-3 Average 93 stars, based on 1 article reviews
econo pac column adapter - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Proteintech
frs2 ![]() Frs2, supplied by Proteintech, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adaptor/FRS2+Antibody/pm37759450-58-47-50 Average 91 stars, based on 1 article reviews
frs2 - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cells
Article Title: BAP31 Modulates Mitochondrial Homeostasis Through PINK1/Parkin Pathway in MPTP Parkinsonism Mouse Models
doi: 10.3390/cells15020137
Figure Lengend Snippet: BAP31 is a potential regulatory factor mediating Parkinson’s disease in mice: ( a ) Reproductive flowchart of BAP31 fl/fl and Slc6a3cre-BAP31 fl/fl mice. ( b ) GO annotation classification histogram in the substantia nigra pars compacta of BAP31 fl/fl and Slc6a3cre-BAP31 fl/fl mice. ( c ) The KEGG enrichment analysis of differentially expressed genes in the substantia nigra pars compacta of BAP31 fl/fl and Scl6a3 cre-BAP31 fl/fl mice. ( d ) The volcanic pattern analysis of these differentially expressed genes. ( e ) The Venn diagrams of the sample database alongside the two Parkinson’s disease databases, GSE8397 -DEGs and GSE20164 -DEGs.
Article Snippet:
Techniques:
Journal: Cells
Article Title: BAP31 Modulates Mitochondrial Homeostasis Through PINK1/Parkin Pathway in MPTP Parkinsonism Mouse Models
doi: 10.3390/cells15020137
Figure Lengend Snippet: BAP31 deficiency increased behavioral dysfunction in MPTP-treated mice: ( a ) mRNA expression of BAP31 in primary DA neurons from Slc6a3cre-BAP31 fl/fl and BAP31 fl/fl analyzed by real-time PCR (BAP31 fl/fl mice, n = 3; Slc6a3cre-BAP31 fl/fl , n = 3). ( b ) Protein expression of BAP31 in primary DA neurons from Slc6a3cre-BAP31 fl/fl and BAP31 fl/fl , detected by WB (BAP31 fl/fl mice, n = 3; Slc6a3cre-BAP31 fl/fl , n = 3). ( c – f ) Behavioral results of 6-month-old Slc6a3cre-BAP31 fl/fl and BAP31 fl/fl mice injected with saline or MPTP (half male and female). ( c ) Walking time of the balance beam test. ( d ) Pole climbing test. ( e ) Rotating rod experiment. ( f ) The open-field test. (Experimental group: BAP31 fl/fl mice, n = 12; Slc6a3cre-BAP31 fl/fl mice, n = 12; BAP31 fl/fl mice injected with MPTP, n = 12; and Slc6a3cre-BAP31 fl/fl mice injected with MPTP, n = 12). * p < 0.05, ** p < 0.01, *** p < 0.001.
Article Snippet:
Techniques: Expressing, Real-time Polymerase Chain Reaction, Injection, Saline
Journal: Cells
Article Title: BAP31 Modulates Mitochondrial Homeostasis Through PINK1/Parkin Pathway in MPTP Parkinsonism Mouse Models
doi: 10.3390/cells15020137
Figure Lengend Snippet: BAP31 deficiency increased neuron loss induced by MPTP-treated mice: ( a ) Expression levels of NeuN and GFAP were detected by immunofluorescence assay. Scale bar = 50 μm. Experimental groups: BAP31 fl/fl mice, n = 3; Slc6a3cre-BAP31 fl/fl mice, n = 3; BAP31 fl/fl mice injected with MPTP, n = 3; and Slc6a3cre-BAP31 fl/fl mice injected with MPTP, n = 3. ( b ) Results of HE staining in the midbrain of mice. Scale bar = 500 or 100 μm. ( c ) Results of HE staining in the striatum of mice. Scale bar = 500 or 100 μm. Experimental groups: BAP31 fl/fl mice, n = 3; Slc6a3cre-BAP31 fl/fl mice, n = 3; BAP31 fl/fl mice injected with MPTP, n = 3; and Slc6a3cre-BAP31 fl/fl mice injected with MPTP, n = 3. ( d ) The ultrastructure of the nucleus in the midbrain and striatum of mice was observed by an electron microscope. Scale bar = 1 μm. Experimental groups: BAP31 fl/fl mice, n = 3; Slc6a3cre-BAP31 fl/fl mice, n = 3; BAP31 fl/fl mice injected with MPTP, n = 3; and Slc6a3cre-BAP31 fl/fl mice injected with MPTP n = 3. ** p < 0.01, *** p < 0.001.
Article Snippet:
Techniques: Expressing, Immunofluorescence, Injection, Staining, Microscopy
Journal: Cells
Article Title: BAP31 Modulates Mitochondrial Homeostasis Through PINK1/Parkin Pathway in MPTP Parkinsonism Mouse Models
doi: 10.3390/cells15020137
Figure Lengend Snippet: BAP31 deficiency increased dopamine neuron loss in MPTP-treated mice: ( a , b ) TH content in the midbrain and striatum of mice was detected by immunohistochemistry. Scale bar = 500, 200, or 50 μm. ( c ) TH level in the midbrain and striatum of mice was detected by WB. ( d ) BAP31 deficiency affected the DAT level in the brain of MPTP-treated mice. Scale bar = 50 μm. ( e ) ELISA detected the DA, DOPAC, and HVA levels in the midbrain and striatum of the brains of mice. Experimental groups: BAP31 fl/fl mice, n = 3; Slc6a3cre-BAP31 fl/fl mice, n = 3; BAP31 fl/fl mice injected with MPTP, n = 3; and Slc6a3cre-BAP31 fl/fl mice injected with MPTP n = 3. * p < 0.05, ** p < 0.01, *** p < 0.001.
Article Snippet:
Techniques: Immunohistochemistry, Enzyme-linked Immunosorbent Assay, Injection
Journal: Cells
Article Title: BAP31 Modulates Mitochondrial Homeostasis Through PINK1/Parkin Pathway in MPTP Parkinsonism Mouse Models
doi: 10.3390/cells15020137
Figure Lengend Snippet: BAP31 deficiency results in MPTP-lesioned mitochondrial homeostasis in PD mice: ( a – e ) The ultrastructure of mitochondria in the midbrain and striatum of mice was observed using electron microscopy. Mitochondrial status was rated as I–IV, and the number of different grades was counted. Scale bar = 1 μm. ( f ) The content of BAP31, MFF, Drp1, FIS1, MFN1, and OPA1 in the midbrain and striatum was detected by WB. Experimental groups: BAP31 fl/fl mice, n = 3; Slc6a3cre-BAP31 fl/fl mice, n = 3; BAP31 fl/fl mice injected with MPTP, n = 3; and Slc6a3cre-BAP31 fl/fl mice injected with MPTP, n = 3. * p < 0.05, ** p < 0.01, *** p < 0.001.
Article Snippet:
Techniques: Electron Microscopy, Injection
Journal: Cells
Article Title: BAP31 Modulates Mitochondrial Homeostasis Through PINK1/Parkin Pathway in MPTP Parkinsonism Mouse Models
doi: 10.3390/cells15020137
Figure Lengend Snippet: BAP31 deficiency affected the expression of PINK1/Parkin pathway-related proteins in MPTP-treated mice: ( a ) GeneCard scores of PD-related genes, indicating 19 genes with scores above 90. ( b ) The mRNA levels of each protein in the mouse brain were analyzed by qPCR. ( c ) The protein expressions of BAP31, PINK1, and Parkin were detected and quantitatively analyzed by WB. ( d , e ) The results of immunofluorescence double staining indicated the fluorescence levels of PINK1 and Parkin in the midbrain and striatum of mice. Scale bar = 50 μm. Experimental groups: BAP31 fl/fl mice, n = 3; Slc6a3cre-BAP31 fl/fl mice, n = 3; BAP31 fl/fl mice injected with MPTP, n = 3; and Slc6a3cre-BAP31 fl/fl mice injected with MPTP, n = 3. * p < 0.05, ** p < 0.01, *** p < 0.001.
Article Snippet:
Techniques: Expressing, Immunofluorescence, Double Staining, Fluorescence, Injection
Journal: Cells
Article Title: BAP31 Modulates Mitochondrial Homeostasis Through PINK1/Parkin Pathway in MPTP Parkinsonism Mouse Models
doi: 10.3390/cells15020137
Figure Lengend Snippet: BAP31 regulated the levels of PINK1 through EN1: ( a ) SH-SY5Y was transfected with siBAP31, and a Flag tag and WB were performed to observe changes in PINK1 protein levels. ( b ) Co-IP results indicate BAP31 and PINK1. ( c ) SH-SY5Y cells were transfected with siBAP31, and changes in SP1 and EN1 protein levels were observed by WB. ( d ) SH-SY5Y cells were transfected with Flag, and changes in SP1 and EN1 protein levels were detected by WB. ( e ) Correlation analysis of BAP31 and EN1. ( f ) WB analysis of PINK1 expression in cells transfected with siRNA-BAP31 and overexpressing EN1. ( g ) Analysis of the mRNA level of PINK1 expression in cells transfected with siRNA-BAP31 and those overexpressing EN1. ( h ) WB analysis of PINK1 expression in cells transfected with siRNA-EN1 and overexpressing BAP31. ( i ) Analysis of the mRNA level of PINK1 expression in cells transfected with siRNA-EN1 and overexpressing BAP31. * p < 0.05, ** p < 0.01, *** p < 0.001.
Article Snippet:
Techniques: Transfection, FLAG-tag, Co-Immunoprecipitation Assay, Expressing
Journal: Cells
Article Title: BAP31 Modulates Mitochondrial Homeostasis Through PINK1/Parkin Pathway in MPTP Parkinsonism Mouse Models
doi: 10.3390/cells15020137
Figure Lengend Snippet: We used arrowheads (→) to indicate activation or positive regulation and T-shaped arrowheads (--|) to indicate inhibition or negative regulation. In this study, we found that BAP31 deficiency down-regulated the PINK1 transcription factor EN1, thereby impairing the PINK1–Parkin pathway. This disruption led to an imbalance in mitochondrial fission and fusion, mitochondrial dysfunction, loss of dopamine neurons, and ultimately exacerbated PD development.
Article Snippet:
Techniques: Activation Assay, Inhibition, Disruption
Journal: Cells
Article Title: Functional Distinctions of Endometrial Cancer-Associated Mutations in the Fibroblast Growth Factor Receptor 2 Gene.
doi: 10.3390/cells12182227
Figure Lengend Snippet: Figure 5. Analysis of FGF7/FGFR2-induced ADAM17-mediated phosphorylation of MAPK in COS7 cells stably overexpressing mutant forms of FGFR2. (A) Representative immunoblot analysis of COS7 cell lysates stably overexpressing mutant forms of FGFR2, treated with 50 ng/mL FGF7 or vehicle and blotted for phosphorylated (p) and total (t) fibroblast growth factor receptor substrate (FRS2) or pMitogen-activated protein kinase (pMAPK) and tMAPK. (B,C) Densitometric quantification of immunoblots from 3 separate experiments including those presented in A. The ratios of pFRS2 to tFRS2 (B) and pMAPK to tMAPK (C) are shown, mean ± SEM. ImageJ software was used to quantify the bands obtained via immunoblot analysis. The area under the curve (AUC) for the specific signal was corrected for the total loading control AUC. n = 3 for densitometric quantification of FRS or MAPK phosphorylation. Data are expressed as mean ± SEM; Welch’s t-test. p < 0.05 indicates significant differences in FGF7-stimulated (+) FRS2 (B) and MAPK (C) phosphorylation compared to unstimulated vehicle-treated (−) cells.
Article Snippet: Membranes were blocked with 3% weight/volume skim milk in TBS and probed with primary antibodies against FGFR2 (1:2000 dilution, Cell Signaling Technologies, Danvers, MA, USA), phospho and total 44/42 MAPK (1:1000 dilution; Cell Signaling Technologies, Danvers, MA, USA), pFRS2 (1:500 dilution, Cell Signaling Technologies, Danvers, USA), and
Techniques: Phospho-proteomics, Stable Transfection, Mutagenesis, Western Blot, Software, Control