90
|
5 PRIME
double stranded adapter oligo Double Stranded Adapter Oligo, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/double+stranded+adapter+oligo/pmc04441129-63-19-18 Average 90 stars, based on 1 article reviews
double stranded adapter oligo - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
SuperArray Bioscience Corporation
oligo innate & adaptive immune responses microarray Oligo Innate & Adaptive Immune Responses Microarray, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/oligo+innate+++adaptive+immune+responses+microarray/pmc04443065-93-2-16 Average 90 stars, based on 1 article reviews
oligo innate & adaptive immune responses microarray - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Nextera AS
adapter 1 blocker oligo Adapter 1 Blocker Oligo, supplied by Nextera AS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/adapter+1+blocker+oligo/pm34650278-122-18-17 Average 90 stars, based on 1 article reviews
adapter 1 blocker oligo - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
CustomArray Inc
oligo's with grna sequences flanked by adapters Oligo's With Grna Sequences Flanked By Adapters, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/oligo+s+with+grna+sequences+flanked+by+adapters/pm30030148-70-6-10 Average 90 stars, based on 1 article reviews
oligo's with grna sequences flanked by adapters - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Promega
oligo(dt)-adapter primer [atgaattcggtacccgggatcc(t) 17] Oligo(dt) Adapter Primer [Atgaattcggtacccgggatcc(t) 17], supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/oligo+dt++adapter+primer++atgaattcggtacccgggatcc+t++17+/pmc03925239-82-13-24 Average 90 stars, based on 1 article reviews
oligo(dt)-adapter primer [atgaattcggtacccgggatcc(t) 17] - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
98
|
New England Biolabs
t4 rna ligase 2, truncated kq T4 Rna Ligase 2, Truncated Kq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/T4+RNA+Ligase+2%2C+truncated+KQ/custom%40m0373%4010%2E1101%2F752709 Average 98 stars, based on 1 article reviews
t4 rna ligase 2, truncated kq - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |
90
|
ATDBio Inc
methylated adapters methylated adapter oligos Methylated Adapters Methylated Adapter Oligos, supplied by ATDBio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/methylated+adapters+methylated+adapter+oligos/10__1038_slash_nprot__2010__190-170-0-17 Average 90 stars, based on 1 article reviews
methylated adapters methylated adapter oligos - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
SuperArray Bioscience Corporation
human innate and adaptive immunity oligo array Human Innate And Adaptive Immunity Oligo Array, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/human+innate+and+adaptive+immunity+oligo+array/10__1111_slash_j__1524___475x__2008__00401__x-45-12-16 Average 90 stars, based on 1 article reviews
human innate and adaptive immunity oligo array - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Promega
oligo-dt primer containing a 50 adapter sequence (p1; ggccacgcgtcgactagtac(t)25 Oligo Dt Primer Containing A 50 Adapter Sequence (P1; Ggccacgcgtcgactagtac(t)25, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/oligo+dt+primer+containing+a+50+adapter+sequence++p1++ggccacgcgtcgactagtac+t+25/pm22899339-51-23-38 Average 90 stars, based on 1 article reviews
oligo-dt primer containing a 50 adapter sequence (p1; ggccacgcgtcgactagtac(t)25 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
ATDBio Inc
methylated adapter oligos, in which all cs are replaced by 5′-methyl cs Methylated Adapter Oligos, In Which All Cs Are Replaced By 5′ Methyl Cs, supplied by ATDBio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/methylated+adapter+oligos++in+which+all+cs+are+replaced+by+5++methyl+cs/pm21412275-170-12-17 Average 90 stars, based on 1 article reviews
methylated adapter oligos, in which all cs are replaced by 5′-methyl cs - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Federation of European Neuroscience Societies
oligo(dt) adapter primer Oligo(dt) Adapter Primer, supplied by Federation of European Neuroscience Societies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/oligo+dt++adapter+primer/pm10338117-38-17-28 Average 90 stars, based on 1 article reviews
oligo(dt) adapter primer - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Promega
oligo(dt)-adapter primer and m-mlv-rnase h-reverse transcriptase Oligo(dt) Adapter Primer And M Mlv Rnase H Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/adapter+oligos/oligo+dt++adapter+primer+and+m+mlv+rnase+h+reverse+transcriptase/pm21867972-40-8-14 Average 90 stars, based on 1 article reviews
oligo(dt)-adapter primer and m-mlv-rnase h-reverse transcriptase - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |