Journal: PLoS ONE

Article Title: Identification of the ER-resident E3 ubiquitin ligase RNF145 as a novel LXR-regulated gene

doi: 10.1371/journal.pone.0172721

Figure Lengend Snippet: ( A ) Expression of Rnf145 was evaluated in the indicated mouse tissues by qPCR. Bars indicate mean ± SD (n = 3) ( B , C ) The indicated ( B ) human and ( C ) mouse cell lines and primary macrophages were cultured in lipoprotein-depletion medium for 16 hours and subsequently treated for 6 hours with 1μM GW3965 (GW). ( D ) THP1 cells were cultured in sterol depletion medium for 16 hrs and then treated with 1μM GW3965 (GW) and 100nM LG100268 (LG) for 6 hrs as indicated. Subsequently, ABCA1 and RNF145 expression was determined by qPCR and each bar and error represents the mean fold-change of ligand-treated cells over sterol-depleted cells ± SD (n≥3).

Article Snippet: Membranes were probed with the following antibodies: LDLR (Abcam, clone EP1553Y, 1:4000), tubulin (Sigma, clone DM1A, ascites fluid, 1:5000), ABCA1 (Novus Biologicals, NB400-105, 1:1000), FLAG (Sigma, clone M2, 1:1000), GFP (Santa Cruz sc-9996, 1:500), Myc (Santa Cruz 9E10, 1:3000), HA (Covance, clone 16B12, ascites fluid, 1:6000), HMGCR (rabbit polyserum was a kind gift from Dr. Peter Edwards, UCLA), SREBP2 (BD Biosciences, clone 1C6, 1:1000), SREBP1 (ThermoFisher, clone 2A4, 1:1000), actin (Merck Millipore, clone C4, 1:5000), V5 (Invitrogen, 46–0705, 1:3000), RNF145 (Abgent AP18281b, 1:8000), and ubiquitin (Enzo life Sciences, clone FK2, 1:1000).

Techniques: Expressing, Cell Culture

Journal: PLoS ONE

Article Title: Identification of the ER-resident E3 ubiquitin ligase RNF145 as a novel LXR-regulated gene

doi: 10.1371/journal.pone.0172721

Figure Lengend Snippet: ( A ) RAW264.7 macrophages were treated with 5μg/mL Actinomycin D (ActD) for the indicated time and expression of Abca1 and Rnf145 was determined by qPCR and plotted as mean ± SD relative to untreated cells (n = 3), ( B ) HepG2 and RAW264.7 cells were treated with 1μM GW3965 for 6 hours in the presence or absence of 5μg/ml actinomycinD for 4 hours, after which expression of the indicated genes was measured by qPCR. Bars indicate mean ± SD (n = 3) ( C , D ) THP1 macrophages were cultured in sterol-depletion medium for 16 hrs and then treated with ( C ) 1μM GW3965 (GW) for the indicated time, or ( D ) with the indicated concentration of GW3965 for 4 hrs. Subsequently, gene expression was evaluated qPCR and bars indicate mean ± SD (n = 3)

Article Snippet: Membranes were probed with the following antibodies: LDLR (Abcam, clone EP1553Y, 1:4000), tubulin (Sigma, clone DM1A, ascites fluid, 1:5000), ABCA1 (Novus Biologicals, NB400-105, 1:1000), FLAG (Sigma, clone M2, 1:1000), GFP (Santa Cruz sc-9996, 1:500), Myc (Santa Cruz 9E10, 1:3000), HA (Covance, clone 16B12, ascites fluid, 1:6000), HMGCR (rabbit polyserum was a kind gift from Dr. Peter Edwards, UCLA), SREBP2 (BD Biosciences, clone 1C6, 1:1000), SREBP1 (ThermoFisher, clone 2A4, 1:1000), actin (Merck Millipore, clone C4, 1:5000), V5 (Invitrogen, 46–0705, 1:3000), RNF145 (Abgent AP18281b, 1:8000), and ubiquitin (Enzo life Sciences, clone FK2, 1:1000).

Techniques: Expressing, Cell Culture, Concentration Assay, Gene Expression

Journal: PLoS ONE

Article Title: Identification of the ER-resident E3 ubiquitin ligase RNF145 as a novel LXR-regulated gene

doi: 10.1371/journal.pone.0172721

Figure Lengend Snippet: ( A ) LXR ChIP-seq experiments in human THP1 cells (GSE28319) and RAW macrophage-like cells (GSE50944) were analyzed and used to identify active LXREs within the Rnf145/Rnf145 loci, as graphically illustrated. ( B , C ) Genomic location of the identified LXREs. In bold, nucleotides that were mutated to disrupt LXR binding ( C ) A 1kb genomic region upstream of the transcriptional start site of hRNF145 was cloned into a pGL3basic. The putative LXRE was also mutated as indicated above. The empty, RNF145 WT , RNF145 MUT , and ABCA1 reporter plasmids were co-transfected with or without RXRα and LXRα expression plasmids in HEK 293T cells. 24 hours post-transfection the cells were treated with 1μM GW3965 (LXR) and 100nM LG100268 (RXR) for 24 hours and measured for luciferase signal (n≥3). ( D ) Cells were transfected with an empty or a tandem LXRE-containing pGL2 as in C . In all luciferase experiments the transfection efficiency was normalized to co-transfected Renilla luciferase. Bars report normalized chemiluminescence relative to untreated control ± SD (n = 3).

Article Snippet: Membranes were probed with the following antibodies: LDLR (Abcam, clone EP1553Y, 1:4000), tubulin (Sigma, clone DM1A, ascites fluid, 1:5000), ABCA1 (Novus Biologicals, NB400-105, 1:1000), FLAG (Sigma, clone M2, 1:1000), GFP (Santa Cruz sc-9996, 1:500), Myc (Santa Cruz 9E10, 1:3000), HA (Covance, clone 16B12, ascites fluid, 1:6000), HMGCR (rabbit polyserum was a kind gift from Dr. Peter Edwards, UCLA), SREBP2 (BD Biosciences, clone 1C6, 1:1000), SREBP1 (ThermoFisher, clone 2A4, 1:1000), actin (Merck Millipore, clone C4, 1:5000), V5 (Invitrogen, 46–0705, 1:3000), RNF145 (Abgent AP18281b, 1:8000), and ubiquitin (Enzo life Sciences, clone FK2, 1:1000).

Techniques: ChIP-sequencing, Binding Assay, Clone Assay, Transfection, Expressing, Luciferase, Control

Journal:

Article Title: Retinoic Acid Receptor-Mediated Induction of ABCA1 in Macrophages

doi: 10.1128/MCB.23.21.7756-7766.2003

Figure Lengend Snippet: Retinoids induce ABCA1 in macrophages. (A) Retinoids stimulate ABCA1-mediated cholesterol efflux from mouse peritoneal macrophages. The ability of macrophages to efflux cholesterol to apoA-I responds to ATRA treatment in a dose-dependent fashion. The results are expressed as mean ± the standard error of the mean (SEM; n = 4). ✽, P < 0.05; ✽✽, P < 0.01 (compared to control). (B) ATRA and TO-901317 (LXR agonist) induce a comparable increase in cholesterol efflux to apoA-I. The results are expressed as mean ± the SEM (n = 4). (C) Retinoids increase ABCA1 protein accumulation in macrophages. ABCA1 protein levels were analyzed by Western blot in mouse peritoneal macrophages and human monocyte-derived macrophages after ATRA treatment (10 μM for human macrophages) for 24 h in DMEM containing 10% lipoprotein-deficient serum. The fold induction is shown standardized against β-actin. (D) The synthetic RAR pan-agonist, TTNPB, also increases ABCA1 protein accumulation in macrophages.

Article Snippet: Membranes were probed with anti-ABCA1 antibody (Novus Biologicals, Littleton, Colo.) and anti-β-actin antibody (Sigma) according to the manufacturer's recommendations.

Techniques: Western Blot, Derivative Assay

Journal:

Article Title: Retinoic Acid Receptor-Mediated Induction of ABCA1 in Macrophages

doi: 10.1128/MCB.23.21.7756-7766.2003

Figure Lengend Snippet: Induction of macrophages genes by ATRA. (A) Mouse peritoneal macrophages in DMEM containing 10% LPDS were treated for 24 h with various concentrations of ATRA (0.1 to 5 μM) or vehicle (DMSO). (B) Human monocyte-derived macrophages were treated for 24 h with various concentrations of ATRA (0.5 to 5 μM) or vehicle (DMSO). The expression of ABCA1, ABCG1, SREBP-1c, apoE, and LXRα mRNA were measured by quantitative real-time PCR assays (TaqMan) and standardized against β-actin mRNA levels. ✽, P < 0.05; ✽✽, P < 0.01; ✽✽✽, P < 0.001 (compared to control).

Article Snippet: Membranes were probed with anti-ABCA1 antibody (Novus Biologicals, Littleton, Colo.) and anti-β-actin antibody (Sigma) according to the manufacturer's recommendations.

Techniques: Derivative Assay, Expressing, Real-time Polymerase Chain Reaction

Journal:

Article Title: Retinoic Acid Receptor-Mediated Induction of ABCA1 in Macrophages

doi: 10.1128/MCB.23.21.7756-7766.2003

Figure Lengend Snippet: Retinoids do not induce lipogenic SREBP-1c target genes in vivo. (A) RAR regulation of ABCA1 and SREBP-1c expression in mouse peritoneal macrophages. Macrophages were exposed to TTNPB (1 μM) or DMSO (control) for 24 h in 10% LPDS. ABCA1 and SREBP-1c mRNA levels were determined by quantitative real-time reverse transcription-PCR and standardized against β-actin mRNA levels. The results are expressed as mean ± the SEM (n = 4 and 6). ✽, P < 0.05; ✽✽, P < 0.01 (compared to control). (B) Regulation of gene expression by TTNPB in the mouse liver. Mice were injected intraperitoneally with TTNPB (1 or 10 mg/kg) or vehicle (DMSO-polyethylene glycol 300). After 24 h, the mice were anesthetized, the livers were perfused, and the square lobes were removed for isolation of RNA. The expression of SREBP-1c, FAS, ABCA1, and Cyp26 mRNA (positive control for the effect of TTNPB) were measured by quantitative real-time PCR assays (TaqMan) and standardized against β-actin mRNA levels. The results are expressed as mean ± the SEM (n = 5).

Article Snippet: Membranes were probed with anti-ABCA1 antibody (Novus Biologicals, Littleton, Colo.) and anti-β-actin antibody (Sigma) according to the manufacturer's recommendations.

Techniques: In Vivo, Expressing, Reverse Transcription, Injection, Isolation, Positive Control, Real-time Polymerase Chain Reaction

Journal:

Article Title: Retinoic Acid Receptor-Mediated Induction of ABCA1 in Macrophages

doi: 10.1128/MCB.23.21.7756-7766.2003

Figure Lengend Snippet: Human ABCA1 promoter is activated by RXR/RAR. (A) In HEK293 cells, hABCA1 promoter is activated by RARγ. HEK293 cells were transfected with hABCA1 promoter (pb −928 to pb +101) and/or pCMX-hRXRα, pCMX-hRARα, pCMX-hRARβ, and pCMX-hRARγ1 and then exposed to DMSO (control) or 0.1 μM TTNPB in DMEM-lipoprotein-deficient serum-10% penicillin-streptomycin for 36 h before analysis. The luciferase activity was determined as described previously (6). The values are means ± the SEM of three to six independent experiments. ✽, P < 0.05 (Mann-Whitney test). (B) Activation of human ABCA1 promoter by RARγ does not need cotransfection of RXRα. (C) RAR activates hABCA1 promoter through its LXRE DR4 element. HEK 293 cells were transfected with hABCA1 wild-type promoter, a deleted version (bp −100 to bp +101),or the full-length promoter containing mutations in the DR4 element previously described as an LXRE (6). Cells were cotransfected with pCMX-RXRα and pCMX RARγ1 and exposed to 0.1 μM TTNPB for 36 h before luciferase analysis. The values are mean ± the SD of three independent experiments performed in duplicates. (D) RXRα/RARγ1 heterodimer binds hABCA1 DR4 element in EMSAs. In vitro-translated RXRα and RARγ were incubated with 32P-labeled hABCA1 DR4 element. The arrow indicates the resulting complex. Lane 1, wheat germ extract; lane 2, RXRα/RARγ complex on the DR4; lane 3, competition with unlabeled hABCA1 DR4; lanes 4 and 5, asterisks represent a shift of the complex in the presence of RARγ (lane 4) or RXRα (lane 5) polyclonal antibody; lane 6, control anti-RORα antibody; lane 7, competition with mutated unlabeled hABCA1 DR4 (described in Fig. ​Fig.4C,4C, independent experiment). (E) Structure of the mSREBP-1c promoter and position of the two DR4s (LXRE a and b). (F) RXRα/RARγ heterodimer does not interact with the DR4 sequences of the mouse SREBP-1c promoter. (Left panel) RXRα, RARγ, and LXRβ were separately produced by using an in vitro transcription-translation wheat germ extract systems and used in EMSAs with a 32P-labeled mouse SREBP-1c DR4b element as a probe. Lane 1, RXRα/LXRβ binding; lane 2, absence of binding of RXRα/RARγ. (Right panel) EMSA analysis as described in panel D but with a 32P-labeled human ABCA1 DR4 element as a probe. Lane 1, binding of RXRα/RARγ on DR4; lane 2, competition with unlabeled probe; lane 3, competition assay using unlabeled mouse SREBP-1c DR4b element as competitor.

Article Snippet: Membranes were probed with anti-ABCA1 antibody (Novus Biologicals, Littleton, Colo.) and anti-β-actin antibody (Sigma) according to the manufacturer's recommendations.

Techniques: Transfection, Luciferase, Activity Assay, MANN-WHITNEY, Activation Assay, Cotransfection, In Vitro, Incubation, Labeling, Produced, Binding Assay, Competitive Binding Assay

Journal:

Article Title: Retinoic Acid Receptor-Mediated Induction of ABCA1 in Macrophages

doi: 10.1128/MCB.23.21.7756-7766.2003

Figure Lengend Snippet: (A) RARγ tissue distribution in C57BL/6J mouse. Western blot analyses were performed after SDS-polyacrylamide gel electrophoresis separation of 100 μg of the nuclear proteins extracted from each tissue. (B) In vivo association of RARγ/RXR dimer with the DR4 region in the ABCA1 promoter as determined by ChIP analysis. Mouse peritoneal macrophages were treated or not treated (lane 1) with 1 μM ATRA for 24 h and subjected to ChIP assays. Lanes 1 and 5, rabbit anti-RARγ polyclonal antibody used for immunoprecipitation; lane 2, normal rabbit immunoglobulin G used for immunoprecipitation negative control; lane 3, rabbit anti-RARα polyclonal antibody used for immunoprecipitation; lane 4, rabbit anti-RARβ polyclonal antibody used for immunoprecipitation; lane 6, no DNA; lanes 7 to 12, input DNA used for PCR. (C) ABCA1 protein accumulates in TTNPB-treated RARγ−/− mouse peritoneal macrophages. Thioglycolate-elicited peritoneal macrophages from RARγ−/− and RARγ+/+ mice were treated with 5 μM TTNPB for 24 h in DMEM-10% lipoprotein-deficient serum-1% penicillin-streptomycin. The ABCA1 protein levels were then analyzed by Western blot analysis as described for Fig. ​Fig.1C.1C. (D) Upregulation of RARα in RARγ−/− mouse peritoneal macrophages. Nuclear protein extracts isolated from RARγ−/− and RARγ+/+ macrophages were separated by SDS-polyacrylamide gel electrophoresis, and the RARα protein level was determined by Western blot analysis.

Article Snippet: Membranes were probed with anti-ABCA1 antibody (Novus Biologicals, Littleton, Colo.) and anti-β-actin antibody (Sigma) according to the manufacturer's recommendations.

Techniques: Western Blot, Polyacrylamide Gel Electrophoresis, In Vivo, Immunoprecipitation, Negative Control, Isolation

Journal: Biomedicines

Article Title: ABCA1 Expression Is Upregulated in an EMT in Breast Cancer Cell Lines via MYC-Mediated De-Repression of Its Proximal Ebox Element

doi: 10.3390/biomedicines10030581

Figure Lengend Snippet: ABCA1 expression is higher in mesenchymal breast cancer cells and promotes migration in MCF7 cells. ( a ) Relative gene expression levels of ABCA1 are shown on the y -axis across breast cell lines. Normal indicates a non-cancer cell line, and Luminal and Basal B indicates the subtype of the cancer cell lines. Error bars indicate one standard deviation. ( b ) This immunoblot shows the expression of ABCA1 and GAPDH in MCF7 cells with or without overexpression of ABCA1. ( c ) A representative image (from 15 fields) shows the migrated MCF7 cells in from a transwell migration assay for the baseline condition ( left ) as well as those with ABCA1 expression ( right ). ( d ) The relative number of migrated cells are shown on the y -axis for the two conditions. Error bars indicate one standard deviation. Statistical significance, relative to the CTRL condition, is indicated by ** p < 0.01, *** p < 0.001. ( e ) The relative membrane fluidity is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. ( f ) The relative cellular cholesterol content is shown on the y -axis ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown.

Article Snippet: ABCA1 was amplified from human ABCA1 (NP_005493) VersaClone cDNA plasmid (R&D Systems, Minneapolis, MN, USA) by performing a two-step PCR with initial denaturation at 98 °C for 2 min followed by 35 cycles of denaturation at 98 °C for 30 s and elongation at 68 °C for 7 min using the following primer set: _F GATGTGGTGGTACGTAGGATGGCTTGTTGGCCTCAG _R TGGAAAATAACCGGAATTGGTCATACATAGCTTTCTTTCACTTTC PCR product was column-purified from 0.7% agarose gel using QIAquick Gel Extraction Kit, and cloned into expression retroviral vector pWZL Hygro, a gift from Scott Lowe (Addgene plasmid #18750), after it was linearized by digestion with EcoRI-HF and SalI (both New England Biolabs, Ipswich, MA, USA) using the Gibson Assembly Cloning Kit.

Techniques: Expressing, Migration, Gene Expression, Standard Deviation, Western Blot, Over Expression, Transwell Migration Assay, Membrane

Journal: Biomedicines

Article Title: ABCA1 Expression Is Upregulated in an EMT in Breast Cancer Cell Lines via MYC-Mediated De-Repression of Its Proximal Ebox Element

doi: 10.3390/biomedicines10030581

Figure Lengend Snippet: ABCA1 expression is differentially regulated in mesenchymal cell lines through the E-box motif in its proximal promoter. ( a ) This schematic outlines the structure of ABCA1 alternative promoters. ( b ) Luminescence induced by alternative proximal promoters P1 or P2 are shown on the y -axis ( n = 4 technical replicates). Error bars indicate one standard deviation. Statistical significance is indicated as in . ( c ) Luminescence induced by promoter P1, or promoter fragments P1a and P1b, are shown on the y -axis ( n = 4 technical replicates). Error bars indicate one standard deviation. ( d ) This shows the mutations introduced to the P1b promoter fragment to disrupt binding capacity of the E-box, SP1, and LXR motifs. Mutations are labeled in bold. ( e ) Luminescence is shown on the x -axis for each of the mutant promoters in the MCF7, HMLE, MDA-MB-231, and HMLE-Twist cell lines ( n = 4 technical replicates, for each). Error bars indicate one standard deviation. At least three biological replicates were performed for each experiment, and representative data are shown. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: ABCA1 was amplified from human ABCA1 (NP_005493) VersaClone cDNA plasmid (R&D Systems, Minneapolis, MN, USA) by performing a two-step PCR with initial denaturation at 98 °C for 2 min followed by 35 cycles of denaturation at 98 °C for 30 s and elongation at 68 °C for 7 min using the following primer set: _F GATGTGGTGGTACGTAGGATGGCTTGTTGGCCTCAG _R TGGAAAATAACCGGAATTGGTCATACATAGCTTTCTTTCACTTTC PCR product was column-purified from 0.7% agarose gel using QIAquick Gel Extraction Kit, and cloned into expression retroviral vector pWZL Hygro, a gift from Scott Lowe (Addgene plasmid #18750), after it was linearized by digestion with EcoRI-HF and SalI (both New England Biolabs, Ipswich, MA, USA) using the Gibson Assembly Cloning Kit.

Techniques: Expressing, Standard Deviation, Binding Assay, Labeling, Mutagenesis

Journal: Biomedicines

Article Title: ABCA1 Expression Is Upregulated in an EMT in Breast Cancer Cell Lines via MYC-Mediated De-Repression of Its Proximal Ebox Element

doi: 10.3390/biomedicines10030581

Figure Lengend Snippet: MYC binds to the ABCA1 promoter and represses its expression in epithelial cells. ( a ) This volcano plot shows the relative log 2 expression of E-box binding transcription factors on the x -axis. Each transcription factor is shown as a dot, and those expressed higher in mesenchymal cells are shown on the right, while those expressed higher in epithelial cells are on the left. The y -axis shows the −log 10 of the p -value. A dotted line indicates p = 0.05. ( b ) The gene ( top ) and protein ( bottom ) expressions of ABCA1 are shown for four cell lines ( n = 3 technical replicates). Error bars indicate one standard deviation. Statistical significance is indicated as in . ( c ) The relative gene expressions of ABCA1 , MYC , or CDH1 are shown on the y -axis across time ( x -axis) in log scale ( n = 3 technical replicates). Error bars indicate one standard deviation. ( d ) ( top panel ) The relative gene expressions of ABCA1 or MYC in HMLE cells are shown on the y -axis after knockdown with three independent siRNAs targeting MYC ( n = 3 technical replicates). Error bars indicate one standard deviation. ( bottom ) These immunoblots show the protein expression in the same conditions. ( e ) The binding affinity of MYC to the ABCA1 promoter or a gene desert ( GD ) region is quantified relative to input ( y -axis) ( n = 3 technical replicates). Error bars indicate one standard deviation. At least three biological replicates were performed for experiments shown in panels b, d, and e, and representative data are shown. The data in panel ( a ) were aggregated from six data sets. For panel ( c ), the time series has been measured over five times, but the time points profiled in the middle samples varied. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: ABCA1 was amplified from human ABCA1 (NP_005493) VersaClone cDNA plasmid (R&D Systems, Minneapolis, MN, USA) by performing a two-step PCR with initial denaturation at 98 °C for 2 min followed by 35 cycles of denaturation at 98 °C for 30 s and elongation at 68 °C for 7 min using the following primer set: _F GATGTGGTGGTACGTAGGATGGCTTGTTGGCCTCAG _R TGGAAAATAACCGGAATTGGTCATACATAGCTTTCTTTCACTTTC PCR product was column-purified from 0.7% agarose gel using QIAquick Gel Extraction Kit, and cloned into expression retroviral vector pWZL Hygro, a gift from Scott Lowe (Addgene plasmid #18750), after it was linearized by digestion with EcoRI-HF and SalI (both New England Biolabs, Ipswich, MA, USA) using the Gibson Assembly Cloning Kit.

Techniques: Expressing, Binding Assay, Standard Deviation, Knockdown, Western Blot

Journal: Journal of Biological Chemistry

Article Title: Expression of Liver X Receptor Target Genes Decreases Cellular Amyloid β Peptide Secretion

doi: 10.1074/jbc.m300760200

Figure Lengend Snippet: FIG. 3. ABCA1 overexpression inhibits A secretion. A, ABCA1 protein in Neuro2a cells after LXR activation (top panel) or transient transfection (bottom panel), showing similar expression levels relative to actin. B and C, A peptide in medium was determined by immunopre- cipitation and immunoblotting; cellular APP (cAPP) was determined by immunoblotting cell lysates. The bar graphs show combined data from three or more independent experiments. *, p 0.01 compared with mock (mk) control. B, Neuro2a-APPSw cells were transfected with either mock control plasmid or ABCA1 cDNA. ApoA-I (A1) was added for 6 h where indicated. C, Neuro2a-APPsw cells were transfected with empty vector (control) or vector containing ABCA1 cDNA or ABCA1 with a mutation in the ATP-binding cassette (Walker motif mutation). Filled bar, no apolipoprotein added; hatched bar, apoA-I added.

Article Snippet: Polyclonal anti-ABCA1 antibody was purchased from Novus (Littleton, CO).

Techniques: Over Expression, Activation Assay, Transfection, Expressing, Western Blot, Control, Plasmid Preparation, Mutagenesis, Binding Assay

Journal: Journal of Biological Chemistry

Article Title: Expression of Liver X Receptor Target Genes Decreases Cellular Amyloid β Peptide Secretion

doi: 10.1074/jbc.m300760200

Figure Lengend Snippet: FIG. 4. The effect of apoE isoforms on A secretion. Neuro2a- APPSw cells were transfected with empty vector (control) or ABCA1 vector, and apoE isoforms were added during the last 6 h of the exper- iment; data are the means S.E. for five separate experiments con- ducted in duplicate or triplicate. *, p 0.01 compared with mock transfected; #, p 0.05 compared with ABCA1 transfected without apolipoprotein.

Article Snippet: Polyclonal anti-ABCA1 antibody was purchased from Novus (Littleton, CO).

Techniques: Transfection, Plasmid Preparation, Control

Journal: Journal of Biological Chemistry

Article Title: Expression of Liver X Receptor Target Genes Decreases Cellular Amyloid β Peptide Secretion

doi: 10.1074/jbc.m300760200

Figure Lengend Snippet: FIG. 5. ABCA1 overexpression decreases -cleavage of APPSw and -cleavage of the 99-amino acid C-terminal fragment of APP. A, Neuro2a-APPSw cells were transfected with either empty vector or vector containing ABCA1 cDNA. The -cleavage product C99 was detected by immunoprecipitation of cell lysates with antibody 4G8 followed by immunoblotting with 6E10. Cellular APP (cAPP) level was measured by immunoblotting cell lysates. The data are the means S.E. for five separate experiments; *, p 0.01 compared with mock (mk) transfected. B, Neuro2a cells were transfected with vector containing either C99 Myc alone or C99 Myc with ABCA1. A was detected as in Fig. 3. Cellular C99 was detected by immunoprecipitation with anti-Myc antibody followed by Western blot with 6E10. The data are shown for three separate experiments conducted in duplicate. #, p 0.05 compared with C99 transfected alone.

Article Snippet: Polyclonal anti-ABCA1 antibody was purchased from Novus (Littleton, CO).

Techniques: Over Expression, Transfection, Plasmid Preparation, Immunoprecipitation, Western Blot

Journal: PloS one

Article Title: Bone marrow deficiency of MCPIP1 results in severe multi-organ inflammation but diminishes atherogenesis in hyperlipidemic mice.

doi: 10.1371/journal.pone.0080089

Figure Lengend Snippet: Figure 9. MCPIP1 deficiency increased macrophage cholesterol efflux. A. Bone marrow-derived macrophages were loaded with ac-LDL and cholesterol efflux to DMEM, apoAI and HDL was measured. Data were presented as mean 6 SEM. N = 3 in each group. B. Bone marrow-derived macrophages were cultured in DMEM for 48 h with or without ac-LDL. Cell lysates were used for western blotting analysis for ABCA1 and ABCG1. Representative western blotting result was shown. C. Quantitative analysis of the western blots. Data were presented as mean 6 SEM. N = 4 in each group. Open column: WT macrophages; Black column, MCPIP12/2 macrophages. doi:10.1371/journal.pone.0080089.g009

Article Snippet: Rabbit antimouse ABCA1 and anti-mouse ABCG1 antibodies were from Novus Biologicals (Littleton, CO).

Techniques: Derivative Assay, Cell Culture, Western Blot

Journal: Journal of lipid research

Article Title: ABCA1-mediated cholesterol efflux generates microparticles in addition to HDL through processes governed by membrane rigidity.

doi: 10.1194/jlr.M800345-JLR200

Figure Lengend Snippet: Fig. 2. Functional ABCA1 and protein kinase A (PKA) activity is re- quired for apoA-I independent cholesterol efflux. A: 3H-cholesterol labeled BHK-mock, ABCA1, ABCA1-A937V cells were induced for 20 h and incubated with DMEM without apoA-I for 4 h. B: 3H- cholesterol labeled BHK-mock and ABCA1 were induced and incu- bated with DMEM with or without 50 mM PKI. Cholesterol efflux was measured as in Fig. 2. Bars represent mean 6 standard devia- tion of triplicate wells.

Article Snippet: The polyclonal antibody against ABCA1 was from Novus Biological Inc. (Littleton, CO).

Techniques: Functional Assay, Activity Assay, Labeling, Incubation

Journal: Journal of lipid research

Article Title: ABCA1-mediated cholesterol efflux generates microparticles in addition to HDL through processes governed by membrane rigidity.

doi: 10.1194/jlr.M800345-JLR200

Figure Lengend Snippet: Fig. 1. ATP-binding cassette transport A1 (ABCA1) expression alone induces cholesterol efflux. A: Baby hamster kidney (BHK) and RAW264.7 macrophage cells were labeled with 3H-cholesterol. ABCA1 expression was induced by treating BHK cells with 10 nM mifepristone or RAW macrophages with 0.5 mM 8-bromo-cAMP. Cells were then changed into fresh DMEM medium [no apolipo- protein A-I (apoA-I)] with induction reagents. Medium was collected after 8 h. Medium and cell-associated 3H radioactivity was counted and presented as percentage of cholesterol in the medium relative to the total cholesterol (medium and cell-associated). B: BHK and RAW cells prelabeled with 3H-choline chloride were treated as in A. Phospholipids containing 3H-choline were extracted from both medium and cells to calculate the percentage of 3H-choline contain- ing phospholipids in the medium. C: 3H-Cholesterol efflux was car- ried out in DMEM (no BSA) for 8 h in the absence (2apoA-I) or in presence of 10 mg/ml apoA-I (1apoA-I).

Article Snippet: The polyclonal antibody against ABCA1 was from Novus Biological Inc. (Littleton, CO).

Techniques: Binding Assay, Expressing, Labeling, Radioactivity

Journal: Journal of lipid research

Article Title: ABCA1-mediated cholesterol efflux generates microparticles in addition to HDL through processes governed by membrane rigidity.

doi: 10.1194/jlr.M800345-JLR200

Figure Lengend Snippet: Fig. 3. Characterization of lipid particles shed to the medium in the absence of apoA-I. 3H-cholesterol-labeled BHK cells expressing ABCA1 or not (mock) were incubated in presence of 10 mg/ml apoA-I or without apoA-I for 8 h. Media were collected, concen- trated by ultrafiltration. A, B: Concentrated medium from ABCA1 or mock cells was analyzed by fast performance liquid chromatog- raphy (FPLC). Radioactivity associated with each fraction was deter- mined. Fractions corresponding to elution peaks were analyzed by immunoblotting to detect apoA-I. C: Concentrated medium from ABCA1 cells was immunoblotted using antibodies against hamster apoB, hamster apoE, and hamster apoA-I to exclude potential pro- duction of endogenous apoproteins by BHK cells. Hamster plasma was used as positive control.

Article Snippet: The polyclonal antibody against ABCA1 was from Novus Biological Inc. (Littleton, CO).

Techniques: Labeling, Expressing, Incubation, Radioactivity, Western Blot, Clinical Proteomics, Positive Control

Journal: Journal of lipid research

Article Title: ABCA1-mediated cholesterol efflux generates microparticles in addition to HDL through processes governed by membrane rigidity.

doi: 10.1194/jlr.M800345-JLR200

Figure Lengend Snippet: Fig. 5. Wheat germ agglutinin (WGA) inhibits lipid release to medium. A: 3H-cholesterol-labeled BHK cells stably expressing hu- man ABCA1 or an empty vector (mock) were incubated for 20 h in DMEM/BSA containing 10 nM mifepristone to induce ABCA1 ex- pression. The release of 3H-cholesterol to the medium containing apoA-I (10 mg/ml) for 2 h was measured in the presence or absence of WGA (10 mg/ml). B: Cholesterol efflux (2 h) from induced or noninduced RAW macrophages. C: BHK cells prelabeled with 3H-choline chloride were treated as in A. Phospholipids containing 3H-choline were extracted from both medium and cells to calculate the percentage of 3H-choline containing phospholipids. Bars repre- sent mean 6 standard deviation of triplicate wells.

Article Snippet: The polyclonal antibody against ABCA1 was from Novus Biological Inc. (Littleton, CO).

Techniques: Labeling, Stable Transfection, Expressing, Plasmid Preparation, Incubation, Standard Deviation

Journal: Journal of lipid research

Article Title: ABCA1-mediated cholesterol efflux generates microparticles in addition to HDL through processes governed by membrane rigidity.

doi: 10.1194/jlr.M800345-JLR200

Figure Lengend Snippet: Fig. 4. Non-HDL microparticles are distinct from immune-micro- particles. A: 3H-cholesterol-labeled RAW macrophages, either induced or noninduced were treated with the indicated dose of lipopolysac- charide for 6 h. Cholesterol efflux was measured as in Fig. 1A. B: Mock and ABCA1 BHK cells were induced with mifepristone at indicated concentration for 18 h. Methylthiazol tetrazolium tox- icity tests were carried as described in Materials and Methods. Results are presented as optical density (550 nm) readings from for- mazan and bars represent mean 6 standard deviation of triplicate wells. C: 3H-cholesterol-labeled BHK cells were induced with 10 nM mifepristone overnight. Cells were then pretreated with DMEM or DMEM 1 EGTA (2 mM) for 30 min. Cholesterol efflux was then carried out for 2 h with or without EGTA.

Article Snippet: The polyclonal antibody against ABCA1 was from Novus Biological Inc. (Littleton, CO).

Techniques: Labeling, Concentration Assay, Standard Deviation

Journal: Journal of lipid research

Article Title: ABCA1-mediated cholesterol efflux generates microparticles in addition to HDL through processes governed by membrane rigidity.

doi: 10.1194/jlr.M800345-JLR200

Figure Lengend Snippet: Fig. 7. Effect of WGA on ABCA1 distribution and apoA-I binding. A: BHK cells were treated with and without WGA (10 mg/ml) for 2 h. Cells were then fixed and immuno-stained for ABCA1. Con- focal images were taken from both basal section (first row) and middle section (second row) of the cells. Mock cells had no visi- ble staining when the images were taken under identical condi- tion as for ABCA1 cells (third row). B: ABCA1 cells were treated with or without 10 mg/ml of WGA and 125I-apoA-I (10 mg/ml) for 2 h and cell-associated 125I-apoA-I was calculated by counting radioactivity in a g counter. Data represents average from tripli- cate samples and error bars expressing standard deviation from the mean.

Article Snippet: The polyclonal antibody against ABCA1 was from Novus Biological Inc. (Littleton, CO).

Techniques: Binding Assay, Staining, Radioactivity, Expressing, Standard Deviation

Journal: Journal of lipid research

Article Title: ABCA1-mediated cholesterol efflux generates microparticles in addition to HDL through processes governed by membrane rigidity.

doi: 10.1194/jlr.M800345-JLR200

Figure Lengend Snippet: Fig. 6. WGA inhibits HDL and microparticles formation. A: 3H- cholesterol released to the medium from BHK cells incubated with- out apoA-I for 8 h in the presence or absence of WGA (10 mg/ml). B, C: BHK cells induced to express ABCA1 were incubated with DMEM containing apoA-I (10 mg/ml) in the presence or absence of 10 mg/ml WGA for 4 h. Medium was collected and concentrated before FPLC analysis. B: Cells were treated identically as in A, ex- cept without apoA-I.

Article Snippet: The polyclonal antibody against ABCA1 was from Novus Biological Inc. (Littleton, CO).

Techniques: Incubation

Journal: Journal of lipid research

Article Title: ABCA1-mediated cholesterol efflux generates microparticles in addition to HDL through processes governed by membrane rigidity.

doi: 10.1194/jlr.M800345-JLR200

Figure Lengend Snippet: Fig. 8. Removal of WGA from the plasma membrane restores normal cholesterol efflux. A: BHK-ABCA1 cells were incubated with Alexa 488-WGA (10 mg/ml) for 2 h (left panel). Cells were then changed into WGA-free medium containing N-acetylglucosamine (200 mM) for another 2 h (right panel) before fluorescence microscopy observation. B: As indicated, 3H-cholesterol efflux was measured in BHK cells with or without apoA-I (10 mg/ml) for 2 h; or with apoA-I plus WGA (10 mg/ml) for 2 h; or in cells preincubated for 2 h with WGA, followed by 2 h efflux with apoA-I plus N- acetylglucosamine (200 mM).

Article Snippet: The polyclonal antibody against ABCA1 was from Novus Biological Inc. (Littleton, CO).

Techniques: Clinical Proteomics, Membrane, Incubation, Fluorescence, Microscopy

Journal: Journal of lipid research

Article Title: ABCA1-mediated cholesterol efflux generates microparticles in addition to HDL through processes governed by membrane rigidity.

doi: 10.1194/jlr.M800345-JLR200

Figure Lengend Snippet: Fig. 9. Membrane rigidifiers and fluidizers modulate cholesterol release to medium. BHK cells were labeled with 1 mCi/ml 3H- cholesterol for 2 days and ABCA1 expression was induced. Cells were pretreated for 2 h, and further coincubated for 2 h in the ab- sence or presence of 10 mg/ml apoA-I in medium containing the following agents: cholesteryl hemisuccinate (CH) (500 mM), a membrane rigidifier (A); benzyl alcohol (10 mM) (B) and hexanol (50 mM) (C), both membrane fluidizers, enhanced cholesterol re- lease to medium in ABCA1 expressing cells in the absence and the presence of apoA-I.

Article Snippet: The polyclonal antibody against ABCA1 was from Novus Biological Inc. (Littleton, CO).

Techniques: Membrane, Labeling, Expressing

Journal: Molecular medicine reports

Article Title: Effect of triptolide on the regulation of ATP‑binding cassette transporter A1 expression in lipopolysaccharide‑induced acute lung injury of rats.

doi: 10.3892/mmr.2014.2636

Figure Lengend Snippet: Figure 5. ABCA1 protein expression in lung tissue. *P<0.05 compared with the N and C groups. ΔP<0.05 compared with the L group. N, normal group; C, control group; L, LPS‑treated group; TP1‑3, triptolide‑treated group at 25, 50 or 100 µg/kg respectively; ABCA1, ATP‑binding cassette transporter A1.

Article Snippet: ABCA1 monoclonal antibody (article no. p3490RB) was purchased from R&D Systems (Minneapolis, MN, USA), GAPDH antibody (article no. sz‐293072) was obtained from Santa Cruz Biotechnology, Inc., (Santa Cruz, CA, USA) and rabbit anti-mouse immunoglobulin G (IgG) (article no. KTB4027) was purchased from Shanghai Boyao Biological Technology Co., Ltd., (Shanghai, China).

Techniques: Expressing, Control

Journal: Molecular medicine reports

Article Title: Effect of triptolide on the regulation of ATP‑binding cassette transporter A1 expression in lipopolysaccharide‑induced acute lung injury of rats.

doi: 10.3892/mmr.2014.2636

Figure Lengend Snippet: Figure 4. Changes in ABCA1 mRNA expression in the lung tissue of rats in all groups. *P<0.05 compared with the N and C groups. ΔP<0.05 compared with the L group. N, normal group; C, control group; L, LPS‑treated group; TP1‑3, triptolide treated group at 25, 50 or 100 µg/kg, respectively; ABCA1, ATP‑binding cassette transporter A1.

Article Snippet: ABCA1 monoclonal antibody (article no. p3490RB) was purchased from R&D Systems (Minneapolis, MN, USA), GAPDH antibody (article no. sz‐293072) was obtained from Santa Cruz Biotechnology, Inc., (Santa Cruz, CA, USA) and rabbit anti-mouse immunoglobulin G (IgG) (article no. KTB4027) was purchased from Shanghai Boyao Biological Technology Co., Ltd., (Shanghai, China).

Techniques: Expressing, Control