|
System Biosciences Inc
adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta ![]() Adeno Associated Virus Serotype 8 (Aav8) Encoding Shrna Against Ir: Ccctgaaggatggagtcttta, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta/product/System Biosciences Inc Average 90 stars, based on 1 article reviews
adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
InVivos Pte Ltd
4 × 10 11 gc aav8-alb-null virus ![]() 4 × 10 11 Gc Aav8 Alb Null Virus, supplied by InVivos Pte Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/4 × 10 11 gc aav8-alb-null virus/product/InVivos Pte Ltd Average 90 stars, based on 1 article reviews
4 × 10 11 gc aav8-alb-null virus - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Biowit Technologies
aav8-tbg-cre virus ![]() Aav8 Tbg Cre Virus, supplied by Biowit Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav8-tbg-cre virus/product/Biowit Technologies Average 90 stars, based on 1 article reviews
aav8-tbg-cre virus - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Shanghai Model Organisms Center
aav8-tbg-cre (aav-cre) virus ![]() Aav8 Tbg Cre (Aav Cre) Virus, supplied by Shanghai Model Organisms Center, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav8-tbg-cre (aav-cre) virus/product/Shanghai Model Organisms Center Average 90 stars, based on 1 article reviews
aav8-tbg-cre (aav-cre) virus - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
AveXis Inc
adeno-associated virus vectors (aav) 8 and 9 ![]() Adeno Associated Virus Vectors (Aav) 8 And 9, supplied by AveXis Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/adeno-associated virus vectors (aav) 8 and 9/product/AveXis Inc Average 90 stars, based on 1 article reviews
adeno-associated virus vectors (aav) 8 and 9 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Shanghai Genechem Ltd
adeno associated virus aav8-pparγ-rnai aav8-pparγ ![]() Adeno Associated Virus Aav8 Pparγ Rnai Aav8 Pparγ, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/adeno associated virus aav8-pparγ-rnai aav8-pparγ/product/Shanghai Genechem Ltd Average 90 stars, based on 1 article reviews
adeno associated virus aav8-pparγ-rnai aav8-pparγ - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
DIRUI Industrial Co Ltd
recombinant adeno-associated virus 8 (aav8 ![]() Recombinant Adeno Associated Virus 8 (Aav8, supplied by DIRUI Industrial Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant adeno-associated virus 8 (aav8/product/DIRUI Industrial Co Ltd Average 90 stars, based on 1 article reviews
recombinant adeno-associated virus 8 (aav8 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Healgen Scientific
aav8-shacc1 virus ![]() Aav8 Shacc1 Virus, supplied by Healgen Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav8-shacc1 virus/product/Healgen Scientific Average 90 stars, based on 1 article reviews
aav8-shacc1 virus - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: Insulin receptor associates with promoters genome-wide and regulates gene expression
doi: 10.1016/j.cell.2019.02.030
Figure Lengend Snippet: Key Resource Table
Article Snippet: Adeno-Associated Virus serotype 8 (AAV8) encoding shRNA against IR:
Techniques: Magnetic Beads, Virus, shRNA, Control, Recombinant, Protease Inhibitor, Fractionation, Cell Culture, Purification, SYBR Green Assay, Mutagenesis, Luciferase, CCK-8 Assay, Colorimetric Assay, Quantitation Assay, Sequencing, Molecular Cloning, Plasmid Preparation, Software
Journal: Nature Communications
Article Title: Hepatocyte-specific IL11 cis-signaling drives lipotoxicity and underlies the transition from NAFLD to NASH
doi: 10.1038/s41467-020-20303-z
Figure Lengend Snippet: a Schematic of WDF feeding in mice with hepatocyte-specific expression of sgp130 for data shown in ( b – p ). Three weeks following AAV8-Alb-Null or AAV8-Alb-sgp130 virus injection, mice were fed WDF for 16 weeks. b Western blots showing hepatic levels of sgp130, IL11, IL6, and GAPDH as internal control ( n = 4 mice/group). c Serum IL11 levels. d Serum IL6 levels. e Representative gross anatomy, H&E-stained (scale bars, 50 µm), and Masson’s Trichrome (scale bars, 100 µm) images of livers. Representative dataset from n = 8 mice/group is shown for gross anatomy; representative dataset from n = 4 mice/group is shown for H&E-stained and Masson’s Trichrome images. f Liver weight. g Hepatic triglycerides content. h Serum ALT levels. i Serum AST levels. j Hepatic collagen levels. k Fasting blood glucose levels. l Serum triglycerides levels. m Serum cholesterol levels. n Hepatic GSH content. o Hepatic pro-inflammatory and fibrotic genes expression heatmap (values are shown in Supplementary Fig. and e). p Western blots of hepatic phospho-ERK, ERK, phospho-JNK, JNK, phospho-STAT3, and STAT3 ( n = 4 mice/group). c , d , f – o n = 8 mice/group. c , d , f – n Data are shown as box-and-whisker with median (middle line), 25th–75th percentiles (box), and min–max values (whiskers); one-way ANOVA with Tukey’s correction. Source data are provided as a Source data file.
Article Snippet: Six- to eight-week-old male C57BL/6N mice (
Techniques: Expressing, Injection, Western Blot, Staining, Whisker Assay
Journal: Nature Communications
Article Title: Hepatocyte-specific IL11 cis-signaling drives lipotoxicity and underlies the transition from NAFLD to NASH
doi: 10.1038/s41467-020-20303-z
Figure Lengend Snippet: a Schematic of HFMCD feeding regimen for AAV8-Alb-Cre injected Il11ra1 loxP/loxP (conditional knockout; CKO) mice for experiments shown in ( b – k ). Il11ra1 loxP/loxP mice were intravenously injected with either AAV8-Alb-Null or AAV8-Alb-Cre to delete Il11ra1 specifically in hepatocytes 3 weeks prior to the start of HFMCD diet. b Western blots of hepatic IL11RA and GAPDH ( n = 3 mice/group). c Body weight (shown as a percentage (%) of initial body weight). d Representative gross anatomy, H&E-stained (scale bars, 50 µm), and Masson’s Trichrome (scale bars, 100 µm) images of livers. Representative dataset from n = 5 mice/group is shown for gross anatomy; representative dataset from n = 4 mice/group is shown for H&E-stained and Masson’s Trichrome images. e Hepatic triglycerides content. f Serum ALT levels. g Serum AST levels. h Hepatic GSH content. i Hepatic collagen levels. j Heatmap showing hepatic mRNA expression of pro-inflammatory markers ( Tnfα , Ccl2 , Ccl5 ) and fibrotic markers ( Col1a1, Col1a2, Col3a1, Acta2) . Values are shown in Supplementary Fig. and d. k Western blots showing hepatic ERK and JNK activation status ( n = 3 mice/group). c , e – j NCD ( n = 5 mice/group), HFMCD ( n = 6 mice/group). c Data are shown as mean ± SD, two-way ANOVA with Tukey’s correction, statistical significance ( P values) are shown for comparison between WT HFMCD and CKO HFMCD; e – i data are shown as box-and-whisker with median (middle line), 25th–75th percentiles (box), and min–max values (whiskers); two-way ANOVA with Tukey’s correction. Source data are provided as a Source data file.
Article Snippet: Six- to eight-week-old male C57BL/6N mice (
Techniques: Injection, Knock-Out, Western Blot, Staining, Expressing, Activation Assay, Whisker Assay
Journal: Nature Communications
Article Title: Hepatocyte-specific IL11 cis-signaling drives lipotoxicity and underlies the transition from NAFLD to NASH
doi: 10.1038/s41467-020-20303-z
Figure Lengend Snippet: a Schematic of WDF-fed control and CKO mice for data shown in ( b – m ). Three weeks following AAV8-Alb-Null or AAV8-Alb-Cre virus injection, CKO mice were fed WDF for 16 weeks. b Western blots showing hepatic levels of IL11RA and GAPDH ( n = 3 mice/group). c Body weight (shown as a percentage (%) of initial body weight). d Fat mass. e Representative gross anatomy, H&E-stained (scale bars, 50 µm), and Masson’s Trichrome (scale bars, 100 µm) images of livers. Representative dataset from n = 5/group is shown for gross anatomy; representative dataset from n = 4 mice/group is shown for H&E-stained and Masson’s Trichrome images. f Hepatic triglycerides content. g Liver weight. h Serum ALT levels. i Serum AST levels. j Hepatic GSH content. k Hepatic collagen levels. l Hepatic pro-inflammatory and fibrotic genes expression on heatmap (values are shown in Supplementary Fig. and d). m Western blots showing activation status of hepatic ERK and JNK ( n = 3 mice/group). c , d , f – l n = 5 mice/group. c , d Data are shown as mean ± SD, two-way ANOVA with Tukey’s correction, statistical significance ( P values) are shown for comparison between WT WDF and CKO WDF; f – k data are shown as box-and-whisker with median (middle line), 25th–75th percentiles (box), and min–max values (whiskers); two-way ANOVA with Tukey’s correction. Source data are provided as a Source data file.
Article Snippet: Six- to eight-week-old male C57BL/6N mice (
Techniques: Injection, Western Blot, Staining, Expressing, Activation Assay, Whisker Assay
Journal: Nature Communications
Article Title: Hepatocyte-specific IL11 cis-signaling drives lipotoxicity and underlies the transition from NAFLD to NASH
doi: 10.1038/s41467-020-20303-z
Figure Lengend Snippet: a Schematic showing WDF feeding regimen of Il11ra1 +/+ (WT) and Il11ra1 −/− (KO) mice for experiments shown in ( b – n ). AAV8-Alb-Null, AAV8-Alb-mbIl11ra1 (full-length membrane-bound Il11ra1), and AAV8-Alb-sIl11ra1 (soluble form of Il11ra1)-injected KO mice were given 16 weeks of WDF feeding, three weeks following virus administration. b Western blots showing hepatic levels of IL11RA and GAPDH ( n = 2 mice/group). c Representative gross anatomy, H&E-stained (scale bars, 50 µm) and Masson’s Trichrome (scale bars, 100 µm) images of livers. Representative dataset from n = 6 mice/group is shown for gross anatomy; representative dataset from n = 4 mice/group is shown for H&E-stained and Masson’s Trichrome images. d Liver weight. e Hepatic triglycerides content. f Serum ALT levels. g Serum AST levels. h Hepatic GSH content. i Hepatic collagen content. j Hepatic pro-inflammatory and fibrotic genes expression heatmap (values are shown in Supplementary Fig. and d). k Western blots showing activation status of hepatic ERK and JNK ( n = 2 mice/group). l Fasting blood glucose levels. m Serum triglycerides levels. n Serum cholesterol levels. d – j , l – n n = 6 mice/group. d – i , l – n Data are shown as box-and-whisker with median (middle line), 25th–75th percentiles (box), and min–max values (whiskers); one-way ANOVA with Tukey’s correction. Source data are provided as a Source data file.
Article Snippet: Six- to eight-week-old male C57BL/6N mice (
Techniques: Injection, Western Blot, Staining, Expressing, Activation Assay, Whisker Assay