aav8 serotype Search Results


90
PlasmidFactory gmbh aav8-slu7
Aav8 Slu7, supplied by PlasmidFactory gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav8-slu7/product/PlasmidFactory gmbh
Average 90 stars, based on 1 article reviews
aav8-slu7 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
System Biosciences Inc adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta
Key Resource Table
Adeno Associated Virus Serotype 8 (Aav8) Encoding Shrna Against Ir: Ccctgaaggatggagtcttta, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta/product/System Biosciences Inc
Average 90 stars, based on 1 article reviews
adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Alnylam Inc adeno-associated viruses aav8 serotype
Key Resource Table
Adeno Associated Viruses Aav8 Serotype, supplied by Alnylam Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/adeno-associated viruses aav8 serotype/product/Alnylam Inc
Average 90 stars, based on 1 article reviews
adeno-associated viruses aav8 serotype - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Tamai Kasei Co Ltd aav8 serotype
Key Resource Table
Aav8 Serotype, supplied by Tamai Kasei Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav8 serotype/product/Tamai Kasei Co Ltd
Average 90 stars, based on 1 article reviews
aav8 serotype - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


Key Resource Table

Journal: Cell

Article Title: Insulin receptor associates with promoters genome-wide and regulates gene expression

doi: 10.1016/j.cell.2019.02.030

Figure Lengend Snippet: Key Resource Table

Article Snippet: Adeno-Associated Virus serotype 8 (AAV8) encoding shRNA against IR: CCCTGAAGGATGGAGTCTTTA , This paper , System Biosciences Inc..

Techniques: Magnetic Beads, Virus, shRNA, Control, Recombinant, Protease Inhibitor, Fractionation, Cell Culture, Purification, SYBR Green Assay, Mutagenesis, Luciferase, CCK-8 Assay, Colorimetric Assay, Quantitation Assay, Sequencing, Molecular Cloning, Plasmid Preparation, Software