90
|
PlasmidFactory gmbh
aav8-slu7 Aav8 Slu7, supplied by PlasmidFactory gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav8-slu7/product/PlasmidFactory gmbh Average 90 stars, based on 1 article reviews
aav8-slu7 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
System Biosciences Inc
adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta ![]() Adeno Associated Virus Serotype 8 (Aav8) Encoding Shrna Against Ir: Ccctgaaggatggagtcttta, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta/product/System Biosciences Inc Average 90 stars, based on 1 article reviews
adeno-associated virus serotype 8 (aav8) encoding shrna against ir: ccctgaaggatggagtcttta - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Alnylam Inc
adeno-associated viruses aav8 serotype ![]() Adeno Associated Viruses Aav8 Serotype, supplied by Alnylam Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/adeno-associated viruses aav8 serotype/product/Alnylam Inc Average 90 stars, based on 1 article reviews
adeno-associated viruses aav8 serotype - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Tamai Kasei Co Ltd
aav8 serotype ![]() Aav8 Serotype, supplied by Tamai Kasei Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav8 serotype/product/Tamai Kasei Co Ltd Average 90 stars, based on 1 article reviews
aav8 serotype - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: Insulin receptor associates with promoters genome-wide and regulates gene expression
doi: 10.1016/j.cell.2019.02.030
Figure Lengend Snippet: Key Resource Table
Article Snippet: Adeno-Associated Virus serotype 8 (AAV8) encoding shRNA against IR:
Techniques: Magnetic Beads, Virus, shRNA, Control, Recombinant, Protease Inhibitor, Fractionation, Cell Culture, Purification, SYBR Green Assay, Mutagenesis, Luciferase, CCK-8 Assay, Colorimetric Assay, Quantitation Assay, Sequencing, Molecular Cloning, Plasmid Preparation, Software