|
Vector Biolabs
aav5 cag flex mcherry Aav5 Cag Flex Mcherry, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/pm37018397-319-16-30?v=Vector+Biolabs Average 94 stars, based on 1 article reviews
aav5 cag flex mcherry - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
OriGene
ada adk5a anti aav5 origene tecnologies cat bm5095 Ada Adk5a Anti Aav5 Origene Tecnologies Cat Bm5095, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/pm30664785__41591_2018_327_MOESM2_ESM-42-1-5?v=OriGene Average 90 stars, based on 1 article reviews
ada adk5a anti aav5 origene tecnologies cat bm5095 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
OriGene
adk5b ![]() Adk5b, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/pmc07698955-144-25-26?v=OriGene Average 91 stars, based on 1 article reviews
adk5b - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Vector Biolabs
construct termed aav5 u6 shfign cmv gfp ![]() Construct Termed Aav5 U6 Shfign Cmv Gfp, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/pmc06507085-401-6-17?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
construct termed aav5 u6 shfign cmv gfp - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Biosynth Carbosynth
rabbit polyclonal anti aav5 antibody ![]() Rabbit Polyclonal Anti Aav5 Antibody, supplied by Biosynth Carbosynth, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/pm31193016-202-14-18?v=Biosynth+Carbosynth Average 90 stars, based on 1 article reviews
rabbit polyclonal anti aav5 antibody - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Vector Biolabs
control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa ![]() Control Virus Aav5 Gfp U6 Scrmb Shrna Caacaagatgaagagcaccaa, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/10__1523_slash_jneurosci__0406___21__2021-79-11-17?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Vector Biolabs
aav5 cre ![]() Aav5 Cre, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/pmc04058554-54-3-12?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
aav5 cre - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Vector Biolabs
aav5 gfap 0 7 ![]() Aav5 Gfap 0 7, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/cahill_michelle_kimberly__2023__dissecting_cortical_astrocyte_network_dynamics_using_all_optical_approaches-899-4-5?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
aav5 gfap 0 7 - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Vector Biolabs
aav cre gfp virus ![]() Aav Cre Gfp Virus, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/10__1164_slash_rccm__201910___1958oc-448-22-24?v=Vector+Biolabs Average 90 stars, based on 1 article reviews
aav cre gfp virus - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Vector Biolabs
cre recombinase aav5 gfap 0 7 icre t2a mcherry ![]() Cre Recombinase Aav5 Gfap 0 7 Icre T2a Mcherry, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/bio_rxiv__2025__07__07__663457-269-22-34?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
cre recombinase aav5 gfap 0 7 icre t2a mcherry - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Vector Biolabs
virus core gvvc aav 95 aav5 cag ![]() Virus Core Gvvc Aav 95 Aav5 Cag, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav5/pm36049479-176-19-38?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
virus core gvvc aav 95 aav5 cag - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Viruses
Article Title: The Structure of an AAV5-AAVR Complex at 2.5 Å Resolution: Implications for Cellular Entry and Immune Neutralization of AAV Gene Therapy Vectors
doi: 10.3390/v12111326
Figure Lengend Snippet: Overlap in the binding sites on AAV5 of receptor AAV5 and antibodies ADK5a & ADK5b. ( A ) The solvent accessible surface of AAV5 is colored with the ADK5a footprint blue, AKD5b red, and amino acids common to both, purple. The footprints comprise residues identified in prior EM structures at 11 Å resolution . Three-fold symmetry axes, marked as triangles, map to equatorial three-folds left and right of center in B, while the five-fold (pentagon) maps to a five-fold above center on the mid-line of B. The view in in B and here is down a two-fold axis. ( B ) The current structure of AAVR’s PKD1 is overlaid (with its symmetry equivalents), showing that the antibody footprints are substantially occluded. ( C – E ) Roadmap projections of the AAV5 surface colored by distance from the center of the virus. The perspective is the same as in panels A & B. The triangle shows one unique asymmetric unit of the surface, which, if expanded 60-fold by the icosahedral symmetry, would generate the entire virus surface. ( C ) The contact footprint of AAVR PKD1 is outlined in white. It is concentrated on the side of a three-fold spike, and although the domain occludes access to a swath leading up towards the five-fold, there is not the previously reported contact near the five-fold pore. A magnified version is provided in the supplement with residues labeled. ( D,E ) illustrate the footprints of ADK5b and ADK5a superimposed on that of AAVR PKD1, showing substantial overlap.
Article Snippet: To test the competition of various concentrations of PKD1 with a constant concentration of the AAV5 antibodies ADK5a (Progen, Heidelberg, Germany, cat. no. 615148) or
Techniques: Binding Assay, Solvent, Virus, Data-independent acquisition, Labeling
Journal: Viruses
Article Title: The Structure of an AAV5-AAVR Complex at 2.5 Å Resolution: Implications for Cellular Entry and Immune Neutralization of AAV Gene Therapy Vectors
doi: 10.3390/v12111326
Figure Lengend Snippet: Competition assays of ADK5a, ADK5b, and PKD1. ( A ) ELISA of antibody binding to AAV5 with constant antibody concentration and differing levels of PKD1 concentration, performed as six replicates and normalized to a positive control without PKD1. ( B ) ELISA of PKD1 binding to AAV5 with a constant PKD1 concentration of 0.1µM and various levels of ADK5a performed in triplicate and normalized to a positive control without antibody. ( C ) The same as B but with ADK5b instead of ADK5a. All error bars are ± 1 standard deviation.
Article Snippet: To test the competition of various concentrations of PKD1 with a constant concentration of the AAV5 antibodies ADK5a (Progen, Heidelberg, Germany, cat. no. 615148) or
Techniques: Enzyme-linked Immunosorbent Assay, Binding Assay, Concentration Assay, Positive Control, Standard Deviation