aaagcccaaatttccttgct3 ′ Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Roche fast start taq dna polymerase
    Fast Start Taq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 89/100, based on 249 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast start taq dna polymerase/product/Roche
    Average 89 stars, based on 249 article reviews
    Price from $9.99 to $1999.99
    fast start taq dna polymerase - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    92
    Roche deoxynucleoside triphosphates dntps
    Deoxynucleoside Triphosphates Dntps, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 284 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphates dntps/product/Roche
    Average 92 stars, based on 284 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphates dntps - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    88
    Roche gc rich buffer
    Gc Rich Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gc rich buffer/product/Roche
    Average 88 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    gc rich buffer - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    mgcl2  (Roche)
    95
    Roche mgcl2
    Mgcl2, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 50461 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mgcl2/product/Roche
    Average 95 stars, based on 50461 article reviews
    Price from $9.99 to $1999.99
    mgcl2 - by Bioz Stars, 2020-08
    95/100 stars
      Buy from Supplier

    88
    Roche polymerase chain reaction pcr fragment
    Polymerase Chain Reaction Pcr Fragment, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr fragment/product/Roche
    Average 88 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr fragment - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    88
    Roche fast start taq dna polymerase buffer
    Fast Start Taq Dna Polymerase Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast start taq dna polymerase buffer/product/Roche
    Average 88 stars, based on 43 article reviews
    Price from $9.99 to $1999.99
    fast start taq dna polymerase buffer - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    Image Search Results