86
|
Jackson Laboratory
n a mouse N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/pm41747734-293-219-223?v=Jackson+Laboratory Average 86 stars, based on 1 article reviews
n a mouse - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Merck & Co
ggccttcgtttttgataagtc merck n a primer Ggccttcgtttttgataagtc Merck N A Primer, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/pmc12281364__mmc2-633-226-227?v=Merck+%26+Co Average 86 stars, based on 1 article reviews
ggccttcgtttttgataagtc merck n a primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Wikimedia Foundation
a n A N, supplied by Wikimedia Foundation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/10__7146_slash_nys__v1i60__129348-91-1-21?v=Wikimedia+Foundation Average 86 stars, based on 1 article reviews
a n - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
nnnnnnnnncggcatggacgagctg sangon biotech n a linker sadbc f Nnnnnnnnncggcatggacgagctg Sangon Biotech N A Linker Sadbc F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/pm41338187-478-0-1?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
nnnnnnnnncggcatggacgagctg sangon biotech n a linker sadbc f - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Azenta
genewiz n a id3 cdnaseq f Genewiz N A Id3 Cdnaseq F, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/pmc12490220__mmc1-42-12-12?v=Azenta Average 86 stars, based on 1 article reviews
genewiz n a id3 cdnaseq f - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Merck & Co
eluent a Eluent A, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/pmc12413491-148-6-18?v=Merck+%26+Co Average 86 stars, based on 1 article reviews
eluent a - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Photonics Inc
a a f j A A F J, supplied by Photonics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/10__3390_slash_photonics11030262-221-88-89?v=Photonics+Inc Average 86 stars, based on 1 article reviews
a a f j - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Macklin Inc
won jae lee n a escherichia coli atcc attc Won Jae Lee N A Escherichia Coli Atcc Attc, supplied by Macklin Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/pm40811058-222-198-212?v=Macklin+Inc Average 86 stars, based on 1 article reviews
won jae lee n a escherichia coli atcc attc - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
paper n a tn5 primera Paper N A Tn5 Primera, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/pm40633538-330-26-31?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
paper n a tn5 primera - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
A-M Systems
alloy Alloy, supplied by A-M Systems, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/us12473875-69-5-8?v=A-M+Systems Average 86 stars, based on 1 article reviews
alloy - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Merck & Co
hcl p a Hcl P A, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/10__24198_slash_cna__v8__n3__31564-36-76-78?v=Merck+%26+Co Average 86 stars, based on 1 article reviews
hcl p a - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
sangon biotech n a primer Sangon Biotech N A Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/a/pm41534530-729-51-52?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
sangon biotech n a primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |