N/A
|
strong MicroRNA hsa miR 520f 5p strong Accession Number MIMAT0026609 Mature Sequence CCUCUAAAGGGAAGCGCUUUCU hsa miR 520f 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
|
Buy from Supplier |
N/A
86
|
Bruker Corporation
m1446 m1447 data collection bruker apex duo 4k ccd diffractometer radiation source M1446 M1447 Data Collection Bruker Apex Duo 4k Ccd Diffractometer Radiation Source, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m1446 m1447 data collection bruker apex duo 4k ccd diffractometer radiation source/product/Bruker Corporation Average 86 stars, based on 1 article reviews Price from $9.99 to $1999.99
m1446 m1447 data collection bruker apex duo 4k ccd diffractometer radiation source - by Bioz Stars,
2023-01
86/100 stars
|
Buy from Supplier |
86
|
HiMedia Laboratories
selective enrichment rappaport vassiliadis soybean meal broth Selective Enrichment Rappaport Vassiliadis Soybean Meal Broth, supplied by HiMedia Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/selective enrichment rappaport vassiliadis soybean meal broth/product/HiMedia Laboratories Average 86 stars, based on 1 article reviews Price from $9.99 to $1999.99
selective enrichment rappaport vassiliadis soybean meal broth - by Bioz Stars,
2023-01
86/100 stars
|
Buy from Supplier |