M14478 Search Results


90
HiMedia Laboratories rappaport vassiliadis soybean meal broth
Rappaport Vassiliadis Soybean Meal Broth, supplied by HiMedia Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rappaport vassiliadis soybean meal broth/product/HiMedia Laboratories
Average 90 stars, based on 1 article reviews
rappaport vassiliadis soybean meal broth - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Bruker Corporation apex duo 4k ccd diffractometer
Apex Duo 4k Ccd Diffractometer, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/apex duo 4k ccd diffractometer/product/Bruker Corporation
Average 90 stars, based on 1 article reviews
apex duo 4k ccd diffractometer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

N/A
MicroRNA: hsa-miR-520f-5p Accession Number: MIMAT0026609 Mature Sequence: CCUCUAAAGGGAAGCGCUUUCU hsa-miR-520f-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
  Buy from Supplier



N/A
Boster Bio Anti-SMYD4 Monoclonal Antibody catalog # M14482. Tested in ELISA, WB applications. This antibody reacts with Human.
  Buy from Supplier


N/A
MicroRNA: hsa-miR-556-5p Accession Number: MIMAT0003220 Mature Sequence: GAUGAGCUCAUUGUAAUAUGAG hsa-miR-556-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
  Buy from Supplier

N/A
Gm14486 CRISPRa kit CRISPR gene activation of mouse predicted gene 14486
  Buy from Supplier

N/A
Gm14486 Mouse 3 unique 27mer siRNA duplexes 2 nmol each
  Buy from Supplier


N/A
Recombinant Mouse GM14482 full length or partial length protein was expressed.http://www.creativebiomart.net/Recombinant-Mouse-GM14482-Protein-442092.htm
  Buy from Supplier

Image Search Results