M14478 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    strong MicroRNA hsa miR 520f 5p strong Accession Number MIMAT0026609 Mature Sequence CCUCUAAAGGGAAGCGCUUUCU hsa miR 520f 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
      Buy from Supplier


    86
    Bruker Corporation m1446 m1447 data collection bruker apex duo 4k ccd diffractometer radiation source
    M1446 M1447 Data Collection Bruker Apex Duo 4k Ccd Diffractometer Radiation Source, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m1446 m1447 data collection bruker apex duo 4k ccd diffractometer radiation source/product/Bruker Corporation
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    m1446 m1447 data collection bruker apex duo 4k ccd diffractometer radiation source - by Bioz Stars, 2023-01
    86/100 stars
      Buy from Supplier

    86
    HiMedia Laboratories selective enrichment rappaport vassiliadis soybean meal broth
    Selective Enrichment Rappaport Vassiliadis Soybean Meal Broth, supplied by HiMedia Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/selective enrichment rappaport vassiliadis soybean meal broth/product/HiMedia Laboratories
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    selective enrichment rappaport vassiliadis soybean meal broth - by Bioz Stars, 2023-01
    86/100 stars
      Buy from Supplier


    Image Search Results