M04512 Search Results


98
New England Biolabs nebnext high fidelity 2x pcr master mix
Nebnext High Fidelity 2x Pcr Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext high fidelity 2x pcr master mix/product/New England Biolabs
Average 98 stars, based on 1 article reviews
nebnext high fidelity 2x pcr master mix - by Bioz Stars, 2026-04
98/100 stars
  Buy from Supplier

90
Agilent technologies cd3
( a,b ) The frequencies (means ± SEM) of CD4, CD8 and <t>CD20</t> positive cells in ( a ) BAL and ( b ) the lungs (*p < 0.05 compared to day 0). ( c,d ) The percentage of naïve, central memory (CM) and effector memory (EM) CD4 and CD8 T cells in the ( c ) BAL ( & p < 0.05 for CM; * p < 0.05 for EM compared to day 0) and ( d ) lungs ( & p < 0.05 for CM; *p < 0.05 for EM; # p < 0.05 for naïve compared to day 0). ( e,f ) The percentage of plasmacytoid DCs (pDCs), myeloid DCs (mDCs), and macrophages (MACs) in ( e ) BAL and ( f ) lungs ( & p < 0.05 for MACs; *p < 0.05 for pDCs; # p < 0.05 for mDCs). BAL: n = 14 (0 days post infection, DPI), n = 11 (3 DPI), n = 8 (7 DPI), n = 5 (10 DPI), n = 3 (14 DPI); Lung: n = 3 (0 DPI), n = 3 (3 DPI), n = 3 (7 DPI), n = 2 (10 DPI), n = 3 (14 DPI). Tissues used were from the infected right lobe.
Cd3, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cd3/product/Agilent technologies
Average 90 stars, based on 1 article reviews
cd3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Agilent technologies anti–t lymphocytes
( a,b ) The frequencies (means ± SEM) of CD4, CD8 and <t>CD20</t> positive cells in ( a ) BAL and ( b ) the lungs (*p < 0.05 compared to day 0). ( c,d ) The percentage of naïve, central memory (CM) and effector memory (EM) CD4 and CD8 T cells in the ( c ) BAL ( & p < 0.05 for CM; * p < 0.05 for EM compared to day 0) and ( d ) lungs ( & p < 0.05 for CM; *p < 0.05 for EM; # p < 0.05 for naïve compared to day 0). ( e,f ) The percentage of plasmacytoid DCs (pDCs), myeloid DCs (mDCs), and macrophages (MACs) in ( e ) BAL and ( f ) lungs ( & p < 0.05 for MACs; *p < 0.05 for pDCs; # p < 0.05 for mDCs). BAL: n = 14 (0 days post infection, DPI), n = 11 (3 DPI), n = 8 (7 DPI), n = 5 (10 DPI), n = 3 (14 DPI); Lung: n = 3 (0 DPI), n = 3 (3 DPI), n = 3 (7 DPI), n = 2 (10 DPI), n = 3 (14 DPI). Tissues used were from the infected right lobe.
Anti–T Lymphocytes, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti–t lymphocytes/product/Agilent technologies
Average 90 stars, based on 1 article reviews
anti–t lymphocytes - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

N/A
The Leptin R Antibody (MM0452-9L34) [DyLight 405] from Novus is a Leptin R antibody to Leptin R. This antibody reacts with Human. The Leptin R antibody has been validated for the following applications: Western Blot,
  Buy from Supplier

N/A
Boster Bio CDX1 mouse monoclonal antibody,clone OTI2A5. Catalog# M04522. Tested in IHC, WB. This antibody reacts with Human, Mouse.
  Buy from Supplier

N/A
Boster Bio Anti-RAB11B Antibody Picoband® (monoclonal, 6C5) catalog # M04526. Tested in Flow Cytometry, IF, ICC, WB applications. This antibody reacts with Human, Mouse, Rat. The brand Picoband indicates this is a premium antibody that
  Buy from Supplier

N/A
Dimethyldodecylamine
  Buy from Supplier

N/A
MicroRNA: hsa-miR-6770-3p Accession Number: MIMAT0027441 Mature Sequence: CUGGCGGCUGUGUCUUCACAG hsa-miR-6770-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
  Buy from Supplier

N/A
MicroRNA: hsa-miR-6820-3p Accession Number: MIMAT0027541 Mature Sequence: UGUGACUUCUCCCCUGCCACAG hsa-miR-6820-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
  Buy from Supplier

Image Search Results


( a,b ) The frequencies (means ± SEM) of CD4, CD8 and CD20 positive cells in ( a ) BAL and ( b ) the lungs (*p < 0.05 compared to day 0). ( c,d ) The percentage of naïve, central memory (CM) and effector memory (EM) CD4 and CD8 T cells in the ( c ) BAL ( & p < 0.05 for CM; * p < 0.05 for EM compared to day 0) and ( d ) lungs ( & p < 0.05 for CM; *p < 0.05 for EM; # p < 0.05 for naïve compared to day 0). ( e,f ) The percentage of plasmacytoid DCs (pDCs), myeloid DCs (mDCs), and macrophages (MACs) in ( e ) BAL and ( f ) lungs ( & p < 0.05 for MACs; *p < 0.05 for pDCs; # p < 0.05 for mDCs). BAL: n = 14 (0 days post infection, DPI), n = 11 (3 DPI), n = 8 (7 DPI), n = 5 (10 DPI), n = 3 (14 DPI); Lung: n = 3 (0 DPI), n = 3 (3 DPI), n = 3 (7 DPI), n = 2 (10 DPI), n = 3 (14 DPI). Tissues used were from the infected right lobe.

Journal: Scientific Reports

Article Title: Genomic and functional analysis of the host response to acute simian varicella infection in the lung

doi: 10.1038/srep34164

Figure Lengend Snippet: ( a,b ) The frequencies (means ± SEM) of CD4, CD8 and CD20 positive cells in ( a ) BAL and ( b ) the lungs (*p < 0.05 compared to day 0). ( c,d ) The percentage of naïve, central memory (CM) and effector memory (EM) CD4 and CD8 T cells in the ( c ) BAL ( & p < 0.05 for CM; * p < 0.05 for EM compared to day 0) and ( d ) lungs ( & p < 0.05 for CM; *p < 0.05 for EM; # p < 0.05 for naïve compared to day 0). ( e,f ) The percentage of plasmacytoid DCs (pDCs), myeloid DCs (mDCs), and macrophages (MACs) in ( e ) BAL and ( f ) lungs ( & p < 0.05 for MACs; *p < 0.05 for pDCs; # p < 0.05 for mDCs). BAL: n = 14 (0 days post infection, DPI), n = 11 (3 DPI), n = 8 (7 DPI), n = 5 (10 DPI), n = 3 (14 DPI); Lung: n = 3 (0 DPI), n = 3 (3 DPI), n = 3 (7 DPI), n = 2 (10 DPI), n = 3 (14 DPI). Tissues used were from the infected right lobe.

Article Snippet: Tissues were then stained with primary antibodies CD3 (1:200 dilution, Dako M0452, CD20 (1:300 dilution, Dako M0755), CD68 (1:75, Dako, Ki67 1:150 dilution, Dako MIB-1), granzyme B (1:200 dilution, Millipore, Temecula, CA) and VZV glycoprotein B (1:200 dilution, antibodies-online.com clone SG2-2E6).

Techniques: Infection

CD3, CD20, CD68, granzyme B and Ki67 staining in lung sections from ( a ) naïve, ( b ) 7 DPI and ( c ) 14 DPI at 20X and 40X magnification.

Journal: Scientific Reports

Article Title: Genomic and functional analysis of the host response to acute simian varicella infection in the lung

doi: 10.1038/srep34164

Figure Lengend Snippet: CD3, CD20, CD68, granzyme B and Ki67 staining in lung sections from ( a ) naïve, ( b ) 7 DPI and ( c ) 14 DPI at 20X and 40X magnification.

Article Snippet: Tissues were then stained with primary antibodies CD3 (1:200 dilution, Dako M0452, CD20 (1:300 dilution, Dako M0755), CD68 (1:75, Dako, Ki67 1:150 dilution, Dako MIB-1), granzyme B (1:200 dilution, Millipore, Temecula, CA) and VZV glycoprotein B (1:200 dilution, antibodies-online.com clone SG2-2E6).

Techniques: Staining