|
New England Biolabs
nebnext high fidelity 2x pcr master mix Nebnext High Fidelity 2x Pcr Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nebnext high fidelity 2x pcr master mix/product/New England Biolabs Average 98 stars, based on 1 article reviews
nebnext high fidelity 2x pcr master mix - by Bioz Stars,
2026-04
98/100 stars
|
Buy from Supplier |
|
Agilent technologies
cd3 ![]() Cd3, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cd3/product/Agilent technologies Average 90 stars, based on 1 article reviews
cd3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Agilent technologies
anti–t lymphocytes ![]() Anti–T Lymphocytes, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti–t lymphocytes/product/Agilent technologies Average 90 stars, based on 1 article reviews
anti–t lymphocytes - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
The Leptin R Antibody (MM0452-9L34) [DyLight 405] from Novus is a Leptin R antibody to Leptin R. This antibody reacts with Human. The Leptin R antibody has been validated for the following applications: Western Blot,
|
Buy from Supplier |
|
Boster Bio CDX1 mouse monoclonal antibody,clone OTI2A5. Catalog# M04522. Tested in IHC, WB. This antibody reacts with Human, Mouse.
|
Buy from Supplier |
|
Boster Bio Anti-RAB11B Antibody Picoband® (monoclonal, 6C5) catalog # M04526. Tested in Flow Cytometry, IF, ICC, WB applications. This antibody reacts with Human, Mouse, Rat. The brand Picoband indicates this is a premium antibody that
|
Buy from Supplier |
|
MicroRNA: hsa-miR-6770-3p Accession Number: MIMAT0027441 Mature Sequence: CUGGCGGCUGUGUCUUCACAG hsa-miR-6770-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
|
MicroRNA: hsa-miR-6820-3p Accession Number: MIMAT0027541 Mature Sequence: UGUGACUUCUCCCCUGCCACAG hsa-miR-6820-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
Image Search Results
Journal: Scientific Reports
Article Title: Genomic and functional analysis of the host response to acute simian varicella infection in the lung
doi: 10.1038/srep34164
Figure Lengend Snippet: ( a,b ) The frequencies (means ± SEM) of CD4, CD8 and CD20 positive cells in ( a ) BAL and ( b ) the lungs (*p < 0.05 compared to day 0). ( c,d ) The percentage of naïve, central memory (CM) and effector memory (EM) CD4 and CD8 T cells in the ( c ) BAL ( & p < 0.05 for CM; * p < 0.05 for EM compared to day 0) and ( d ) lungs ( & p < 0.05 for CM; *p < 0.05 for EM; # p < 0.05 for naïve compared to day 0). ( e,f ) The percentage of plasmacytoid DCs (pDCs), myeloid DCs (mDCs), and macrophages (MACs) in ( e ) BAL and ( f ) lungs ( & p < 0.05 for MACs; *p < 0.05 for pDCs; # p < 0.05 for mDCs). BAL: n = 14 (0 days post infection, DPI), n = 11 (3 DPI), n = 8 (7 DPI), n = 5 (10 DPI), n = 3 (14 DPI); Lung: n = 3 (0 DPI), n = 3 (3 DPI), n = 3 (7 DPI), n = 2 (10 DPI), n = 3 (14 DPI). Tissues used were from the infected right lobe.
Article Snippet: Tissues were then stained with primary
Techniques: Infection
Journal: Scientific Reports
Article Title: Genomic and functional analysis of the host response to acute simian varicella infection in the lung
doi: 10.1038/srep34164
Figure Lengend Snippet: CD3, CD20, CD68, granzyme B and Ki67 staining in lung sections from ( a ) naïve, ( b ) 7 DPI and ( c ) 14 DPI at 20X and 40X magnification.
Article Snippet: Tissues were then stained with primary
Techniques: Staining