M0273 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs taq buffer
    PCR products of UBP4′: M-marker (bp) GeneRuler <t>DNA</t> Ladder Mix (Fermentas Life Sciences), lanes 1–8 UBP4′ gene (276 bp UBP4′ length and 26 bp for restriction enzymes sequence = 302 bp) PCR product: lanes 1, 2: PCR reaction with Biotools DNA polymerase and 23 cycles, lanes 3, 4: PCR reaction with Biotools DNA polymerase and 29 cycles, lanes 5, 6: PCR reaction with Biotools DNA polymerase and 29 cycles, and lanes 7, 8: PCR reaction with <t>Taq</t> DNA polymerase and 29 cycles.
    Taq Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 339 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq buffer/product/New England Biolabs
    Average 95 stars, based on 339 article reviews
    Price from $9.99 to $1999.99
    taq buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    92
    Millipore myosin
    PCR products of UBP4′: M-marker (bp) GeneRuler <t>DNA</t> Ladder Mix (Fermentas Life Sciences), lanes 1–8 UBP4′ gene (276 bp UBP4′ length and 26 bp for restriction enzymes sequence = 302 bp) PCR product: lanes 1, 2: PCR reaction with Biotools DNA polymerase and 23 cycles, lanes 3, 4: PCR reaction with Biotools DNA polymerase and 29 cycles, lanes 5, 6: PCR reaction with Biotools DNA polymerase and 29 cycles, and lanes 7, 8: PCR reaction with <t>Taq</t> DNA polymerase and 29 cycles.
    Myosin, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 258 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/myosin/product/Millipore
    Average 92 stars, based on 258 article reviews
    Price from $9.99 to $1999.99
    myosin - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    N/A
    Accession number MIMAT0027534 Mature sequence UCUGCCAUAGGAAGCUUGGAGUGG hsa miR 6817 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor structures miRNAs
      Buy from Supplier

    Image Search Results


    PCR products of UBP4′: M-marker (bp) GeneRuler DNA Ladder Mix (Fermentas Life Sciences), lanes 1–8 UBP4′ gene (276 bp UBP4′ length and 26 bp for restriction enzymes sequence = 302 bp) PCR product: lanes 1, 2: PCR reaction with Biotools DNA polymerase and 23 cycles, lanes 3, 4: PCR reaction with Biotools DNA polymerase and 29 cycles, lanes 5, 6: PCR reaction with Biotools DNA polymerase and 29 cycles, and lanes 7, 8: PCR reaction with Taq DNA polymerase and 29 cycles.

    Journal: BioMed Research International

    Article Title: DNASynth: A Computer Program for Assembly of Artificial Gene Parts in Decreasing Temperature

    doi: 10.1155/2015/413262

    Figure Lengend Snippet: PCR products of UBP4′: M-marker (bp) GeneRuler DNA Ladder Mix (Fermentas Life Sciences), lanes 1–8 UBP4′ gene (276 bp UBP4′ length and 26 bp for restriction enzymes sequence = 302 bp) PCR product: lanes 1, 2: PCR reaction with Biotools DNA polymerase and 23 cycles, lanes 3, 4: PCR reaction with Biotools DNA polymerase and 29 cycles, lanes 5, 6: PCR reaction with Biotools DNA polymerase and 29 cycles, and lanes 7, 8: PCR reaction with Taq DNA polymerase and 29 cycles.

    Article Snippet: S.A. or Taq DNA polymerase with standard Taq buffer, New England Biolabs, Inc.), and 1 μ L as a template for 23 and 29 cycles using Eppendorf 5330 thermocycler.

    Techniques: Polymerase Chain Reaction, Marker, Sequencing