M0208 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    New England Biolabs taq
    Principle of OLA-based SNP genotyping. (a) For each polymorphism, a set of three genotyping oligos are allowed to anneal to denatured PCR product (blue) in the presence of <t>Taq</t> <t>DNA</t> ligase. Ligation of up- and downstream oligos occurs only if there is a perfect match to template. Upstream oligos are color-coded gray (M13 forward amplification primer sequence), red/green (a pair of barcode sequences), and black (assay-specific sequence flanking the query SNP). The downstream oligo is 5'-phosphorylated, and color-coded gray (reverse complemented sequence of the M13 reverse amplification primer), and black (assay-specific flanking sequence). (b) Addition of common M13 primers (gray) allows amplification of all ligated products. (c) After arraying amplified OLA products, membranes are hybridized with probes complementary to the barcode sequences. Probes can be fluorescently labeled with infrared (IR) fluors and both alleles hybridized simultaneously, or radiolabeled and hybridized sequentially.
    Taq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1024 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq/product/New England Biolabs
    Average 96 stars, based on 1024 article reviews
    Price from $9.99 to $1999.99
    taq - by Bioz Stars, 2020-01
    96/100 stars
      Buy from Supplier

    N/A
    Use these accessories for the ARCTURUS Laser Capture Microdissection LCM instrument to ensure success in your microgenomics research ExtracSure Sample Extraction DeviceUse the ExtracSure Device in conjunction with the CapSure
      Buy from Supplier

    77
    Vector Laboratories fluorescein succinylated wheat germ agglutinin
    Representative cross-section of labeling from an unfixed subscapularis muscle labeled with antibodies to (A) fluorescein <t>succinylated</t> wheat germ agglutinin and (B) fast myosin. The overlay of wheat germ agglutinin (green) and fast myosin (red) labeling
    Fluorescein Succinylated Wheat Germ Agglutinin, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescein succinylated wheat germ agglutinin/product/Vector Laboratories
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    fluorescein succinylated wheat germ agglutinin - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    N/A
    Accession number MIMAT0032026 Mature sequence GCUCUGACGAGGUUGCACUACU hsa miR 301b 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor structures miRNAs
      Buy from Supplier

    Image Search Results


    Principle of OLA-based SNP genotyping. (a) For each polymorphism, a set of three genotyping oligos are allowed to anneal to denatured PCR product (blue) in the presence of Taq DNA ligase. Ligation of up- and downstream oligos occurs only if there is a perfect match to template. Upstream oligos are color-coded gray (M13 forward amplification primer sequence), red/green (a pair of barcode sequences), and black (assay-specific sequence flanking the query SNP). The downstream oligo is 5'-phosphorylated, and color-coded gray (reverse complemented sequence of the M13 reverse amplification primer), and black (assay-specific flanking sequence). (b) Addition of common M13 primers (gray) allows amplification of all ligated products. (c) After arraying amplified OLA products, membranes are hybridized with probes complementary to the barcode sequences. Probes can be fluorescently labeled with infrared (IR) fluors and both alleles hybridized simultaneously, or radiolabeled and hybridized sequentially.

    Journal: Genome Biology

    Article Title: A low-cost open-source SNP genotyping platform for association mapping applications

    doi: 10.1186/gb-2005-6-12-r105

    Figure Lengend Snippet: Principle of OLA-based SNP genotyping. (a) For each polymorphism, a set of three genotyping oligos are allowed to anneal to denatured PCR product (blue) in the presence of Taq DNA ligase. Ligation of up- and downstream oligos occurs only if there is a perfect match to template. Upstream oligos are color-coded gray (M13 forward amplification primer sequence), red/green (a pair of barcode sequences), and black (assay-specific sequence flanking the query SNP). The downstream oligo is 5'-phosphorylated, and color-coded gray (reverse complemented sequence of the M13 reverse amplification primer), and black (assay-specific flanking sequence). (b) Addition of common M13 primers (gray) allows amplification of all ligated products. (c) After arraying amplified OLA products, membranes are hybridized with probes complementary to the barcode sequences. Probes can be fluorescently labeled with infrared (IR) fluors and both alleles hybridized simultaneously, or radiolabeled and hybridized sequentially.

    Article Snippet: OLA and OLA amplification reaction conditions The OLA reactions are just 3 μl in volume, and contain 1 × OLA buffer (50 mM Tris-HCl pH 8.5, 50 mM KCl, 7.5 mM MgCl2 , 1 mM NAD), 2.5 mM dithiothreitol, 1.6 units Taq (Thermus aquaticus ) DNA ligase (NEB), and 0.03 pmol of each genotyping oligo.

    Techniques: Polymerase Chain Reaction, Ligation, Amplification, Sequencing, Labeling

    Representative cross-section of labeling from an unfixed subscapularis muscle labeled with antibodies to (A) fluorescein succinylated wheat germ agglutinin and (B) fast myosin. The overlay of wheat germ agglutinin (green) and fast myosin (red) labeling

    Journal: The Journal of orthopaedic and sports physical therapy

    Article Title: Fiber Type Composition of Cadaveric Human Rotator Cuff Muscles

    doi: 10.2519/jospt.2008.2878

    Figure Lengend Snippet: Representative cross-section of labeling from an unfixed subscapularis muscle labeled with antibodies to (A) fluorescein succinylated wheat germ agglutinin and (B) fast myosin. The overlay of wheat germ agglutinin (green) and fast myosin (red) labeling

    Article Snippet: Unfixed tissue samples were double-labeled with primary and secondary antibodies to myosin as described, as well as fluorescein succinylated wheat germ agglutinin (M0208; Vector Laboratories, Burlingame, CA).

    Techniques: Labeling