Journal: Circulation. Cardiovascular genetics

Article Title: Relationship Between The Temporal Profile of Plasma microRNA and Left Ventricular Remodeling In Patients Following Myocardial Infarction

doi: 10.1161/CIRCGENETICS.111.959841

Figure Lengend Snippet: Applied Biosystems miRNA primers

Article Snippet: In initial assays performed in triplicate using referent control samples, the coefficient of variation for individual miR values was less than 10% ( ). table ft1 table-wrap mode="anchored" t5 caption a7 miRNA Catalog Number Target Sequence miR-1 2222 UGGAAUGUAAAGAAGUAUGUAU miR-21 0397 UAGCUUAUCAGACUGAUGUUGA miR-29a 2112 UAGCACCAUCUGAAAUCGGUUA miR-125b-3p 2378 ACGGGUUAGGCUCUUGGGAGCU miR-133a 2246 UUUGGUCCCCUUCAACCAGCUG miR-208a 0511 AUAAGACGAGCAAAAAGCUUGU U6 snRNA 1973 GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUUACUGCCCUCCAUGCCCUGCCCCACAAACGCUCUGAUAACAGUCUGUCCCUGUCUCUCUCCUGCUGCUCCUAUGGAAGCGAAGUUUUCCGCUCCUGCAGAAAGCAAAGUUACGACUCAGAGACGGCUGAGGAUGACAUCAGCGAUGUGC Open in a separate window Applied Biosystems miRNA primers table ft1 table-wrap mode="anchored" t5 caption a7 miRNA Ct Values (Mean±SEM) Coefficient of Variation (%) miR-1 28.55±0.69 8.40% miR-21 20.29±0.75 12.80% miR-29a 23.03±0.77 11.83% miR-133a 27.54±0.94 11.83% miR-208a 37.75±1.44 10.76% U6 snRNA 27.46±1.06 13.43% Open in a separate window Ct Values and Coefficient of Variation for Twelve Referent Controls Six miRs and one endogenous control were chosen for this study.

Techniques: Sequencing

Journal: Circulation. Cardiovascular genetics

Article Title: Relationship Between The Temporal Profile of Plasma microRNA and Left Ventricular Remodeling In Patients Following Myocardial Infarction

doi: 10.1161/CIRCGENETICS.111.959841

Figure Lengend Snippet: Ct Values and Coefficient of Variation for Twelve Referent Controls

Article Snippet: In initial assays performed in triplicate using referent control samples, the coefficient of variation for individual miR values was less than 10% ( ). table ft1 table-wrap mode="anchored" t5 caption a7 miRNA Catalog Number Target Sequence miR-1 2222 UGGAAUGUAAAGAAGUAUGUAU miR-21 0397 UAGCUUAUCAGACUGAUGUUGA miR-29a 2112 UAGCACCAUCUGAAAUCGGUUA miR-125b-3p 2378 ACGGGUUAGGCUCUUGGGAGCU miR-133a 2246 UUUGGUCCCCUUCAACCAGCUG miR-208a 0511 AUAAGACGAGCAAAAAGCUUGU U6 snRNA 1973 GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUUACUGCCCUCCAUGCCCUGCCCCACAAACGCUCUGAUAACAGUCUGUCCCUGUCUCUCUCCUGCUGCUCCUAUGGAAGCGAAGUUUUCCGCUCCUGCAGAAAGCAAAGUUACGACUCAGAGACGGCUGAGGAUGACAUCAGCGAUGUGC Open in a separate window Applied Biosystems miRNA primers table ft1 table-wrap mode="anchored" t5 caption a7 miRNA Ct Values (Mean±SEM) Coefficient of Variation (%) miR-1 28.55±0.69 8.40% miR-21 20.29±0.75 12.80% miR-29a 23.03±0.77 11.83% miR-133a 27.54±0.94 11.83% miR-208a 37.75±1.44 10.76% U6 snRNA 27.46±1.06 13.43% Open in a separate window Ct Values and Coefficient of Variation for Twelve Referent Controls Six miRs and one endogenous control were chosen for this study.

Techniques:

Journal: Circulation. Cardiovascular genetics

Article Title: Relationship Between The Temporal Profile of Plasma microRNA and Left Ventricular Remodeling In Patients Following Myocardial Infarction

doi: 10.1161/CIRCGENETICS.111.959841

Figure Lengend Snippet: Panel A-Serial changes in miR-29 in the patients following a myocardial infarction (MI). Data for post-MI patients are presented as a fold change from referent controls (CTL) set at 1. Data are mean ± SEM, * = P < 0.05 vs. CTL; # = P < 0.05 vs. day 2. Panel B-Relationship between early changes in miR-29a values at day 5 post-MI versus late changes in left ventricular (LV) end diastolic volume 90 days post-MI. The larger the early increase in miR-29a at 5 days, the larger the late increase LV end diastolic volume following an MI. y = − 5.5 + 0.07x, r = 0.77

Article Snippet: In initial assays performed in triplicate using referent control samples, the coefficient of variation for individual miR values was less than 10% ( ). table ft1 table-wrap mode="anchored" t5 caption a7 miRNA Catalog Number Target Sequence miR-1 2222 UGGAAUGUAAAGAAGUAUGUAU miR-21 0397 UAGCUUAUCAGACUGAUGUUGA miR-29a 2112 UAGCACCAUCUGAAAUCGGUUA miR-125b-3p 2378 ACGGGUUAGGCUCUUGGGAGCU miR-133a 2246 UUUGGUCCCCUUCAACCAGCUG miR-208a 0511 AUAAGACGAGCAAAAAGCUUGU U6 snRNA 1973 GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUUACUGCCCUCCAUGCCCUGCCCCACAAACGCUCUGAUAACAGUCUGUCCCUGUCUCUCUCCUGCUGCUCCUAUGGAAGCGAAGUUUUCCGCUCCUGCAGAAAGCAAAGUUACGACUCAGAGACGGCUGAGGAUGACAUCAGCGAUGUGC Open in a separate window Applied Biosystems miRNA primers table ft1 table-wrap mode="anchored" t5 caption a7 miRNA Ct Values (Mean±SEM) Coefficient of Variation (%) miR-1 28.55±0.69 8.40% miR-21 20.29±0.75 12.80% miR-29a 23.03±0.77 11.83% miR-133a 27.54±0.94 11.83% miR-208a 37.75±1.44 10.76% U6 snRNA 27.46±1.06 13.43% Open in a separate window Ct Values and Coefficient of Variation for Twelve Referent Controls Six miRs and one endogenous control were chosen for this study.

Techniques:

Journal: International Journal of Biological Sciences

Article Title: ISG15 Promotes Progression and Gemcitabine Resistance of Pancreatic Cancer Cells Through ATG7

doi: 10.7150/ijbs.85424

Figure Lengend Snippet: ISG15 is highly expressed in pancreatic cancer (PC) tissues. A, Bioinformatics analysis of ISG15 in PC tumor and non-tumor tissues using data from GSE16515 and GSE62452 with numbers enrolled (n) indicated on the bottom. B, Box-plot of the expression of ISG15 in PC tissues of different differentiation grades. C, Log-rank analysis of the correlation between ISG15 expression and survival of 63 PC patients using data from GSE57495. D, Representative images of ISG15 IHC staining in tumor and non-tumor tissues from PC microarray HPan-Ade170Sur-01 (scale bar; 50 μm) with zoomed-in pictures shown on the bottom (scale bar; 200 μm). E, Box-plot of the expression of ISG15 in tumor and adjacent non-tumor tissue sections from PC microarray. Method of H-score evaluation was described in Methods and Materials. (* p <0.05; ** p <0.01; *** p <0.001).

Article Snippet: The tissue sections were stained with antibody against ISG15 (1:50, A1182, ABclonal) and ATG7 (1:500, GB11399-1, Servicebio).

Techniques: Expressing, Immunohistochemistry, Microarray

Journal: International Journal of Biological Sciences

Article Title: ISG15 Promotes Progression and Gemcitabine Resistance of Pancreatic Cancer Cells Through ATG7

doi: 10.7150/ijbs.85424

Figure Lengend Snippet: ISG15 promotes malignant biological behaviors of PC cells. A, Proliferation of PC cells with or without ISG15 depletion as determined by CCK-8 assay. B, Representative images of colony formation assays. C, Effects of ISG15 knockdown on cell migration capacity as valued by wound healing assay. Representative images are shown (scale bar; 100 μm). D-E, Representative images of chamber migration (D) and invasion assays (E) designated for evaluation of cell migration and invasion capacity, respectively (scale bar; 100 μm). F-G, Effects of ISG15 depletion on spheroid formation. Representative images are shown (F) with statistic results (G) (scale bar; 50 μm). (*** p <0.001).

Article Snippet: The tissue sections were stained with antibody against ISG15 (1:50, A1182, ABclonal) and ATG7 (1:500, GB11399-1, Servicebio).

Techniques: CCK-8 Assay, Knockdown, Migration, Wound Healing Assay

Journal: International Journal of Biological Sciences

Article Title: ISG15 Promotes Progression and Gemcitabine Resistance of Pancreatic Cancer Cells Through ATG7

doi: 10.7150/ijbs.85424

Figure Lengend Snippet: ISG15 expression correlates with resistance to Gemcitabine. A, ISG15 expression was elevated after Gemcitabine (Gemci) treatment. PC cells were treated with DMSO and Gemcitabine. After different times of treatment, cells were collected and lysed for Western blotting analysis. Grey value of ISG15 was detected and normalized by ACTIN. Relative expression level of ISG15 was calculated as normalized grey value of certain time point / normalized grey value of ISG15 at time 0. Representative results of Western blotting are shown on the left, and quantitative results of at least three independent results are on the right. B-C, Down-regulation of ISG15 increased PC cell sensitivity to Gemcitabine. B, In colony formation assays, 24h after cells were plated, Gemcitabine was added for additional 24-hour incubation and then removed for colony formation. Representative results of colony formation assays are shown on the left with quantitative results of at least three independent results shown on the right. For the concentration of Gemcitabine used in the assay of colony formation, we conducted preliminary experiments using PANC-1 and PACA-2 cells (data not shown), and chose 10nM Gemcitabine to treat PANC-1 cells, and 1nM Gemcitabine to treat PACA-2 cells. C, Survival fraction in different concentration of Gemcitabine was calculated using CCK-8 assay. 24h after cells were plated, different concentrations of Gemcitabine was added. 48h later, CCK-8 detection was performed. Survival fraction (SF) is calculated following the formula: SF= (absorbance at certain concentration) / (absorbance at control) while DMSO was used as control. Representative results of at least three independent experiments are shown. D, Knock-down of ISG15 increased PC cell apoptosis after Gemcitabine treatment. Representative results of flow cytometry analysis are shown on the left with quantitative results shown on the right. E, ISG15 down-regulation enhanced the inhibition of spheroid formation by Gemcitabine. Representative results of spheroid formation are shown on the top panel with quantitative result shown on the bottom (scale bar; 50 μm). (* p <0.05; ** p <0.01; *** p <0.001).

Article Snippet: The tissue sections were stained with antibody against ISG15 (1:50, A1182, ABclonal) and ATG7 (1:500, GB11399-1, Servicebio).

Techniques: Expressing, Western Blot, Incubation, Concentration Assay, CCK-8 Assay, Control, Knockdown, Flow Cytometry, Inhibition

Journal: International Journal of Biological Sciences

Article Title: ISG15 Promotes Progression and Gemcitabine Resistance of Pancreatic Cancer Cells Through ATG7

doi: 10.7150/ijbs.85424

Figure Lengend Snippet: ISG15 promotes tumor progression and Gemcitabine resistance in vivo. A, Tumor size derived from ISG15-depleted or control PANC-1 cells with or without Gemcitabine treatment were measured in Balb/c nude mice. B-C, Tumor size (B) and weight (C) were measured after tumor excision at day 42. D, IHC staining of ISG15 and Ki67 and the results of TUNEL assays are shown (scale bar =50 μm). E-F, Statistic results of tumor weight (E) and the percentage of TUNEL-positive (apoptotic) cells (F) in PANC-1 derived tumors with different treatments. (* p <0.05; ** p <0.01; *** p <0.001).

Article Snippet: The tissue sections were stained with antibody against ISG15 (1:50, A1182, ABclonal) and ATG7 (1:500, GB11399-1, Servicebio).

Techniques: In Vivo, Derivative Assay, Control, Immunohistochemistry, TUNEL Assay

Journal: International Journal of Biological Sciences

Article Title: ISG15 Promotes Progression and Gemcitabine Resistance of Pancreatic Cancer Cells Through ATG7

doi: 10.7150/ijbs.85424

Figure Lengend Snippet: LC3 conversion was blocked due to destabilization of ATG7 by ISG15 knockdown in PC cells. A, Confocal microscopic images of GFP-mCherry-LC3-labeled autophagosomes in ISG15-depleted or control PANC-1cells. Images were captured under 1,600× magnification (scale bar: 100μm). B, Inhibition of LC3 II degradation in lysosomes by chloroquine (CQ) rescued the decreased LC3 II/I ratio as revealed by Western blotting. C, Under the condition of ISG15 knockdown, the expression of LC3-conversion-related molecules (ATG3, ATG5, ATG7 and ATG12) was analyzed with Western blotting. D, In Western blotting experiments, the intensity of ATG7 was measured and normalized with ACTIN, and the expression levels relative to that of 0 h are shown. Plots of relative expression level of ATG7 in ISG15-depleted or control cells after Cycloheximide (CHX) treatment are shown. E, Control or ISG15-depleted cells were treated with MG132 or E64D/ Pepstatin A (E+P). The grey value of the bands was measured and normalized with the corresponding actin band. Relative expression levels normalized to the intensity of control (NC). F, FLAG-tagged ISG15 and HA-tagged ATG7 were overexpressed separately or simultaneously in 293T cells. Co-immunoprecipitation was performed as described in Methods and materials. Representative images are shown. (** p <0.01; *** p <0.001).

Article Snippet: The tissue sections were stained with antibody against ISG15 (1:50, A1182, ABclonal) and ATG7 (1:500, GB11399-1, Servicebio).

Techniques: Knockdown, Labeling, Control, Inhibition, Western Blot, Expressing, Immunoprecipitation

Journal: International Journal of Biological Sciences

Article Title: ISG15 Promotes Progression and Gemcitabine Resistance of Pancreatic Cancer Cells Through ATG7

doi: 10.7150/ijbs.85424

Figure Lengend Snippet: The autophagy regulated by ISG15 affects the Gemcitabine sensitivity of PC. A, LC3 II/I ratio was calculated in PC cells treated with DMSO (as a control), Gemcitabine (Gemci) and Rapamycin (Rapa), (as positive inducers of autophagy). LC3 I to II conversion ratio was calculated following the formula: LC3 II/I= (grey value of LC3 II band) / (grey value of LC3 I band), and representative results are shown with the conversion ratio marked. B-D, Effects of overexpression of ISG15 or ATG7 in ISG15-silenced PC cells. Effects on LC3 conversion were analyzed with Western blotting. LC3 conversion ratio was calculated as described in the preceding part and noted in the image (B). Apoptosis induced by Gemcitabine was detected with flow cytometry, and the statistical results are shown on the right, with representative pictures shown on the left (C, D). (** p <0.01; *** p <0.001).

Article Snippet: The tissue sections were stained with antibody against ISG15 (1:50, A1182, ABclonal) and ATG7 (1:500, GB11399-1, Servicebio).

Techniques: Control, Over Expression, Western Blot, Flow Cytometry

Journal: International Journal of Biological Sciences

Article Title: ISG15 Promotes Progression and Gemcitabine Resistance of Pancreatic Cancer Cells Through ATG7

doi: 10.7150/ijbs.85424

Figure Lengend Snippet: ISG15 regulates autophagy by modulating ATG7 degradation: the model. When the expression of ISG15 is low or deficient, ATG7 is degraded by lysosome-mediated pathway, and the transformation from LC3-I to LC3-II is inhibited, with the autophagy level reduced (Left panel). In the cells with normal or high ISG15 expression, ISG15 can inhibit ATG7 degradation and promotes the transformation from LC3-I to LC3-II, resulting in autophagy (Right panel).

Article Snippet: The tissue sections were stained with antibody against ISG15 (1:50, A1182, ABclonal) and ATG7 (1:500, GB11399-1, Servicebio).

Techniques: Expressing, Transformation Assay