93
|
Chondrex Inc
mouse monoclonal ige against ovalbumin ova Mouse Monoclonal Ige Against Ovalbumin Ova, supplied by Chondrex Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7091/Mouse+Anti-Ovalbumin+IgE+Monoclonal+Antibody/pmc04885219-139-0-9 Average 93 stars, based on 1 article reviews
mouse monoclonal ige against ovalbumin ova - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
93
|
AMS Biotechnology
mouse anti-ovalbumin ige monoclonal antibody, clone e-c1 Mouse Anti Ovalbumin Ige Monoclonal Antibody, Clone E C1, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7091/Mouse+Anti-Ovalbumin+IgE+Monoclonal+Antibody%2C+Clone+E-C1/custom%407091%4037696941 Average 93 stars, based on 1 article reviews
mouse anti-ovalbumin ige monoclonal antibody, clone e-c1 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
93
|
GE Healthcare
track etched membrane Track Etched Membrane, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7091/Cyclopore+Polycarbonate+Thin+Clear+Membrane%2C+pore+size%2C+circle/bio_rxiv__400721-174-6-17 Average 93 stars, based on 1 article reviews
track etched membrane - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
94
|
Tocris
miro1 reducer Miro1 Reducer, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7091/Miro1+Reducer/pmc09574377-124-5-9 Average 94 stars, based on 1 article reviews
miro1 reducer - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
93
|
Novus Biologicals
mouse anti hs igm antibody Mouse Anti Hs Igm Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7091/IgM+Antibody+(2B9cc)/pmc12496195-295-9-23 Average 93 stars, based on 1 article reviews
mouse anti hs igm antibody - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
93
|
Tocris
respiratory chain complex Respiratory Chain Complex, supplied by Tocris, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7091/Miro1+Reducer/pmc11842757-443-14-21 Average 93 stars, based on 1 article reviews
respiratory chain complex - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
90
|
Clevite Corporation
dpr 7091 ai alloy strip Dpr 7091 Ai Alloy Strip, supplied by Clevite Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7091/dpr+7091+ai+alloy+strip/10__1007_slash_bf02833668-4932-3-31 Average 90 stars, based on 1 article reviews
dpr 7091 ai alloy strip - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Metcut Research Inc
aluminum alloy 7091 Aluminum Alloy 7091, supplied by Metcut Research Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7091/aluminum+alloy+7091/10__1007_slash_bf03338169-5208-5-13 Average 90 stars, based on 1 article reviews
aluminum alloy 7091 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
86
|
Grammarly Inc
chrome 136 0 7091 2 grammarly language editing Chrome 136 0 7091 2 Grammarly Language Editing, supplied by Grammarly Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7091/0+136+2+7091+chrome+editing+grammarly+language/10__3390_slash_tropicalmed10110310-69-5-7 Average 86 stars, based on 1 article reviews
chrome 136 0 7091 2 grammarly language editing - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
N/A
|
Hairpin precursor miRNA of approximately 150 nucleotides is cloned into lentiviral or non-viral vectors for delivery in virtually all cell types.
|
Buy from Supplier |
N/A
|
MicroRNA: mmu-miR-7091-3p Accession Number: MIMAT0028089 Mature Sequence: AGUGGCUUCUGUCGUCUCUAG mmu-miR-7091-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
N/A
|
MicroRNA: mmu-miR-7091-5p Accession Number: MIMAT0028088 Mature Sequence: GUAGGGGUGAUAGAUUCCAUGGC mmu-miR-7091-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |