|
ATCC
atcc 10555 Atcc 10555, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7078/pmc12876083-37-6-6?v=ATCC Average 93 stars, based on 1 article reviews
atcc 10555 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Hairpin precursor miRNA of approximately 150 nucleotides is cloned into lentiviral or non-viral vectors for delivery in virtually all cell types.
|
Buy from Supplier |
|
DSMZ
m voltae ![]() M Voltae, supplied by DSMZ, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7078/pm30451902-307-44-57?v=DSMZ Average 91 stars, based on 1 article reviews
m voltae - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Chondrex Inc
monoclonal rat anti col4a5 ![]() Monoclonal Rat Anti Col4a5, supplied by Chondrex Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7078/bio_rxiv__2025__04__28__650774-269-28-33?v=Chondrex+Inc Average 94 stars, based on 1 article reviews
monoclonal rat anti col4a5 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Vector Biolabs
104 genome copies gc raav gfp ![]() 104 Genome Copies Gc Raav Gfp, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7078/pm34648695-50-43-51?v=Vector+Biolabs Average 95 stars, based on 1 article reviews
104 genome copies gc raav gfp - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Tektronix inc
low noise triax cable ![]() Low Noise Triax Cable, supplied by Tektronix inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7078/pmc06889394-198-20-23?v=Tektronix+inc Average 90 stars, based on 1 article reviews
low noise triax cable - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Corning Life Sciences
lc column corning 7078-5 n serological disposable glass pipette ![]() Lc Column Corning 7078 5 N Serological Disposable Glass Pipette, supplied by Corning Life Sciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7078/pm36368113-109-14-16?v=Corning+Life+Sciences Average 90 stars, based on 1 article reviews
lc column corning 7078-5 n serological disposable glass pipette - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
ProMIS Neurosciences
7078 exomes ![]() 7078 Exomes, supplied by ProMIS Neurosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7078/pm40533538-93-4-4?v=ProMIS+Neurosciences Average 90 stars, based on 1 article reviews
7078 exomes - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
AMS Biotechnology
anti-human alpha 5 (iv) antibody, clone h53 ![]() Anti Human Alpha 5 (Iv) Antibody, Clone H53, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7078/custom%407078%4010%2E1101%2F2023%2E08%2E29%2E555364?v=AMS+Biotechnology Average 94 stars, based on 1 article reviews
anti-human alpha 5 (iv) antibody, clone h53 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
VESTOLIT GmbH
hostalit p 7078 ![]() Hostalit P 7078, supplied by VESTOLIT GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7078/10__1002_slash_apmc__1975__050420103-113-0-9?v=VESTOLIT+GmbH Average 90 stars, based on 1 article reviews
hostalit p 7078 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
MicroRNA: mmu-miR-7078-3p Accession Number: MIMAT0028063 Mature Sequence: UACUUUUUUUAUCAUCCACAG mmu-miR-7078-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
|
MicroRNA: mmu-miR-7078-5p Accession Number: MIMAT0028062 Mature Sequence: UGUGGGUGGUAGGAGACGCU mmu-miR-7078-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
Image Search Results
Journal: Nature communications
Article Title: Hydrogen production by Sulfurospirillum species enables syntrophic interactions of Epsilonproteobacteria.
doi: 10.1038/s41467-018-07342-3
Figure Lengend Snippet: Fig. 6 Syntrophic coculture of S. multivorans and Methanococcus voltae. a Scheme of syntrophic interactions and exchange of metabolites and b lactate concentration in S. multivorans pure culture and coculture of S. multivorans and M. voltae. c Electron microscopic images of aggregates, Magnifications, ×150 (whole aggregate, upper row left, scale bar 200 µm), ×5000 (upper right, scale bar 3 µm), ×10,000 (lower images, scale bar 2 µm). Sections of the lower images were obtained from different areas of the aggregate. White arrows indicate EPS-like structures. Cultivation experiments included three biological replicates in which similar aggregates were formed. S.m. S. multivorans. Pure S. multivorans and the coculture were cultivated in a medium originally optimized for M. voltae modified as described in the Methods section
Article Snippet: All Sulfurospirillum spp. (S. multivorans—DSM 12446, S. cavolei type strain Phe 91 (NBRC 109482)—DSM 18149, S. halorespirans—DSM 13726, S. barnesii—DSM 10660, S. deleyianum—DSM 6946, S. arsenophilum DSM 10659), C. pasteurianum (DSM 525), D. hafniense DCB-2 (DSM 10664), and E. coli JM109 (DSM 3423) and
Techniques: Concentration Assay
Journal: bioRxiv
Article Title: Basement Membrane Structural Integrity Dictates Trans-Tissue Deposition of Laminin in Mammals
doi: 10.1101/2025.04.28.650774
Figure Lengend Snippet: Immunofluorescence was used to localize LAMA2 (green) and Nidogen (red) in kidney sections. (A, D) Laminin α2 was deposited in the defective GBMs (arrows) of Col4a5 mutant and Lamb2 mutant mouse models of Alport and Pierson syndromes, respectively. (E, F) LAMA2 localization was restricted to the mesangial matrix in the Cd2ap mutant, despite mesangial matrix expansion. (G, H) LAMA2 was localized to the mesangial matrix in the Adriamycin-treated mouse, a pattern similar to control. (I-K) Airyscan imaging showed the ectopic LAMA2 (green) deposited on top of the COL4A1/2 (red) layer, overlapping with the split GBM labeled by nidogen, which marks the podocyte side of the GBM.
Article Snippet: The primary antibodies used in this study were as follows: polyclonal rabbit anti-Laminin-α2 LG (previously described , 1:200 dilution), monoclonal rat anti-Nidogen-1 (clone ELM1, Sigma-Aldrich #MAB1946-I, 1:100 dilution),
Techniques: Immunofluorescence, Mutagenesis, Control, Imaging, Labeling
Journal: bioRxiv
Article Title: Basement Membrane Structural Integrity Dictates Trans-Tissue Deposition of Laminin in Mammals
doi: 10.1101/2025.04.28.650774
Figure Lengend Snippet: (A, B) Immunostaining of LAMA2 and nidogen. Pax3Cre; CAG-LSL-Cas9; Tg: Lama2 gRNA mice showed strongly reduced LAMA2 in the interstitium, but only modest reduction in the mesangial matrix. This suggests that some of the mesangium’s LAMA2 is derived from external tissues. (C-G) Ubiquitous Cas9; Tg: Lama2 gRNA mice showed no LAMA2 in COL4A5-negative GBM segments in female Col4a5 +/- mice (arrows vs arrowheads). However, Pax3-Cre- (include podocytes, mesangial cells and interstitial fibroblasts) and Podocin-Cre- (podocytes) dependent Cas9; Tg: Lama2 gRNA mice showed little reduction in ectopic LAMA2 GBM deposition (arrows). This suggests that the ectopic LAMA2 is derived from external tissues. (H-J) HopxCre-tdTomato reporter mice showed that there were no mesangial cell processes in the LAMA2-positive GBM segments in Alport mice (arrows). (K, L) Immunostaining for ITGA8 along with anti-Synpo (podocytes), anti-laminin (GBM), and tdTomato expression (mesangial cells) demonstrated that ITGA8 is present on Alport but not WT podocytes. As in H-J, no mesangial cell processes (red) were observed in WT or Alport peripheral capillary loop GBMs.
Article Snippet: The primary antibodies used in this study were as follows: polyclonal rabbit anti-Laminin-α2 LG (previously described , 1:200 dilution), monoclonal rat anti-Nidogen-1 (clone ELM1, Sigma-Aldrich #MAB1946-I, 1:100 dilution),
Techniques: Immunostaining, Derivative Assay, Expressing
Journal: bioRxiv
Article Title: Basement Membrane Structural Integrity Dictates Trans-Tissue Deposition of Laminin in Mammals
doi: 10.1101/2025.04.28.650774
Figure Lengend Snippet: (A-D) Localization of i.v. administered recombinant LM-211 in the kidneys of LAMA2-deficient Col4a5 WT and mutant mice. Circulating LM-211 protein was deposited in the mesangial matrix and in Alport GBM (arrows). (E, F) Higher magnification images show that injected recombinant LM-211 was deposited in the structurally defective GBM in Alport glomeruli (arrows), mimicking the ectopic LAMA2 deposition observed in Alport mice. (G, H) Localization of i.v. administered recombinant hLM-211 in the kidney of LAMA2-deficient Col4a5 +/- mice. LM-211 was specifically deposited in GBM segments lacking COL4A5 (arrows).
Article Snippet: The primary antibodies used in this study were as follows: polyclonal rabbit anti-Laminin-α2 LG (previously described , 1:200 dilution), monoclonal rat anti-Nidogen-1 (clone ELM1, Sigma-Aldrich #MAB1946-I, 1:100 dilution),
Techniques: Recombinant, Mutagenesis, Injection