91
|
ATCC
bacillus maceram Bacillus Maceram, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7069/Paenibacillus+macerans+(Schardinger)+Ash+et+al/10__1016_slash_s0008___6215_ascii40_00_ascii41_80256___6-80-3-5 Average 91 stars, based on 1 article reviews
bacillus maceram - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
N/A
|
Hairpin precursor miRNA of approximately 150 nucleotides is cloned into lentiviral or non-viral vectors for delivery in virtually all cell types.
|
Buy from Supplier |
93
|
Cell Signaling Technology Inc
pathscan total insulin receptor β sandwich elisa kit Pathscan Total Insulin Receptor β Sandwich Elisa Kit, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7069/PathScan+Total+Insulin+Receptor+beta+Sandwich+ELISA+Kit/pmc09727033-478-0-8 Average 93 stars, based on 1 article reviews
pathscan total insulin receptor β sandwich elisa kit - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
92
|
JASCO Inc
htcd autosampler Htcd Autosampler, supplied by JASCO Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7069/HTCD/pm39702851-29-6-8 Average 92 stars, based on 1 article reviews
htcd autosampler - by Bioz Stars,
2026-10
92/100 stars
|
Buy from Supplier |
90
|
Rohm GmbH
rohamenttm 7069 w Rohamenttm 7069 W, supplied by Rohm GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7069/rohament++7069+w/us09518253-861-0-3 Average 90 stars, based on 1 article reviews
rohamenttm 7069 w - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
AB Enzymes
rohament® 7069 w Rohament® 7069 W, supplied by AB Enzymes, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7069/rohament++7069+w/us11591550-199-136-139 Average 90 stars, based on 1 article reviews
rohament® 7069 w - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
N/A
|
MicroRNA: mmu-miR-7069-3p Accession Number: MIMAT0028045 Mature Sequence: CCUGCCCUGCCAACCCCUACA mmu-miR-7069-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
N/A
|
MicroRNA: mmu-miR-7069-5p Accession Number: MIMAT0028044 Mature Sequence: UUGGGGGCCUGGGAGGGUGACAC mmu-miR-7069-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |