90
|
ATCC
7063 bacillus sphaericus 7063 Bacillus Sphaericus, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7063/Lysinibacillus+sphaericus/us07582455-1412-24-23 Average 90 stars, based on 1 article reviews
7063 bacillus sphaericus - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
91
|
LGC Standards
7063 7063, supplied by LGC Standards, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7063/7063/custom%407063%4010%2E3920%2Fwmj2015%2E2005 Average 91 stars, based on 1 article reviews
7063 - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
93
|
Cell Signaling Technology Inc
p p70s6 kinase thr389 P P70s6 Kinase Thr389, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7063/PathScan+Phospho-p70+S6+Kinase+(Thr389)+Sandwich+ELISA+Kit/pmc04163620-89-27-41 Average 93 stars, based on 1 article reviews
p p70s6 kinase thr389 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
91
|
ATCC
atcc 7063 Atcc 7063, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7063/Lysinibacillus+sphaericus/us07582455-1454-7-7 Average 91 stars, based on 1 article reviews
atcc 7063 - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
90
|
Bayer AG
bayhydur™ xp-7063 polyisocyanate (100% active ingredient, 17.1% [nco], 245 g/equivalent [nco]) Bayhydur™ Xp 7063 Polyisocyanate (100% Active Ingredient, 17.1% [Nco], 245 G/Equivalent [Nco]), supplied by Bayer AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7063/bayhydur++xp+7063+polyisocyanate++100++active+ingredient++17+1+++nco+++245+g+equivalent++nco++/us07452952-7-18-21 Average 90 stars, based on 1 article reviews
bayhydur™ xp-7063 polyisocyanate (100% active ingredient, 17.1% [nco], 245 g/equivalent [nco]) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Kistler Instrumente GmbH
piezoelectric transducer 7063-a Piezoelectric Transducer 7063 A, supplied by Kistler Instrumente GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7063/piezoelectric+transducer+model++7063+a+make++kistler/10__1016_slash_j__fuel__2016__08__046-124-16-34 Average 90 stars, based on 1 article reviews
piezoelectric transducer 7063-a - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Endo Optiks Inc
booth 7063 Booth 7063, supplied by Endo Optiks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7063/booth+7063/10__1016_slash_s0194___5998_ascii40_97_ascii41_80498___6-290-0-2 Average 90 stars, based on 1 article reviews
booth 7063 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
CDN Isotopes
ethyl octanoate-d15 d-7063 Ethyl Octanoate D15 D 7063, supplied by CDN Isotopes, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7063/ethyl+octanoate+d15+d+7063/pm38843713-48-12-19 Average 90 stars, based on 1 article reviews
ethyl octanoate-d15 d-7063 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
86
|
Loctite
sf 7063 industrial cleaner Sf 7063 Industrial Cleaner, supplied by Loctite, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7063/7063+cleaner+industrial+sf/pmc12656205-183-9-8 Average 86 stars, based on 1 article reviews
sf 7063 industrial cleaner - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Loctite
degreaser loctite 7063 Degreaser Loctite 7063, supplied by Loctite, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/7063/7063+degreaser+loctite/10__1088_slash_1361___6501_slash_abaae8-138-21-22 Average 86 stars, based on 1 article reviews
degreaser loctite 7063 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
N/A
|
MicroRNA: mmu-miR-7063-3p Accession Number: MIMAT0028031 Mature Sequence: UGCUCUCUGCCCCUCUUAAG mmu-miR-7063-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |