60 °c Search Results

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    ATCC c pasteurianum
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    C Pasteurianum, supplied by ATCC, used in various techniques. Bioz Stars score: 88/100, based on 125 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c pasteurianum/product/ATCC
    Average 88 stars, based on 125 article reviews
    Price from $9.99 to $1999.99
    c pasteurianum - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    Thermo Fisher snp slc22a1 c 8709275 60
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    Snp Slc22a1 C 8709275 60, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp slc22a1 c 8709275 60/product/Thermo Fisher
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    snp slc22a1 c 8709275 60 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Thermo Fisher 18s 60°c classic
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    18s 60°C Classic, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/18s 60°c classic/product/Thermo Fisher
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    18s 60°c classic - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Thermo Fisher pre warmed 60°c trizol
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    Pre Warmed 60°C Trizol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pre warmed 60°c trizol/product/Thermo Fisher
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pre warmed 60°c trizol - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    Difco liquid 60 ° c water agar
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    Liquid 60 ° C Water Agar, supplied by Difco, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/liquid 60 ° c water agar/product/Difco
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    liquid 60 ° c water agar - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    Gentra Systems subzero 60 ° c freezer temperatures
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    Subzero 60 ° C Freezer Temperatures, supplied by Gentra Systems, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/subzero 60 ° c freezer temperatures/product/Gentra Systems
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    subzero 60 ° c freezer temperatures - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    RETSCH oven dried 60 ° c peat
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    Oven Dried 60 ° C Peat, supplied by RETSCH, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oven dried 60 ° c peat/product/RETSCH
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    oven dried 60 ° c peat - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Agilent technologies prewarmed 60°c dako glycergel mounting medium
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    Prewarmed 60°C Dako Glycergel Mounting Medium, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prewarmed 60°c dako glycergel mounting medium/product/Agilent technologies
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    prewarmed 60°c dako glycergel mounting medium - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    GE Healthcare heat inactivated 60°c fetal bovine serum
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    Heat Inactivated 60°C Fetal Bovine Serum, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/heat inactivated 60°c fetal bovine serum/product/GE Healthcare
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    heat inactivated 60°c fetal bovine serum - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Qiagen heated 60°c cell lysis solution
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    Heated 60°C Cell Lysis Solution, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/heated 60°c cell lysis solution/product/Qiagen
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    heated 60°c cell lysis solution - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Millipore pre warmed 60°c tween 80 solution
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    Pre Warmed 60°C Tween 80 Solution, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pre warmed 60°c tween 80 solution/product/Millipore
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pre warmed 60°c tween 80 solution - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    Bio-Rad heated 60°c aminex hpx 87h ion exclusion organic acid analysis column
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    Heated 60°C Aminex Hpx 87h Ion Exclusion Organic Acid Analysis Column, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/heated 60°c aminex hpx 87h ion exclusion organic acid analysis column/product/Bio-Rad
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    heated 60°c aminex hpx 87h ion exclusion organic acid analysis column - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Millipore c 60
    ( a ) Model for two binding states of a <t>C</t> 60 molecule. STM images of the C 60 molecule before, during and after the switching are presented in inserts. (b) Dependence of potential barrier separating two adjacent in energy C 60 molecule’s orientations on the applied bias voltage.
    C 60, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c 60/product/Millipore
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    c 60 - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    GL Sciences unibeads c 60 80
    ( a ) Model for two binding states of a <t>C</t> 60 molecule. STM images of the C 60 molecule before, during and after the switching are presented in inserts. (b) Dependence of potential barrier separating two adjacent in energy C 60 molecule’s orientations on the applied bias voltage.
    Unibeads C 60 80, supplied by GL Sciences, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/unibeads c 60 80/product/GL Sciences
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    unibeads c 60 80 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Thermo Fisher snp cyp2b6 c 7817765 60
    Nevirapine plasma concentrations following a 200 mg dose to A) African Americans and B) European Americans. The concentrations (mean ± SEM) are stratified by <t>CYP2B6</t> 516G > T genotype: circles GG, squares GT and triangles TT.
    Snp Cyp2b6 C 7817765 60, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 80 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp cyp2b6 c 7817765 60/product/Thermo Fisher
    Average 97 stars, based on 80 article reviews
    Price from $9.99 to $1999.99
    snp cyp2b6 c 7817765 60 - by Bioz Stars, 2020-08
    97/100 stars
      Buy from Supplier

    Thermo Fisher snp cyp2a6 c 27861808 60
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Snp Cyp2a6 C 27861808 60, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp cyp2a6 c 27861808 60/product/Thermo Fisher
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    snp cyp2a6 c 27861808 60 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Thermo Fisher snp ppard c 8851955 60
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Snp Ppard C 8851955 60, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp ppard c 8851955 60/product/Thermo Fisher
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    snp ppard c 8851955 60 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Nano C nano c 60 cytotoxicity
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Nano C 60 Cytotoxicity, supplied by Nano C, used in various techniques. Bioz Stars score: 85/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nano c 60 cytotoxicity/product/Nano C
    Average 85 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    nano c 60 cytotoxicity - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Nano C nano c 60 aquat
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Nano C 60 Aquat, supplied by Nano C, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nano c 60 aquat/product/Nano C
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nano c 60 aquat - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    Olympus olympus c 60 camera
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Olympus C 60 Camera, supplied by Olympus, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/olympus c 60 camera/product/Olympus
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    olympus c 60 camera - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Elekta model c leksell 60 co gamma knife
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Model C Leksell 60 Co Gamma Knife, supplied by Elekta, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/model c leksell 60 co gamma knife/product/Elekta
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    model c leksell 60 co gamma knife - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    Thermo Fisher snp ndufa6 as1 c 32407245 60
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Snp Ndufa6 As1 C 32407245 60, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp ndufa6 as1 c 32407245 60/product/Thermo Fisher
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    snp ndufa6 as1 c 32407245 60 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Olympus c 60 zoom digital camera
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    C 60 Zoom Digital Camera, supplied by Olympus, used in various techniques. Bioz Stars score: 91/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c 60 zoom digital camera/product/Olympus
    Average 91 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    c 60 zoom digital camera - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    Millipore emd c 18 silica gel 60
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Emd C 18 Silica Gel 60, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/emd c 18 silica gel 60/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    emd c 18 silica gel 60 - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Carl Zeiss kryostat hyrax c 60
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Kryostat Hyrax C 60, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kryostat hyrax c 60/product/Carl Zeiss
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    kryostat hyrax c 60 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results

    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. pasteurianum, and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).

    Journal: ISRN biotechnology

    Article Title: Fermentation and Hydrogen Metabolism Affect Uranium Reduction by Clostridia

    doi: 10.5402/2013/657160

    Figure Lengend Snippet: Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. pasteurianum, and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).

    Article Snippet: We purchased C. sphenoides (ATCC 19403), C. acetobutylicum (ATCC 824), and C. pasteurianum (ATCC 7040) from the American Type Culture Center (ATCC).


    ( a ) Model for two binding states of a C 60 molecule. STM images of the C 60 molecule before, during and after the switching are presented in inserts. (b) Dependence of potential barrier separating two adjacent in energy C 60 molecule’s orientations on the applied bias voltage.

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: ( a ) Model for two binding states of a C 60 molecule. STM images of the C 60 molecule before, during and after the switching are presented in inserts. (b) Dependence of potential barrier separating two adjacent in energy C 60 molecule’s orientations on the applied bias voltage.

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques: Binding Assay

    A tunneling microscope tip is located above a fluctuating C 60 molecule. Right panel: The time-evolution of the STM tip-surface distance for the switching C 60 molecule measured at a sample bias, V b = −1.1 V and tunneling current I t = 0.087 nA . The acquisition time was 10 ms per point. Five different states are present indicated by dashed lines. Left panel: Histogram of C 60 molecule residence in different states.

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: A tunneling microscope tip is located above a fluctuating C 60 molecule. Right panel: The time-evolution of the STM tip-surface distance for the switching C 60 molecule measured at a sample bias, V b = −1.1 V and tunneling current I t = 0.087 nA . The acquisition time was 10 ms per point. Five different states are present indicated by dashed lines. Left panel: Histogram of C 60 molecule residence in different states.

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques: Microscopy, Mass Spectrometry

    Constant-current STM images (14 × 14 nm 2 ) of the same area of the C 60 monolayer on the WO 2 /W(110) surface, I t = 0.1 nA (a) V b = 1.2 V ; (b) V b = −1.9 V .

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: Constant-current STM images (14 × 14 nm 2 ) of the same area of the C 60 monolayer on the WO 2 /W(110) surface, I t = 0.1 nA (a) V b = 1.2 V ; (b) V b = −1.9 V .

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .


    ( a ) Schematics of C 60 molecule bonded to WO 2 /W(110) surface by coordination (on the left) and van der Waals (on the right) forces. ( b ) Equivalent circuit of C 60 molecule coupled in STM tunnelling junction. ( c ) Schematics of image charge of negatively charged C 60 .

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: ( a ) Schematics of C 60 molecule bonded to WO 2 /W(110) surface by coordination (on the left) and van der Waals (on the right) forces. ( b ) Equivalent circuit of C 60 molecule coupled in STM tunnelling junction. ( c ) Schematics of image charge of negatively charged C 60 .

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .


    Kugel fountain as a model of rotating C 60 molecule. Image courtesy of M. Grassick.

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: Kugel fountain as a model of rotating C 60 molecule. Image courtesy of M. Grassick.

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .


    The time evolution of the STM current (a) and tip-surface distance (b) for the switching C 60 molecule between two lowest in energy orientations when the tunneling microscope tip is located above a fluctuating C 60 molecule. V b = −1.1 V .

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: The time evolution of the STM current (a) and tip-surface distance (b) for the switching C 60 molecule between two lowest in energy orientations when the tunneling microscope tip is located above a fluctuating C 60 molecule. V b = −1.1 V .

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques: Microscopy

    (a) 160 × 160 nm 2 STM image of nano-islands acquired after the deposition of 0.5 ML of C 60 molecules onto the WO 2 /W(110) surface. V b = 1.0 V , I t = 0.1 nA . (b) A line profile (along the line marked in (a) ) indicating the height of C 60 nano-island. (c) Dependence of C 60 nano-island height on the temperature. Abrupt increase of the height at temperature of rotation phase transition indicates break of C 60 coordination bonds.

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: (a) 160 × 160 nm 2 STM image of nano-islands acquired after the deposition of 0.5 ML of C 60 molecules onto the WO 2 /W(110) surface. V b = 1.0 V , I t = 0.1 nA . (b) A line profile (along the line marked in (a) ) indicating the height of C 60 nano-island. (c) Dependence of C 60 nano-island height on the temperature. Abrupt increase of the height at temperature of rotation phase transition indicates break of C 60 coordination bonds.

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques: Sublimation

    (a) 390 × 390 nm 2 Low-temperature STM images acquired after the deposition of 0.5 ML of C 60 molecules onto the WO 2 /W(110) surface. V b = 1 V , I t = 0.1 nA . (b) 13 × 10 nm 2 Image of C 60 at low temperature with the details of the sub-molecular structure. V b = 0.97 V , I t = 0.07 nA , T = 78 K . (c) 16 × 16 nm 2 STM image of the same C 60 film acquired at T = 315 K . All molecules in (c) appear as perfect spheres due their fast rotation. V b = −1.4 V , I t = 0.1 nA .

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: (a) 390 × 390 nm 2 Low-temperature STM images acquired after the deposition of 0.5 ML of C 60 molecules onto the WO 2 /W(110) surface. V b = 1 V , I t = 0.1 nA . (b) 13 × 10 nm 2 Image of C 60 at low temperature with the details of the sub-molecular structure. V b = 0.97 V , I t = 0.07 nA , T = 78 K . (c) 16 × 16 nm 2 STM image of the same C 60 film acquired at T = 315 K . All molecules in (c) appear as perfect spheres due their fast rotation. V b = −1.4 V , I t = 0.1 nA .

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .


    (a,b) Constant-current STM images (5.5 × 5.5 nm 2 ) of the same area of the C 60 monolayer on the WO 2 /W(110) surface, V b = 1.0 V , I t = 0.1 nA . The molecule at the center of these images switches between static and rotating states, changing its appearance. The molecule in (b) rotates faster than the time scale of the STM experiment. (c) A line profile (along the line marked in (b) ) indicating the height difference between the rotating and static C 60 molecules in the monolayer.

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: (a,b) Constant-current STM images (5.5 × 5.5 nm 2 ) of the same area of the C 60 monolayer on the WO 2 /W(110) surface, V b = 1.0 V , I t = 0.1 nA . The molecule at the center of these images switches between static and rotating states, changing its appearance. The molecule in (b) rotates faster than the time scale of the STM experiment. (c) A line profile (along the line marked in (b) ) indicating the height difference between the rotating and static C 60 molecules in the monolayer.

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .


    Nevirapine plasma concentrations following a 200 mg dose to A) African Americans and B) European Americans. The concentrations (mean ± SEM) are stratified by CYP2B6 516G > T genotype: circles GG, squares GT and triangles TT.

    Journal: Pharmacogenetics and genomics

    Article Title: Measuring the Overall Genetic Component of Nevirapine Pharmacokinetics and the Role of Selected Polymorphisms: Towards Addressing the Missing Heritability in Pharmacogenetic Phenotypes?

    doi: 10.1097/FPC.0b013e32836533a5

    Figure Lengend Snippet: Nevirapine plasma concentrations following a 200 mg dose to A) African Americans and B) European Americans. The concentrations (mean ± SEM) are stratified by CYP2B6 516G > T genotype: circles GG, squares GT and triangles TT.

    Article Snippet: TaqMan assays were used to genotype CYP2B6 516G > T (rs3745274, Assay ID: C___7817765_60) and ABCB1 3435C > T (rs1045642, Assay ID: C___7586657_20).


    Allelic discrimination plot of CYP2A6*2 rs1801272 genotypes

    Journal: BMC Cancer

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population

    doi: 10.1186/s12885-018-4342-5

    Figure Lengend Snippet: Allelic discrimination plot of CYP2A6*2 rs1801272 genotypes

    Article Snippet: For CYP2A6*2 (1799 T > A ) [rs1801272; assay ID: C_27861808_60], the VIC/FAM sequence was as follows: CCCCTGCTCACCGCCAGTGCCCCGG[T/A]GGGCGTCGATGAGGAAGCCCGCCTC.


    Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

    Journal: BMC Cancer

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population

    doi: 10.1186/s12885-018-4342-5

    Figure Lengend Snippet: Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

    Article Snippet: For CYP2A6*2 (1799 T > A ) [rs1801272; assay ID: C_27861808_60], the VIC/FAM sequence was as follows: CCCCTGCTCACCGCCAGTGCCCCGG[T/A]GGGCGTCGATGAGGAAGCCCGCCTC.
