6 fam Kaneka Corp Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Kaneka Corp fluorophore 6 fam
    Fluorophore 6 Fam, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorophore 6 fam/product/Kaneka Corp
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    fluorophore 6 fam - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    85
    Kaneka Corp carboxyfluorescein 6 fam
    Carboxyfluorescein 6 Fam, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 85/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/carboxyfluorescein 6 fam/product/Kaneka Corp
    Average 85 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    carboxyfluorescein 6 fam - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Kaneka Corp 6 fam tcggtgtttgatttggcctg tamra 3
    6 Fam Tcggtgtttgatttggcctg Tamra 3, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam tcggtgtttgatttggcctg tamra 3/product/Kaneka Corp
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    6 fam tcggtgtttgatttggcctg tamra 3 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Kaneka Corp 6 fam tttacgt gcccaagaaggccacaga tamra 3
    6 Fam Tttacgt Gcccaagaaggccacaga Tamra 3, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam tttacgt gcccaagaaggccacaga tamra 3/product/Kaneka Corp
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    6 fam tttacgt gcccaagaaggccacaga tamra 3 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Kaneka Corp m1 probe
    M1 Probe, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 85/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m1 probe/product/Kaneka Corp
    Average 85 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    m1 probe - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    86
    Kaneka Corp probe sanp1
    Probe Sanp1, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 86/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/probe sanp1/product/Kaneka Corp
    Average 86 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    probe sanp1 - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    86
    Kaneka Corp loxp probe
    Loxp Probe, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/loxp probe/product/Kaneka Corp
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    loxp probe - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    85
    Kaneka Corp fluorogenic probe cdvp
    Fluorogenic Probe Cdvp, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorogenic probe cdvp/product/Kaneka Corp
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    fluorogenic probe cdvp - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Kaneka Corp eclipse dark quencher edq
    Eclipse Dark Quencher Edq, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eclipse dark quencher edq/product/Kaneka Corp
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    eclipse dark quencher edq - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    88
    Kaneka Corp primer ar912r
    Primer Ar912r, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 88/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer ar912r/product/Kaneka Corp
    Average 88 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    primer ar912r - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    Image Search Results