6 fam Integrated Dna Technologies Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Integrated DNA Technologies 5 6 fam agatcggaagagcgtcgtgtagg gaaagag 3 dna oligonucleotide
    5 6 Fam Agatcggaagagcgtcgtgtagg Gaaagag 3 Dna Oligonucleotide, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 6 fam agatcggaagagcgtcgtgtagg gaaagag 3 dna oligonucleotide/product/Integrated DNA Technologies
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5 6 fam agatcggaagagcgtcgtgtagg gaaagag 3 dna oligonucleotide - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    90
    Integrated DNA Technologies 5 6 fam ccaagtcatgaaggagagggaataccgct 3
    5 6 Fam Ccaagtcatgaaggagagggaataccgct 3, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 6 fam ccaagtcatgaaggagagggaataccgct 3/product/Integrated DNA Technologies
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5 6 fam ccaagtcatgaaggagagggaataccgct 3 - by Bioz Stars, 2021-01
    90/100 stars
      Buy from Supplier

    92
    Integrated DNA Technologies 5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq
    5 6 Fam Ccaccccac Zen Aagatttaaacaccatgctaa 3 Iabkfq, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq/product/Integrated DNA Technologies
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq - by Bioz Stars, 2021-01
    92/100 stars
      Buy from Supplier

    90
    Integrated DNA Technologies 6 fam darudada 3 tamra oligonucleotide
    Dose response curves of select nsp15 hits. Inhibitor structures and 3° FRET assay dose-response curves with calculated IC 50 values for Exebryl-1 ( A ), Piroxantrone ( C ), and MMV1580853 ( E ). Nsp15 (25 nM) was incubated with 2-fold or 3-fold serial concentrations of compound and incubated with the substrate <t>5’6-</t> <t>FAM/dArUdAdA/3’-TAMRA</t> (0.5 μM) at ambient temperature for 1 h. Results of a polyacrylamide gel-based RNA cleavage assay for Exebryl-1 ( B ) and Piroxantrone ( D ). nsp15 (0.78 μM) and poly(rA) (500 ng) was incubated with 2-fold serial concentrations of each compound and incubated at ambient temperature for 2 h. Cleavage products were separated from uncleaved poly(rA) by electrophoresis on a 15% TBE-urea polyacrylamide gel and the % cleavage activity calculated by quantitating the relative amount of cleaved (20 nt lower band) vs uncleaved (31 nt top band) substrate in each sample relative to a DMSO control. Gel-based RNA cleavage inhibition of MMV1580853 was observed, but was variable from experiment to experiment, likely due to poor solubility in DMSO and assay buffer.
    6 Fam Darudada 3 Tamra Oligonucleotide, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam darudada 3 tamra oligonucleotide/product/Integrated DNA Technologies
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam darudada 3 tamra oligonucleotide - by Bioz Stars, 2021-01
    90/100 stars
      Buy from Supplier

    90
    Integrated DNA Technologies 6 fam dye
    Dose response curves of select nsp15 hits. Inhibitor structures and 3° FRET assay dose-response curves with calculated IC 50 values for Exebryl-1 ( A ), Piroxantrone ( C ), and MMV1580853 ( E ). Nsp15 (25 nM) was incubated with 2-fold or 3-fold serial concentrations of compound and incubated with the substrate <t>5’6-</t> <t>FAM/dArUdAdA/3’-TAMRA</t> (0.5 μM) at ambient temperature for 1 h. Results of a polyacrylamide gel-based RNA cleavage assay for Exebryl-1 ( B ) and Piroxantrone ( D ). nsp15 (0.78 μM) and poly(rA) (500 ng) was incubated with 2-fold serial concentrations of each compound and incubated at ambient temperature for 2 h. Cleavage products were separated from uncleaved poly(rA) by electrophoresis on a 15% TBE-urea polyacrylamide gel and the % cleavage activity calculated by quantitating the relative amount of cleaved (20 nt lower band) vs uncleaved (31 nt top band) substrate in each sample relative to a DMSO control. Gel-based RNA cleavage inhibition of MMV1580853 was observed, but was variable from experiment to experiment, likely due to poor solubility in DMSO and assay buffer.
    6 Fam Dye, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam dye/product/Integrated DNA Technologies
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam dye - by Bioz Stars, 2021-01
    90/100 stars
      Buy from Supplier

    90
    Integrated DNA Technologies 6 fam zen 3 ibfq probe
    Dose response curves of select nsp15 hits. Inhibitor structures and 3° FRET assay dose-response curves with calculated IC 50 values for Exebryl-1 ( A ), Piroxantrone ( C ), and MMV1580853 ( E ). Nsp15 (25 nM) was incubated with 2-fold or 3-fold serial concentrations of compound and incubated with the substrate <t>5’6-</t> <t>FAM/dArUdAdA/3’-TAMRA</t> (0.5 μM) at ambient temperature for 1 h. Results of a polyacrylamide gel-based RNA cleavage assay for Exebryl-1 ( B ) and Piroxantrone ( D ). nsp15 (0.78 μM) and poly(rA) (500 ng) was incubated with 2-fold serial concentrations of each compound and incubated at ambient temperature for 2 h. Cleavage products were separated from uncleaved poly(rA) by electrophoresis on a 15% TBE-urea polyacrylamide gel and the % cleavage activity calculated by quantitating the relative amount of cleaved (20 nt lower band) vs uncleaved (31 nt top band) substrate in each sample relative to a DMSO control. Gel-based RNA cleavage inhibition of MMV1580853 was observed, but was variable from experiment to experiment, likely due to poor solubility in DMSO and assay buffer.
    6 Fam Zen 3 Ibfq Probe, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam zen 3 ibfq probe/product/Integrated DNA Technologies
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam zen 3 ibfq probe - by Bioz Stars, 2021-01
    90/100 stars
      Buy from Supplier

    90
    Integrated DNA Technologies 6 fam
    Dose response curves of select nsp15 hits. Inhibitor structures and 3° FRET assay dose-response curves with calculated IC 50 values for Exebryl-1 ( A ), Piroxantrone ( C ), and MMV1580853 ( E ). Nsp15 (25 nM) was incubated with 2-fold or 3-fold serial concentrations of compound and incubated with the substrate <t>5’6-</t> <t>FAM/dArUdAdA/3’-TAMRA</t> (0.5 μM) at ambient temperature for 1 h. Results of a polyacrylamide gel-based RNA cleavage assay for Exebryl-1 ( B ) and Piroxantrone ( D ). nsp15 (0.78 μM) and poly(rA) (500 ng) was incubated with 2-fold serial concentrations of each compound and incubated at ambient temperature for 2 h. Cleavage products were separated from uncleaved poly(rA) by electrophoresis on a 15% TBE-urea polyacrylamide gel and the % cleavage activity calculated by quantitating the relative amount of cleaved (20 nt lower band) vs uncleaved (31 nt top band) substrate in each sample relative to a DMSO control. Gel-based RNA cleavage inhibition of MMV1580853 was observed, but was variable from experiment to experiment, likely due to poor solubility in DMSO and assay buffer.
    6 Fam, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam/product/Integrated DNA Technologies
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam - by Bioz Stars, 2021-01
    90/100 stars
      Buy from Supplier

    90
    Integrated DNA Technologies zikv 1107 probe ໿
    Dose response curves of select nsp15 hits. Inhibitor structures and 3° FRET assay dose-response curves with calculated IC 50 values for Exebryl-1 ( A ), Piroxantrone ( C ), and MMV1580853 ( E ). Nsp15 (25 nM) was incubated with 2-fold or 3-fold serial concentrations of compound and incubated with the substrate <t>5’6-</t> <t>FAM/dArUdAdA/3’-TAMRA</t> (0.5 μM) at ambient temperature for 1 h. Results of a polyacrylamide gel-based RNA cleavage assay for Exebryl-1 ( B ) and Piroxantrone ( D ). nsp15 (0.78 μM) and poly(rA) (500 ng) was incubated with 2-fold serial concentrations of each compound and incubated at ambient temperature for 2 h. Cleavage products were separated from uncleaved poly(rA) by electrophoresis on a 15% TBE-urea polyacrylamide gel and the % cleavage activity calculated by quantitating the relative amount of cleaved (20 nt lower band) vs uncleaved (31 nt top band) substrate in each sample relative to a DMSO control. Gel-based RNA cleavage inhibition of MMV1580853 was observed, but was variable from experiment to experiment, likely due to poor solubility in DMSO and assay buffer.
    Zikv 1107 Probe ໿, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zikv 1107 probe ໿/product/Integrated DNA Technologies
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    zikv 1107 probe ໿ - by Bioz Stars, 2021-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    Dose response curves of select nsp15 hits. Inhibitor structures and 3° FRET assay dose-response curves with calculated IC 50 values for Exebryl-1 ( A ), Piroxantrone ( C ), and MMV1580853 ( E ). Nsp15 (25 nM) was incubated with 2-fold or 3-fold serial concentrations of compound and incubated with the substrate 5’6- FAM/dArUdAdA/3’-TAMRA (0.5 μM) at ambient temperature for 1 h. Results of a polyacrylamide gel-based RNA cleavage assay for Exebryl-1 ( B ) and Piroxantrone ( D ). nsp15 (0.78 μM) and poly(rA) (500 ng) was incubated with 2-fold serial concentrations of each compound and incubated at ambient temperature for 2 h. Cleavage products were separated from uncleaved poly(rA) by electrophoresis on a 15% TBE-urea polyacrylamide gel and the % cleavage activity calculated by quantitating the relative amount of cleaved (20 nt lower band) vs uncleaved (31 nt top band) substrate in each sample relative to a DMSO control. Gel-based RNA cleavage inhibition of MMV1580853 was observed, but was variable from experiment to experiment, likely due to poor solubility in DMSO and assay buffer.

    Journal: bioRxiv

    Article Title: High-throughput screening of the ReFRAME, Pandemic Box, and COVID Box drug repurposing libraries against SARS-CoV2 nsp15 endoribonuclease to identify small-molecule inhibitors of viral activity

    doi: 10.1101/2021.01.21.427657

    Figure Lengend Snippet: Dose response curves of select nsp15 hits. Inhibitor structures and 3° FRET assay dose-response curves with calculated IC 50 values for Exebryl-1 ( A ), Piroxantrone ( C ), and MMV1580853 ( E ). Nsp15 (25 nM) was incubated with 2-fold or 3-fold serial concentrations of compound and incubated with the substrate 5’6- FAM/dArUdAdA/3’-TAMRA (0.5 μM) at ambient temperature for 1 h. Results of a polyacrylamide gel-based RNA cleavage assay for Exebryl-1 ( B ) and Piroxantrone ( D ). nsp15 (0.78 μM) and poly(rA) (500 ng) was incubated with 2-fold serial concentrations of each compound and incubated at ambient temperature for 2 h. Cleavage products were separated from uncleaved poly(rA) by electrophoresis on a 15% TBE-urea polyacrylamide gel and the % cleavage activity calculated by quantitating the relative amount of cleaved (20 nt lower band) vs uncleaved (31 nt top band) substrate in each sample relative to a DMSO control. Gel-based RNA cleavage inhibition of MMV1580853 was observed, but was variable from experiment to experiment, likely due to poor solubility in DMSO and assay buffer.

    Article Snippet: The 5’6-FAM/dArUdAdA/3’-TAMRA oligonucleotide was purchased from IDT DNA Inc (Coralville, IA).

    Techniques: Incubation, Cleavage Assay, Electrophoresis, Activity Assay, Inhibition, Solubility

    Primary SARS-CoV2 nsp15 endoribonuclease assay. A) Schematic illustrates the assay used to identify nsp15 inhibitors. Close proximity of the intact 5’-FAM and 3’-TAMRA fluorophores of the oligonucleotide substrate, 5’6-FAM/dArUdAdA/3’-TAMRA, results in quenching of fluorescence due to fluorescence resonance energy transfer (FRET). Enzymatic cleavage of the substrate by nsp15 leads to increased FAM fluorescence. B) The effects of Mn 2+ and Mg 2+ on SARS-CoV-2 nsp15 endoU activity in a 1 hr cleavage reaction at ambient temperature. The presence of Mn 2+ leads to a 2.7-fold increase in FAM fluorescence compared to reactions lacking metal supplementation while the addition of Mg 2+ appears to have minimal effect on activity (n=8, mean values ± standard deviations). ***, P

    Journal: bioRxiv

    Article Title: High-throughput screening of the ReFRAME, Pandemic Box, and COVID Box drug repurposing libraries against SARS-CoV2 nsp15 endoribonuclease to identify small-molecule inhibitors of viral activity

    doi: 10.1101/2021.01.21.427657

    Figure Lengend Snippet: Primary SARS-CoV2 nsp15 endoribonuclease assay. A) Schematic illustrates the assay used to identify nsp15 inhibitors. Close proximity of the intact 5’-FAM and 3’-TAMRA fluorophores of the oligonucleotide substrate, 5’6-FAM/dArUdAdA/3’-TAMRA, results in quenching of fluorescence due to fluorescence resonance energy transfer (FRET). Enzymatic cleavage of the substrate by nsp15 leads to increased FAM fluorescence. B) The effects of Mn 2+ and Mg 2+ on SARS-CoV-2 nsp15 endoU activity in a 1 hr cleavage reaction at ambient temperature. The presence of Mn 2+ leads to a 2.7-fold increase in FAM fluorescence compared to reactions lacking metal supplementation while the addition of Mg 2+ appears to have minimal effect on activity (n=8, mean values ± standard deviations). ***, P

    Article Snippet: The 5’6-FAM/dArUdAdA/3’-TAMRA oligonucleotide was purchased from IDT DNA Inc (Coralville, IA).

    Techniques: Fluorescence, Förster Resonance Energy Transfer, Activity Assay