Integrated DNA Technologies
5 6 fam agatcggaagagcgtcgtgtagg gaaagag 3 dna oligonucleotide 5 6 Fam Agatcggaagagcgtcgtgtagg Gaaagag 3 Dna Oligonucleotide, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5 6 fam agatcggaagagcgtcgtgtagg gaaagag 3 dna oligonucleotide/product/Integrated DNA Technologies Average 99 stars, based on 1 article reviews Price from $9.99 to $1999.99
5 6 fam agatcggaagagcgtcgtgtagg gaaagag 3 dna oligonucleotide - by Bioz Stars,
2021-01
99/100 stars
|
Buy from Supplier |
Integrated DNA Technologies
5 6 fam ccaagtcatgaaggagagggaataccgct 3 5 6 Fam Ccaagtcatgaaggagagggaataccgct 3, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5 6 fam ccaagtcatgaaggagagggaataccgct 3/product/Integrated DNA Technologies Average 90 stars, based on 1 article reviews Price from $9.99 to $1999.99
5 6 fam ccaagtcatgaaggagagggaataccgct 3 - by Bioz Stars,
2021-01
90/100 stars
|
Buy from Supplier |
Integrated DNA Technologies
5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq 5 6 Fam Ccaccccac Zen Aagatttaaacaccatgctaa 3 Iabkfq, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq/product/Integrated DNA Technologies Average 92 stars, based on 3 article reviews Price from $9.99 to $1999.99
5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq - by Bioz Stars,
2021-01
92/100 stars
|
Buy from Supplier |
Integrated DNA Technologies
6 fam darudada 3 tamra oligonucleotide ![]() 6 Fam Darudada 3 Tamra Oligonucleotide, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/6 fam darudada 3 tamra oligonucleotide/product/Integrated DNA Technologies Average 90 stars, based on 1 article reviews Price from $9.99 to $1999.99
6 fam darudada 3 tamra oligonucleotide - by Bioz Stars,
2021-01
90/100 stars
|
Buy from Supplier |
Integrated DNA Technologies
6 fam dye ![]() 6 Fam Dye, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/6 fam dye/product/Integrated DNA Technologies Average 90 stars, based on 1 article reviews Price from $9.99 to $1999.99
6 fam dye - by Bioz Stars,
2021-01
90/100 stars
|
Buy from Supplier |
Integrated DNA Technologies
6 fam zen 3 ibfq probe ![]() 6 Fam Zen 3 Ibfq Probe, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/6 fam zen 3 ibfq probe/product/Integrated DNA Technologies Average 90 stars, based on 1 article reviews Price from $9.99 to $1999.99
6 fam zen 3 ibfq probe - by Bioz Stars,
2021-01
90/100 stars
|
Buy from Supplier |
Integrated DNA Technologies
6 fam ![]() 6 Fam, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/6 fam/product/Integrated DNA Technologies Average 90 stars, based on 1 article reviews Price from $9.99 to $1999.99
6 fam - by Bioz Stars,
2021-01
90/100 stars
|
Buy from Supplier |
Integrated DNA Technologies
zikv 1107 probe ![]() Zikv 1107 Probe , supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zikv 1107 probe /product/Integrated DNA Technologies Average 90 stars, based on 1 article reviews Price from $9.99 to $1999.99
zikv 1107 probe - by Bioz Stars,
2021-01
90/100 stars
|
Buy from Supplier |
Image Search Results

Journal: bioRxiv
Article Title: High-throughput screening of the ReFRAME, Pandemic Box, and COVID Box drug repurposing libraries against SARS-CoV2 nsp15 endoribonuclease to identify small-molecule inhibitors of viral activity
doi: 10.1101/2021.01.21.427657
Figure Lengend Snippet: Dose response curves of select nsp15 hits. Inhibitor structures and 3° FRET assay dose-response curves with calculated IC 50 values for Exebryl-1 ( A ), Piroxantrone ( C ), and MMV1580853 ( E ). Nsp15 (25 nM) was incubated with 2-fold or 3-fold serial concentrations of compound and incubated with the substrate 5’6- FAM/dArUdAdA/3’-TAMRA (0.5 μM) at ambient temperature for 1 h. Results of a polyacrylamide gel-based RNA cleavage assay for Exebryl-1 ( B ) and Piroxantrone ( D ). nsp15 (0.78 μM) and poly(rA) (500 ng) was incubated with 2-fold serial concentrations of each compound and incubated at ambient temperature for 2 h. Cleavage products were separated from uncleaved poly(rA) by electrophoresis on a 15% TBE-urea polyacrylamide gel and the % cleavage activity calculated by quantitating the relative amount of cleaved (20 nt lower band) vs uncleaved (31 nt top band) substrate in each sample relative to a DMSO control. Gel-based RNA cleavage inhibition of MMV1580853 was observed, but was variable from experiment to experiment, likely due to poor solubility in DMSO and assay buffer.
Article Snippet: The
Techniques: Incubation, Cleavage Assay, Electrophoresis, Activity Assay, Inhibition, Solubility

Journal: bioRxiv
Article Title: High-throughput screening of the ReFRAME, Pandemic Box, and COVID Box drug repurposing libraries against SARS-CoV2 nsp15 endoribonuclease to identify small-molecule inhibitors of viral activity
doi: 10.1101/2021.01.21.427657
Figure Lengend Snippet: Primary SARS-CoV2 nsp15 endoribonuclease assay. A) Schematic illustrates the assay used to identify nsp15 inhibitors. Close proximity of the intact 5’-FAM and 3’-TAMRA fluorophores of the oligonucleotide substrate, 5’6-FAM/dArUdAdA/3’-TAMRA, results in quenching of fluorescence due to fluorescence resonance energy transfer (FRET). Enzymatic cleavage of the substrate by nsp15 leads to increased FAM fluorescence. B) The effects of Mn 2+ and Mg 2+ on SARS-CoV-2 nsp15 endoU activity in a 1 hr cleavage reaction at ambient temperature. The presence of Mn 2+ leads to a 2.7-fold increase in FAM fluorescence compared to reactions lacking metal supplementation while the addition of Mg 2+ appears to have minimal effect on activity (n=8, mean values ± standard deviations). ***, P
Article Snippet: The
Techniques: Fluorescence, Förster Resonance Energy Transfer, Activity Assay