|
Addgene inc
pich47742 Pich47742, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/pICH47742%3A%3A2x35S-5%E2%80%99UTR-hCas9(STOP)-NOST+(Plasmid+%2349771)/pmc06226536-212-6-7 Average 93 stars, based on 1 article reviews
pich47742 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pagm4723 plasmid Pagm4723 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/pAGM4723%3A%3AAtU6p%3A%3AsgRNA2-2x35S-5%E2%80%B2UTR%3A%3ACas9%3A%3ANOST-AtU6p%3A%3AsgRNA1+(Plasmid+%2349772)/bio_rxiv__2023__05__05__539534-300-14-16 Average 91 stars, based on 1 article reviews
pagm4723 plasmid - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
Addgene inc
ivan topisirovic Ivan Topisirovic, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/pCDNA3+ATP5O(5%E2%80%99UTR)-FF+(Plasmid+%2385486)/pmc12764827-353-29-31 Average 93 stars, based on 1 article reviews
ivan topisirovic - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
hcsat transcript variant 2 Hcsat Transcript Variant 2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/CSHL1+(NM_022581)+Human+3'+UTR+Clone/pm23065352-150-4-14 Average 90 stars, based on 1 article reviews
hcsat transcript variant 2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Addgene inc
phr dhfry100i sfgfp nls p2a nls mcherry p2a emi1 5 Phr Dhfry100i Sfgfp Nls P2a Nls Mcherry P2a Emi1 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_+Emi1+5'+and+3'UTR+(Plasmid+%2367930)/pmc10328522-204-10-20 Average 91 stars, based on 1 article reviews
phr dhfry100i sfgfp nls p2a nls mcherry p2a emi1 5 - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
Addgene inc
50utr cgg 99x fmr1 egfp plasmid ![]() 50utr Cgg 99x Fmr1 Egfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/5'UTR+CGG+99x+FMR1-EGFP+(Plasmid+%2363091)/pm35617426-267-4-9 Average 93 stars, based on 1 article reviews
50utr cgg 99x fmr1 egfp plasmid - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
nls mcherry ![]() Nls Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_+Lox+5'UTR+(Plasmid+%2367932)/pm41405996-289-11-16 Average 93 stars, based on 1 article reviews
nls mcherry - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
tggatgtcagccctctggctta ![]() Tggatgtcagccctctggctta, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/Glypican+5+(GPC5)+(NM_004466)+Human+3'+UTR+Clone/pm40359940-212-155-156 Average 93 stars, based on 1 article reviews
tggatgtcagccctctggctta - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
caspase 5 ![]() Caspase 5, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/Caspase+5+(CASP5)+(NM_001136111)+Human+3'+UTR+Clone/pm33371762-68-21-37 Average 90 stars, based on 1 article reviews
caspase 5 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Addgene inc
human apob48 ![]() Human Apob48, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/pRP%2EExTri-CMV-5'UTR-ApoB48-Linker-eGFP+(Plasmid+%23138334)/pm38211723-84-3-7 Average 92 stars, based on 1 article reviews
human apob48 - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
lipid 5 48 ˆ 10 ![]() Lipid 5 48 ˆ 10, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/SimpleChIP+Human+LENG8+5'+UTR+Primers/10__3390_slash_molecules21020148-154-173-218 Average 90 stars, based on 1 article reviews
lipid 5 48 ˆ 10 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Addgene inc
paper n a ![]() Paper N A, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/5+utr/pFL-SV40-GNB2+5'-UTR+(Plasmid+%23115355)/pm40056900-240-226-223 Average 93 stars, based on 1 article reviews
paper n a - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Proceedings of the National Academy of Sciences of the United States of America
Article Title: Identification of PSMB5 as a genetic modifier of fragile X-associated tremor/ataxia syndrome.
doi: 10.1073/pnas.2118124119
Figure Lengend Snippet: Fig. 4. Mechanisms of amelioration of CGG-associated toxicity by PSMB5 knockdown. (A and B) PSMB5 knockdown significantly diminishes RAN translation of FMR1 50UTR CGG repeats. Plasmid-transfected NL-based reporters for canonical and RAN translation were expressed in HEK293 cells, following transfec- tion of siRNAs against PSMB5 or nontargeting siRNAs (siNT). Four replicates were performed with consistent results, and the graph represents the pooled data gathered across two replicates (two-way ANOVA with Tukey’s multiple comparisons test; n = 6 per condition; *P ≤0.0332, **P ≤0.0021, ****P ≤ 0.0001). Knockdown of PSMB5 results in significant suppression of RAN translation compared to canonical translation and is not frame-dependent. (C) Sche- matic illustrates a proposed model depicting a potential mechanism of CGG-associated toxicity in FXTAS. DGCR8 normally binds PSMB5 mRNA (Left). In the presence of the expanded premutation FMR1 CGG repeat (Right), DGCR8 is sequestered to the expanded CGG repeat, potentially leading to an increase of PSMB5 mRNA unbound by DGCR8. (D and E) Immunoprecipitation of FLAG-DGCR8 shows less PSMB5 mRNA binds to DGCR8 in the presence of CGG repeats. (D) FLAG-DGCR8 was overexpressed in HEK293T cells for 24 h, then cells were subsequently transfected again with either 50UTR CGG 99x FMR1-EGFP plasmid or pcDNA 3.1. Western blot shows upon immunoprecipitation with anti-FLAG antibody, equal amounts of FLAG-DGCR8 were pulled down and eluted. (E) PSMB5 mRNA bound to FLAG-DGCR8 diminishes significantly in the presence of the expanded CGG repeat. Following immunoprecipitation, the eluent was subject to RNA extraction. Using RT-qPCR, mRNA bound to FLAG-DGCR8 was quantified. Significantly less PSMB5 mRNA was bound to FLAG-DGCR8 in the presence of the CGG repeat. Differences in the levels of U16 snoRNA (also known to be bound by DGCR8) were not statistically significant. Data were pooled across three replicates (two-way ANOVA with Sidak’s multiple comparisons test, n = 3 per condition, **P ≤0.005).
Article Snippet: Plasmid DNA consisted of
Techniques: Knockdown, Plasmid Preparation, Transfection, Immunoprecipitation, Western Blot, RNA Extraction, Quantitative RT-PCR
Journal: Molecular metabolism
Article Title: Conditional hepatocyte ablation of PDIA1 uncovers indispensable roles in both APOB and MTTP folding to support VLDL secretion.
doi: 10.1016/j.molmet.2024.101874
Figure Lengend Snippet: Figure 1: Hepatocyte-specific Pdia1 deletion induces severe hypolipidemia and hepatic steatosis with a blockade of hepatic TG export. A. Schematic shows floxed exons 1 and 2 of the Pdia1 allele (Pdia1f/f). Generation of hepatocyte-specific PDIA1-ablated mice (Pdia1-LKO) was produced using Ad-CMV-Cre or AAV8-TBG-Cre. B. Transduction of Pdia1f/f with AAV8-TBG-Cre eliminated Pida1 mRNA in the liver but did not affect the mRNA levels of other PDI protein family members. C. PDIA1 was absent in the livers of Pdia1-LKO accompanied with upregulation of PDIA4. D. Plasma levels of total cholesterol and TG were both greatly reduced in Pdia1-LKO mice (n ¼ 5). E and F. APOB100, APOB48 and APOE were nearly absent in plasma of Pdia1-LKO mice, with a reduced level of ApoA1 but plasma albumin levels were not changed. Each lane represents a sample from individual mouse. G. Liver images and H/E-stained liver sections demonstrate severe liver fat accumulation in Pdia1-LKO mice. Scale bar: 200 mm. H. Hepatic TG content was markedly increased in Pdia1-LKO mice (n ¼ 5). I. Dramatic decrease in hepatic VLDL-TG secretion in Pdia1-LKO mice (n ¼ 3). **P < 0.01.
Article Snippet: Expression vector encoding
Techniques: Produced, Transduction, Clinical Proteomics, Staining
Journal: Molecular metabolism
Article Title: Conditional hepatocyte ablation of PDIA1 uncovers indispensable roles in both APOB and MTTP folding to support VLDL secretion.
doi: 10.1016/j.molmet.2024.101874
Figure Lengend Snippet: Figure 5: Secretion of APOB48 is completely blocked in Pdia1-deleted hepatocytes and is rescued by complementary expression of wild type PDIA1 (PDI) or catalytically inactive PDIA1 (PDImt). A. Pulse-chase analysis revealed that Pdia1-deletion did not affect APOB48 synthesis (lane 5 vs lane 1) but it completely inhibited APOB48 secretion (lanes 12e14 vs lanes 9e11, respectively). B. Complementary expression of PDI or PDImt alone rescued APOB48 secretion. Hepatocytes isolated from Pdia1f/f and Pdia1-LKO mice were infected with the indicated adenoviruses at 20 h after plating. At 18 h post-transduction, the hepatocytes were pulse-labeled with 35S-Met/Cys in the presence of 0.3 mM oleic acid complexed with BSA (OA-BSA) for 3 h. The 35S-labeled ApoB’s and albumin were immunoprecipitated with rabbit polyclonal antibodies against mouse APOB and albumin, respectively. Immunoblotting (IB) demonstrated that no endogenous MTTP was rescued in the Ad-PDI- or Ad-PDImt-infected Pdia1-LKO hepatocytes. C. Complementary expression of PDI or PDImt alone did not rescue secretion of 3H-labeled TG by the Pdia1-LKO hepatocytes, neither did forced expression of MTTP alone. He- patocytes isolated from Pdia1f/f and Pdia1-LKO mice were infected with the indicated adenoviruses. At 18 h p.i., hepatocytes were incubated with DMEM containing 0.3 mM oleic acid-BSA and 3H-glycerol for 4 h. The 3H-labeled TG in cells and media were isolated and the 3H-radioacivity was measured and expressed as DPM/mg cell protein/h. Each bar represents average þ/ SD of triplicate wells. *, P < 0.05; **, P < 0.01.
Article Snippet: Expression vector encoding
Techniques: Expressing, Pulse Chase, Isolation, Infection, Transduction, Labeling, Immunoprecipitation, Western Blot, Incubation
Journal: Molecular metabolism
Article Title: Conditional hepatocyte ablation of PDIA1 uncovers indispensable roles in both APOB and MTTP folding to support VLDL secretion.
doi: 10.1016/j.molmet.2024.101874
Figure Lengend Snippet: Figure 6: Wild type PDIA1 (PDI) and catalytically inactive PDIA1 (PDImt) directly interact with the peptide region between ApoB27 and ApoB48. A. PDI and PDImt interact with APOB48 in transfected COS-7 cells. COS-7 cells were transfected with human APOB48 (hAPOB48), C-terminal-FLAG-tagged PDI (PDI-f) or PDImt (PDImt-f) expression vectors as indicated. The transfected cells were harvested 30 h post- transfection and subjected to FLAG-immnunoprecipitation (IP) analysis using M2 anti-FLAG magnetic beads. Co-IP of hAPOB48 with PDI-f (lanes 10 & 11) or PDImt-f (lanes 12 & 13) indicate their direct interactions. B. Neither APOB17 nor APOB27 interact with PDI or PDImt. COS-7 cells were transfected PDI-f or or PDImt-f expression vectors in the presence of Ad-hAPOB15 (hAPOB15) or Ad-hAPOB27. FLAG-IP assays were performed on the DNA transfected COS-7 cells at 30 h post-transfection. No hAPOB15 nor hAPOB27 were pulled down with PDI-f or PDImt-f. C. PDIA1 is not required for secretion of APOB17 and APOB27. Hepatocytes isolated from Pdia1f/f and Pdia1-LKO mice were transduced with Ad-GFP (GFP), Ad-hAPOB15 (B15), or Ad- hAPOB27 (B27). At 48 h post-transduction, hepatocytes, and conditioned media (20 h incubation time) were harvested. Cellular and secreted human ApoB15 and apoB27 were immunoprecipitated with rabbit anti-human ApoB followed by immuno- blot analysis using goat anti-human ApoB.
Article Snippet: Expression vector encoding
Techniques: Transfection, Expressing, Magnetic Beads, Co-Immunoprecipitation Assay, Isolation, Transduction, Incubation, Immunoprecipitation