5 gaagatct cggcgtcactttgctacctg 3 reverse Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher fastdigest kpni
    Fastdigest Kpni, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 156 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fastdigest kpni/product/Thermo Fisher
    Average 93 stars, based on 156 article reviews
    Price from $9.99 to $1999.99
    fastdigest kpni - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    95
    Promega pgl3 basic vector
    Pgl3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 95/100, based on 27770 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgl3 basic vector/product/Promega
    Average 95 stars, based on 27770 article reviews
    Price from $9.99 to $1999.99
    pgl3 basic vector - by Bioz Stars, 2020-08
    95/100 stars
      Buy from Supplier

    93
    Thermo Fisher fastdigest bglii
    Fastdigest Bglii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 60 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fastdigest bglii/product/Thermo Fisher
    Average 93 stars, based on 60 article reviews
    Price from $9.99 to $1999.99
    fastdigest bglii - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Image Search Results