44658 Search Results


basexos 250 agagggagagaaacagctgg  (ATCC)
90
ATCC basexos 250 agagggagagaaacagctgg
Basexos 250 Agagggagagaaacagctgg, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/basexos 250 agagggagagaaacagctgg/product/ATCC
Average 90 stars, based on 1 article reviews
basexos 250 agagggagagaaacagctgg - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
genus nocardiopsis  (DSMZ)
93
DSMZ genus nocardiopsis
Maximum-likelihood phylogenetic tree based on 16S rRNA gene sequences (1551 nt), showing the relationship between strain CT-R113 T and the available type strains within the genus <t>Nocardiopsis</t> . Accession numbers are indicated in brackets. Values at the nodes indicate bootstrap values of 50 % and above, obtained based on 1000 resampling events. Bacillus subtilis NCIB 3610 T was used as an outgroup. Scale bar, 2 inferred nucleotide substitutions per 100 nucleotides.
Genus Nocardiopsis, supplied by DSMZ, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/genus nocardiopsis/product/DSMZ
Average 93 stars, based on 1 article reviews
genus nocardiopsis - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


Maximum-likelihood phylogenetic tree based on 16S rRNA gene sequences (1551 nt), showing the relationship between strain CT-R113 T and the available type strains within the genus Nocardiopsis . Accession numbers are indicated in brackets. Values at the nodes indicate bootstrap values of 50 % and above, obtained based on 1000 resampling events. Bacillus subtilis NCIB 3610 T was used as an outgroup. Scale bar, 2 inferred nucleotide substitutions per 100 nucleotides.

Journal: International Journal of Systematic and Evolutionary Microbiology

Article Title: Nocardiopsis codii sp. nov., and Rhodococcus chondri sp. nov., two novel actinomycetal species isolated from macroalgae collected in the northern Portuguese coast

doi: 10.1099/ijsem.0.006483

Figure Lengend Snippet: Maximum-likelihood phylogenetic tree based on 16S rRNA gene sequences (1551 nt), showing the relationship between strain CT-R113 T and the available type strains within the genus Nocardiopsis . Accession numbers are indicated in brackets. Values at the nodes indicate bootstrap values of 50 % and above, obtained based on 1000 resampling events. Bacillus subtilis NCIB 3610 T was used as an outgroup. Scale bar, 2 inferred nucleotide substitutions per 100 nucleotides.

Article Snippet: The genus Nocardiopsis, proposed in 1976 [ ], belongs to the family Nocardiopsaceae [ ], order Streptosporangiales and class Actinomycetes [ ], and currently comprises 50 taxa with validly published names ( https://lpsn.dsmz.de/genus/nocardiopsis ).

Techniques:

Maximum-likelihood phylogenomic tree based on 400 universal marker genes, showing the relationship between strain CT-R113 T and the closest related type strains within the genus Nocardiopsis . Accession numbers are indicated in brackets. Values at the nodes indicate bootstrap values of 50 % and above obtained based on 1000 resampling events. Bacillus subtilis NCIB 3610 T was used as an outgroup. Scale bar, 10 inferred nucleotide substitutions per 100 nucleotides.

Journal: International Journal of Systematic and Evolutionary Microbiology

Article Title: Nocardiopsis codii sp. nov., and Rhodococcus chondri sp. nov., two novel actinomycetal species isolated from macroalgae collected in the northern Portuguese coast

doi: 10.1099/ijsem.0.006483

Figure Lengend Snippet: Maximum-likelihood phylogenomic tree based on 400 universal marker genes, showing the relationship between strain CT-R113 T and the closest related type strains within the genus Nocardiopsis . Accession numbers are indicated in brackets. Values at the nodes indicate bootstrap values of 50 % and above obtained based on 1000 resampling events. Bacillus subtilis NCIB 3610 T was used as an outgroup. Scale bar, 10 inferred nucleotide substitutions per 100 nucleotides.

Article Snippet: The genus Nocardiopsis, proposed in 1976 [ ], belongs to the family Nocardiopsaceae [ ], order Streptosporangiales and class Actinomycetes [ ], and currently comprises 50 taxa with validly published names ( https://lpsn.dsmz.de/genus/nocardiopsis ).

Techniques: Marker

Fatty acid compositions of strain CT-R113 T , Nocardiopsis tropica JCM 10877 T and Nocardiopsis umidischolae JCM 11758 T Strains: 1, CT-R113 T ; 2, JCM 10877 T ; 3, JCM 11758 T . All data are from this study. The major cellular fatty acids are in bold. tr , Trace amount (fatty acids amounting to <1 %); –, not detected or values lower than 0.45 %.

Journal: International Journal of Systematic and Evolutionary Microbiology

Article Title: Nocardiopsis codii sp. nov., and Rhodococcus chondri sp. nov., two novel actinomycetal species isolated from macroalgae collected in the northern Portuguese coast

doi: 10.1099/ijsem.0.006483

Figure Lengend Snippet: Fatty acid compositions of strain CT-R113 T , Nocardiopsis tropica JCM 10877 T and Nocardiopsis umidischolae JCM 11758 T Strains: 1, CT-R113 T ; 2, JCM 10877 T ; 3, JCM 11758 T . All data are from this study. The major cellular fatty acids are in bold. tr , Trace amount (fatty acids amounting to <1 %); –, not detected or values lower than 0.45 %.

Article Snippet: The genus Nocardiopsis, proposed in 1976 [ ], belongs to the family Nocardiopsaceae [ ], order Streptosporangiales and class Actinomycetes [ ], and currently comprises 50 taxa with validly published names ( https://lpsn.dsmz.de/genus/nocardiopsis ).

Techniques:

Distinct phenotypic, chemotaxonomic and genomic characteristics of strain CT-R113 T and of its closest related type strains Nocardiopsis tropica JCM 10877 T and Nocardiopsis umidischolae JCM 11758 T Strains: 1, CT-R113 T ; 2, JCM 10877 T ; 3, JCM 11758 T . +, Positive; −, negative. The predominant menaquinone of all strains is MK-10. The cell-wall diamino acid in all strains is meso -Dpm. All strains are catalase positive and oxidase negative. All strains produce aerial mycelium.

Journal: International Journal of Systematic and Evolutionary Microbiology

Article Title: Nocardiopsis codii sp. nov., and Rhodococcus chondri sp. nov., two novel actinomycetal species isolated from macroalgae collected in the northern Portuguese coast

doi: 10.1099/ijsem.0.006483

Figure Lengend Snippet: Distinct phenotypic, chemotaxonomic and genomic characteristics of strain CT-R113 T and of its closest related type strains Nocardiopsis tropica JCM 10877 T and Nocardiopsis umidischolae JCM 11758 T Strains: 1, CT-R113 T ; 2, JCM 10877 T ; 3, JCM 11758 T . +, Positive; −, negative. The predominant menaquinone of all strains is MK-10. The cell-wall diamino acid in all strains is meso -Dpm. All strains are catalase positive and oxidase negative. All strains produce aerial mycelium.

Article Snippet: The genus Nocardiopsis, proposed in 1976 [ ], belongs to the family Nocardiopsaceae [ ], order Streptosporangiales and class Actinomycetes [ ], and currently comprises 50 taxa with validly published names ( https://lpsn.dsmz.de/genus/nocardiopsis ).

Techniques: