91
Santa Cruz Biotechnology
si fak Si Fak, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/si fak/product/Santa Cruz Biotechnology Average 91 stars, based on 1 article reviews
si fak - by Bioz Stars,
2025-07
91/100 stars
|
Buy from Supplier |
86
Thermo Fisher
anti isopentenyl diphosphate delta isomerase 1 idi1 pa5 44207 Anti Isopentenyl Diphosphate Delta Isomerase 1 Idi1 Pa5 44207, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti isopentenyl diphosphate delta isomerase 1 idi1 pa5 44207/product/Thermo Fisher Average 86 stars, based on 1 article reviews
anti isopentenyl diphosphate delta isomerase 1 idi1 pa5 44207 - by Bioz Stars,
2025-07
86/100 stars
|
Buy from Supplier |
86
Unigene
target 2132 guacucacuccguuccuaaa 2151 cleavage 1 osa mir1439 t4 unigene bmk 44207 Target 2132 Guacucacuccguuccuaaa 2151 Cleavage 1 Osa Mir1439 T4 Unigene Bmk 44207, supplied by Unigene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/target 2132 guacucacuccguuccuaaa 2151 cleavage 1 osa mir1439 t4 unigene bmk 44207/product/Unigene Average 86 stars, based on 1 article reviews
target 2132 guacucacuccguuccuaaa 2151 cleavage 1 osa mir1439 t4 unigene bmk 44207 - by Bioz Stars,
2025-07
86/100 stars
|
Buy from Supplier |
85
Santa Cruz Biotechnology
fak shrna plasmid Fak Shrna Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fak shrna plasmid/product/Santa Cruz Biotechnology Average 85 stars, based on 1 article reviews
fak shrna plasmid - by Bioz Stars,
2025-07
85/100 stars
|
Buy from Supplier |