44207 Search Results


91
Santa Cruz Biotechnology si fak
Si Fak, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/si fak/product/Santa Cruz Biotechnology
Average 91 stars, based on 1 article reviews
si fak - by Bioz Stars, 2025-07
91/100 stars
  Buy from Supplier

86
Thermo Fisher anti isopentenyl diphosphate delta isomerase 1 idi1 pa5 44207
Anti Isopentenyl Diphosphate Delta Isomerase 1 Idi1 Pa5 44207, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti isopentenyl diphosphate delta isomerase 1 idi1 pa5 44207/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
anti isopentenyl diphosphate delta isomerase 1 idi1 pa5 44207 - by Bioz Stars, 2025-07
86/100 stars
  Buy from Supplier

86
Unigene target 2132 guacucacuccguuccuaaa 2151 cleavage 1 osa mir1439 t4 unigene bmk 44207
Target 2132 Guacucacuccguuccuaaa 2151 Cleavage 1 Osa Mir1439 T4 Unigene Bmk 44207, supplied by Unigene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/target 2132 guacucacuccguuccuaaa 2151 cleavage 1 osa mir1439 t4 unigene bmk 44207/product/Unigene
Average 86 stars, based on 1 article reviews
target 2132 guacucacuccguuccuaaa 2151 cleavage 1 osa mir1439 t4 unigene bmk 44207 - by Bioz Stars, 2025-07
86/100 stars
  Buy from Supplier

85
Santa Cruz Biotechnology fak shrna plasmid
Fak Shrna Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fak shrna plasmid/product/Santa Cruz Biotechnology
Average 85 stars, based on 1 article reviews
fak shrna plasmid - by Bioz Stars, 2025-07
85/100 stars
  Buy from Supplier

Image Search Results