Journal: Neurotoxicity Research

Article Title: Antiproliferative Effect of Elastin-Derived Peptide VGVAPG on SH-SY5Y Neuroblastoma Cells

doi: 10.1007/s12640-019-00040-y

Figure Lengend Snippet: The effect of 50 nM and 1 μM of VGVAPG and VVGPGA peptide, respectively, on a GPx, b SOD, and c CAT activity in the SH-SY5Y cell line after 48 h. The experiments were conducted after application of scrambled siRNA, GLB1 siRNA, or LGAL3 siRNA. Protein activity was normalized to the total protein level. Data are expressed as mean ± SD of three independent experiments, each of which consisted of six replicates per treatment group. * p < 0.05; *** p < 0.001 versus the scramble siRNA vehicle control. # p < 0.05; ## p < 0.01; ### p < 0.001 versus the GLB1 siRNA, or LGAL3 siRNA vehicle control

Article Snippet: The GLB1 siRNA (sc-43792) and LGALS3 (sc-155994) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Activity Assay, Control

Journal: Oncotarget

Article Title: SOCS-1 rescues IL-1β-mediated suppression of epithelial sodium channel in mouse lung epithelial cells via ASK-1

doi: 10.18632/oncotarget.8543

Figure Lengend Snippet: We carried out transfection studies in MLE-12 cells to study the effects of SOCS-1 or ASK-1 overexpression or ASK-1 depletion on αENaC mRNA expression. A. MLE-12 cells were transfected with SOCS-1 or empty vector and treated with or without IL-1β (10 ng/ml) for 36 hours. Total RNA was extracted and αENaC expression was analyzed by real-time RT-PCR. B. MLE-12 cells were transfected with either control or ASK-1 shRNA for 36 hours and treated in the presence or absence of IL-1β (10 ng/ml) for 36 hours. Total RNA was extracted and αENaC expression checked using real-time PCR. C. MLE-12 cells were transfected with ASK-1 or SOCS-1 vector for 36 hours and again analyzed for αENaC expression using the above method. Results are represented as means ± SEM, N = 4-5 per group. Each experiment was performed thrice. The results are expressed as percentage of control. (A) ** P < 0.01 versus empty vector. # = * P < 0.05 versus MLE-12 cells expressing empty vector and treated with IL-1β. (B) *** P < 0.001 relative to control shRNA. # = ** P < 0.01 versus control shRNA treated with IL-1β. (C) *** P < 0.001 versus empty vector. ** P < 0.01 versus ASK-1 overexpressing MLE-12 cells. * P < 0.05 versus SOCS-1 expressing MLE-12 cells. # = * P < 0.05 compared to ASK-1 overexpressing MLE-12 cells.

Article Snippet: The non-targeted β-Gal shRNA used as a control (sense sequence, UUAUGCCGAUCGCGUCACAUU) was obtained from Santa Cruz and ASK-1 shRNA (catalog number sc-29748) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

Techniques: Transfection, Over Expression, Expressing, Plasmid Preparation, Quantitative RT-PCR, Control, shRNA, Real-time Polymerase Chain Reaction