Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: OX40 gene expression is up-regulated by chromatin remodeling in its promoter region containing Sp1/Sp3, YY1, and NF-kappa B binding sites.

doi: 10.4049/jimmunol.179.3.1760

Figure Lengend Snippet: FIGURE 1. Expression of OX40 mRNA in T cells. A, RT-PCR was performed using RNA from primary total T cells and EL4 cells, cul- tured with (CD3) or without (Non) anti-CD3 Ab. Amplified OX40 mRNA (21, 24, 27, and 30 cycles) and 18S rRNA (13, 16, and 19 cycles; as control) PCR products were analyzed by agarose gel with ethidium bromide staining. B, Real-time PCR was performed using RNA from EL4 cells and CD4 T cells, cultured with (CD3) and with- out (Non) anti-CD3 Ab. Expression levels were normalized by 18S rRNA levels. The OX40 mRNA level in activated cells was then com- pared with that in nonactivated cells.

Article Snippet: PCR primers used to amplify the OX40 basal promoter and Abs were as follows: OX40 promoter sense, TACGCCTGTGCCAAATACAC; OX40 promoter antisense, GCTTTCTGCCTTCACAGGAG;anti-p105/p50-ChIPgrade(Abcam);antiacetyl histone H4 polyclonal Ab (Upstate); and rabbit IgG (Santa Cruz Biotechnology).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Control, Agarose Gel Electrophoresis, Staining, Real-time Polymerase Chain Reaction, Cell Culture

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: OX40 gene expression is up-regulated by chromatin remodeling in its promoter region containing Sp1/Sp3, YY1, and NF-kappa B binding sites.

doi: 10.4049/jimmunol.179.3.1760

Figure Lengend Snippet: FIGURE 2. Promoter activity of the OX40 gene. A, Luciferase reporter plasmids were constructed using pGL4 Basic Vector (Promega) and OX40 promoter fragments. All promoter fragments contained the same 3 end and the position of the 5 end of each construct is indicated in B. B, Luciferase activities generated using the reporter plasmids (Pro 1 to Pro 11) were compared with that using negative control plasmid (no promoter, Basic) in nonactivated (Non) EL4 cells and activated (CD3) EL4 cells with anti-CD3 Ab. Luciferase assays were repeated more than three times, and the activ- ities were normalized using Renilla luciferase activity. C, Luciferase assay was also performed (as described in B) using activated (CD3) primary total T cells and indicated plasmids.

Article Snippet: PCR primers used to amplify the OX40 basal promoter and Abs were as follows: OX40 promoter sense, TACGCCTGTGCCAAATACAC; OX40 promoter antisense, GCTTTCTGCCTTCACAGGAG;anti-p105/p50-ChIPgrade(Abcam);antiacetyl histone H4 polyclonal Ab (Upstate); and rabbit IgG (Santa Cruz Biotechnology).

Techniques: Activity Assay, Luciferase, Construct, Plasmid Preparation, Generated, Negative Control

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: OX40 gene expression is up-regulated by chromatin remodeling in its promoter region containing Sp1/Sp3, YY1, and NF-kappa B binding sites.

doi: 10.4049/jimmunol.179.3.1760

Figure Lengend Snippet: FIGURE 3. Binding of nuclear factors to the OX40 promoter (125 to 26). A, Seven oligo probes for EMSA were designed and prepared. Positions of these probes are indicated by solid lines (P1 to P7). B, EMSA was performed using oligo probes shown in A and nuclear ex- tracts from nonactivated (Non) EL4 cells and activated (CD3) EL4 cells with anti-CD3 Ab.

Article Snippet: PCR primers used to amplify the OX40 basal promoter and Abs were as follows: OX40 promoter sense, TACGCCTGTGCCAAATACAC; OX40 promoter antisense, GCTTTCTGCCTTCACAGGAG;anti-p105/p50-ChIPgrade(Abcam);antiacetyl histone H4 polyclonal Ab (Upstate); and rabbit IgG (Santa Cruz Biotechnology).

Techniques: Binding Assay

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: OX40 gene expression is up-regulated by chromatin remodeling in its promoter region containing Sp1/Sp3, YY1, and NF-kappa B binding sites.

doi: 10.4049/jimmunol.179.3.1760

Figure Lengend Snippet: FIGURE 4. Binding of Sp1/Sp3 to the OX40 basal promoter. A, Com- petition assays performed using the P4 probe and a nuclear extract from EL4 cells with the indicated competitors. Complex formation with probe P4 () was inhibited with the indicated competitors. B, Competition assays performed using the P6 probe and a nuclear extract from EL4 cells with the indicated competitors.

Article Snippet: PCR primers used to amplify the OX40 basal promoter and Abs were as follows: OX40 promoter sense, TACGCCTGTGCCAAATACAC; OX40 promoter antisense, GCTTTCTGCCTTCACAGGAG;anti-p105/p50-ChIPgrade(Abcam);antiacetyl histone H4 polyclonal Ab (Upstate); and rabbit IgG (Santa Cruz Biotechnology).

Techniques: Binding Assay

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: OX40 gene expression is up-regulated by chromatin remodeling in its promoter region containing Sp1/Sp3, YY1, and NF-kappa B binding sites.

doi: 10.4049/jimmunol.179.3.1760

Figure Lengend Snippet: FIGURE 5. Sp1, Sp3, YY1, and NF-B bind to the OX40 promoter. A, Supershift EMSA was performed with a nuclear extract from EL4 cells (A–C) and indicated Abs or no Ab (). A, With P4 probe. B, With P6 probe. C, With P7 probe. D, Sp1, Sp3, YY1, and NF-B binding to probes P4, P6, and P7 was confirmed by EMSA using a nuclear extract from activated (CD3) primary total T cells. Competition assays were also per- formed using P4, P6, P7, IL-10 Sp1, and CD40 NF-B (indicated as CD40 B) competitors.

Article Snippet: PCR primers used to amplify the OX40 basal promoter and Abs were as follows: OX40 promoter sense, TACGCCTGTGCCAAATACAC; OX40 promoter antisense, GCTTTCTGCCTTCACAGGAG;anti-p105/p50-ChIPgrade(Abcam);antiacetyl histone H4 polyclonal Ab (Upstate); and rabbit IgG (Santa Cruz Biotechnology).

Techniques: Binding Assay

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: OX40 gene expression is up-regulated by chromatin remodeling in its promoter region containing Sp1/Sp3, YY1, and NF-kappa B binding sites.

doi: 10.4049/jimmunol.179.3.1760

Figure Lengend Snippet: FIGURE 6. The OX40 promoter is regulated by Sp1/Sp3 and YY1. A, Sp1 and YY1 binding sequences were mutated in Pro 2 and Pro 9 con- structs, and luciferase assay was performed. The structures of the mutant luciferase reporter plas- mids are illustrated. Mutated sites are indicated with an X. Luciferase activities generated using mutant plasmids in nonactivated (Non) and ac- tivated (CD3) EL4 cells with anti-CD3 Ab were compared with those using the wild-type plas- mid. Luciferase assays were repeated more than three times, and the activities were normalized using Renilla luciferase activity. B, Wild-type sequences and mutated sequences of Sp1A, YY1, and Sp1B sites. Mutated sequences are in- dicated in bold. C, EMSA was performed with probes P4 (P4 Wt), P6 (P6 Wt), Sp1A mutant (Sp1A KO), YY1 mutant (YY1 KO), Sp1A/ YY1 double mutant (Sp1A/YY1 KO), and mu- tant Sp1B (Sp1B KO). Complexes with Sp1, Sp3, and YY1 are indicated.

Article Snippet: PCR primers used to amplify the OX40 basal promoter and Abs were as follows: OX40 promoter sense, TACGCCTGTGCCAAATACAC; OX40 promoter antisense, GCTTTCTGCCTTCACAGGAG;anti-p105/p50-ChIPgrade(Abcam);antiacetyl histone H4 polyclonal Ab (Upstate); and rabbit IgG (Santa Cruz Biotechnology).

Techniques: Binding Assay, Luciferase, Mutagenesis, Generated, Activity Assay

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: OX40 gene expression is up-regulated by chromatin remodeling in its promoter region containing Sp1/Sp3, YY1, and NF-kappa B binding sites.

doi: 10.4049/jimmunol.179.3.1760

Figure Lengend Snippet: FIGURE 7. Contribution of NF-B in regulating OX40 promoter activ- ity. A, Structure of the mutant luciferase reporter plasmids. Mutated sites are indicated with an X. NF-B consensus sequence and mutant sequence (bold) are indicated. B, EMSA was performed with the wild-type probe (Wt) and the mutant probe (NF-B KO). C, Luciferase assays were per- formed using Wt and NF-B mutant constructs in nonactivated (Non) and activated (CD3) EL4 cells. Luciferase activities generated with the mutant construct were compared with that using the Wt construct. Luciferase assay were repeated more than three times, and the activities were normalized using Renilla luciferase activity.

Article Snippet: PCR primers used to amplify the OX40 basal promoter and Abs were as follows: OX40 promoter sense, TACGCCTGTGCCAAATACAC; OX40 promoter antisense, GCTTTCTGCCTTCACAGGAG;anti-p105/p50-ChIPgrade(Abcam);antiacetyl histone H4 polyclonal Ab (Upstate); and rabbit IgG (Santa Cruz Biotechnology).

Techniques: Mutagenesis, Luciferase, Sequencing, Construct, Generated, Activity Assay

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: OX40 gene expression is up-regulated by chromatin remodeling in its promoter region containing Sp1/Sp3, YY1, and NF-kappa B binding sites.

doi: 10.4049/jimmunol.179.3.1760

Figure Lengend Snippet: FIGURE 8. OX40 gene expression is regulated by chromatin remodel- ing in its promoter region. A, RT-PCR and ChIP assays were performed using nonactivated (0) and activated (2, 12, and 24 h) EL4 cells with anti-CD3 Ab. Chromatin fragments were immunoprecipitated with anti- acetyl histone H4 Ab (Ac-H4) or control Ab (Ig), and the precipitated OX40 promoter region was analyzed by real-time PCR. B, ChIP assay performed using anti-NF-B p50 (p50) and control Ab (Ig) using nonac- tivated (Non) and activated (CD3) EL4 and CD4CD25 T cells. C, ChIP assay performed using anti-acetyl histone H4 Ab (Ac-H4) and control Ab (Ig) using nonactivated (Non) and activated (CD3) CD4CD25 T cells and CD4CD25 Treg cells.

Article Snippet: PCR primers used to amplify the OX40 basal promoter and Abs were as follows: OX40 promoter sense, TACGCCTGTGCCAAATACAC; OX40 promoter antisense, GCTTTCTGCCTTCACAGGAG;anti-p105/p50-ChIPgrade(Abcam);antiacetyl histone H4 polyclonal Ab (Upstate); and rabbit IgG (Santa Cruz Biotechnology).

Techniques: Gene Expression, Reverse Transcription Polymerase Chain Reaction, Immunoprecipitation, Control, Real-time Polymerase Chain Reaction