|
ATCC
cbo0366 424779 424796 cbo0366 r nhei nnnnnn gctagc ttattcatcctctgccataa construction ![]() Cbo0366 424779 424796 Cbo0366 R Nhei Nnnnnn Gctagc Ttattcatcctctgccataa Construction, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cbo0366 424779 424796 cbo0366 r nhei nnnnnn gctagc ttattcatcctctgccataa construction/product/ATCC Average 90 stars, based on 1 article reviews
cbo0366 424779 424796 cbo0366 r nhei nnnnnn gctagc ttattcatcctctgccataa construction - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
ip3r 3 ![]() Ip3r 3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ip3r 3/product/Santa Cruz Biotechnology Average 88 stars, based on 1 article reviews
ip3r 3 - by Bioz Stars,
2026-02
88/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
ip 3 r sirna ![]() Ip 3 R Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ip 3 r sirna/product/Santa Cruz Biotechnology Average 88 stars, based on 1 article reviews
ip 3 r sirna - by Bioz Stars,
2026-02
88/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Applied and Environmental Microbiology
Article Title: Involvement of Two-Component System CBO0366/CBO0365 in the Cold Shock Response and Growth of Group I (Proteolytic) Clostridium botulinum ATCC 3502 at Low Temperatures
doi: 10.1128/AEM.00555-12
Figure Lengend Snippet: Oligonucleotide primers
Article Snippet: Bacterial strains and plasmids table ft1 table-wrap mode="anchored" t5 caption a7 Primer Sequence (5′→3′) a Use c Binding site in
Techniques: Sequencing, Binding Assay, Over Expression, Plasmid Preparation, Mutagenesis