Chem Impex International
poly d l lactic acid Poly D L Lactic Acid, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/poly d l lactic acid/product/Chem Impex International Average 95 stars, based on 1 article reviews
poly d l lactic acid - by Bioz Stars,
2025-06
95/100 stars
|
Buy from Supplier |
ATCC
1481 catggcccgcagcgacctcca ![]() 1481 Catggcccgcagcgacctcca, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/1481 catggcccgcagcgacctcca/product/ATCC Average 90 stars, based on 1 article reviews
1481 catggcccgcagcgacctcca - by Bioz Stars,
2025-06
90/100 stars
|
Buy from Supplier |
Image Search Results

Journal: Environmental Microbiology
Article Title: Nutrient-regulated transcriptional responses in the brown tide forming alga Aureococcus anophagefferens
doi: 10.1111/j.1462-2920.2010.02351.x
Figure Lengend Snippet: Successfully annotated tags showing greater than two-fold up-regulation in both the –N and –P libraries relative to the control library ( R -value >2). A protein ID is given for: 1) tags that map directly to the genome where a gene model exists, or 2) tags that map to an EST that overlaps with a gene model on the genome. ESTs are given for tags annotated by mapping to an EST.
Article Snippet: Additionally, three tags (1814, 2687, and 922) mapped to three different proteins involved in light harvesting, with all three tags showing similar magnitudes of up-regulation ( ). table ft1 table-wrap mode="anchored" t5 caption a7 Tag ID Sequence R -value Fold change for: Putative annotation EST Protein ID -P -N 1814 CATGATGGGCGTCACGGGCGC 15.58 4.8 3.2 Chloroplast light harvesting protein isoform 3 [Isochrysis galbana] - 59955 10695 CATGGAGGAGGTCAACCTCCT 3.940 14.6 17.6 Contains oxidoreductase domain - 72519 2687 CATGTTCGGCGAGGGCCAGAC 3.834 4.4 2.7 Plastid light harvesting protein isoform 39 (manually curated) 1 - 77828 922 CATGCCGGCGGCCGTGCCGGG 3.401 3.6 3.9 Fucoxanthin chlorophyll a/c protein, deviant [Phaeodactylum tricornutum CCAP 1055/1] 4208996:1 - 1894 CATGCTCGGGCTCGCGCACGC 3.327 7.8 3.6 Glycosyl transferase group 1 [Herpetosiphon aurantiacus ATCC 23779] 4211177:45 -
Techniques: Sequencing, Transduction