|
Sino Biological
rabbit anti h5n1 ha mab ![]() Rabbit Anti H5n1 Ha Mab, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti h5n1 ha mab/product/Sino Biological Average 94 stars, based on 1 article reviews
rabbit anti h5n1 ha mab - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
|
Chem Impex International
nitroindole ![]() Nitroindole, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nitroindole/product/Chem Impex International Average 95 stars, based on 1 article reviews
nitroindole - by Bioz Stars,
2026-02
95/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
sc 40158 vc 5 gatcc caagcgtaaagcacgaagtttcaagagaacttcgtgctttacgcttgttttt ![]() Sc 40158 Vc 5 Gatcc Caagcgtaaagcacgaagtttcaagagaacttcgtgctttacgcttgttttt, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sc 40158 vc 5 gatcc caagcgtaaagcacgaagtttcaagagaacttcgtgctttacgcttgttttt/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
sc 40158 vc 5 gatcc caagcgtaaagcacgaagtttcaagagaacttcgtgctttacgcttgttttt - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
shrna plasmids ![]() Shrna Plasmids, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrna plasmids/product/Santa Cruz Biotechnology Average 91 stars, based on 1 article reviews
shrna plasmids - by Bioz Stars,
2026-02
91/100 stars
|
Buy from Supplier |
|
Sino Biological
h5n1 hemagglutinin ha protein ![]() H5n1 Hemagglutinin Ha Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/h5n1 hemagglutinin ha protein/product/Sino Biological Average 99 stars, based on 1 article reviews
h5n1 hemagglutinin ha protein - by Bioz Stars,
2026-02
99/100 stars
|
Buy from Supplier |
|
BPS Bioscience
pkcß i (pkcbeta1), gst-tag recombinant ![]() Pkcß I (Pkcbeta1), Gst Tag Recombinant, supplied by BPS Bioscience, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pkcß i (pkcbeta1), gst-tag recombinant/product/BPS Bioscience Average 89 stars, based on 1 article reviews
pkcß i (pkcbeta1), gst-tag recombinant - by Bioz Stars,
2026-02
89/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Pathogens
Article Title: Comparative IP-MS Reveals HSPA5 and HSPA8 Interacting with Hemagglutinin Protein to Promote the Replication of Influenza A Virus
doi: 10.3390/pathogens14060535
Figure Lengend Snippet: Screening strategy for comparing host factors interacting with HA from IAV and plasmids. ( A ) IP-MS experimental workflow for identifying interactions between HA and host proteins from human HEK293T, chicken CEF and duck DEF cells. HEK293T cells were transfected with H1N1 HA plasmid or infected with H1N1; CEF and DEF cells were transfected with H5N1 HA plasmid or infected with H5N1. ( B , D , F ) HA expression was detected by RT-qPCR and Western Blotting ( C , E , G ) in HEK293T, CEF and DEF cells were transfected with plasmid or infected with IAV. The red boxes are the selected samples (plasmid, high and virus) from each species.
Article Snippet: The commercially obtained primary antibodies used in this study were as follows: mouse anti-Flag monoclonal antibody (mAb) (MA1-91878, Thermo, Waltham, MA, USA), rabbit anti-GAPDH mAb (MA1-16757, Thermo, Waltham, MA, USA), mouse anti-IgG mAb (A7028, Beyotime, Shanghai, China), rabbit anti-IgG mAb (A7016, Beyotime, Shanghai, China),
Techniques: Protein-Protein interactions, Transfection, Plasmid Preparation, Infection, Expressing, Quantitative RT-PCR, Western Blot, Virus
Journal: Pathogens
Article Title: Comparative IP-MS Reveals HSPA5 and HSPA8 Interacting with Hemagglutinin Protein to Promote the Replication of Influenza A Virus
doi: 10.3390/pathogens14060535
Figure Lengend Snippet: HSPA5 or HSPA8 interacts with IAV HA protein. ( A ) Venn diagram showing the overlap of HA-interacting host proteins identified in human, chicken and duck. ( B ) Interactions between HSPA5 or HSPA8 and H5N1 HA in DF1 cells were examined by immunoprecipitation at 48 h after co-transfection. ( C ) Colocalization of H5N1 HA and HSPA5 or HSPA8 in DF1 cells was monitored at 48 h after co-transfection. DAPI (blue) for nuclei visualization. Colocalization (yellow) between HSPA5 or HSPA8 (red) and HA (green) was observed under a Nikon confocal microscope. ( D ) The Pearson’s correlation and overlap coefficient are shown, deduced from three independent experiments. n = 3.
Article Snippet: The commercially obtained primary antibodies used in this study were as follows: mouse anti-Flag monoclonal antibody (mAb) (MA1-91878, Thermo, Waltham, MA, USA), rabbit anti-GAPDH mAb (MA1-16757, Thermo, Waltham, MA, USA), mouse anti-IgG mAb (A7028, Beyotime, Shanghai, China), rabbit anti-IgG mAb (A7016, Beyotime, Shanghai, China),
Techniques: Immunoprecipitation, Cotransfection, Microscopy
Journal: Pathogens
Article Title: Comparative IP-MS Reveals HSPA5 and HSPA8 Interacting with Hemagglutinin Protein to Promote the Replication of Influenza A Virus
doi: 10.3390/pathogens14060535
Figure Lengend Snippet: HSPA5 or HSPA8 positively regulate the IAV replication. ( A ) The knockdown of HSPA5 or HSPA8 in DF1 cells transfected with specific or scrambled shRNA for 12 h, 24 h, 36 h and 48 h was detected by RT-qPCR. n = 3, *, p < 0.1; **, p < 0.01; ***, p < 0.001. ( B ) Cell viability was determined using a CCK8 assay, with WT (wild-type) and Mock (Lipofectamine -only) DF1 cells as controls. n = 3, *, p < 0.1; **, p < 0.01. HSPA5 shRNA- ( C ), HSPA8 shRNA- ( D ) or scrambled shRNA-transfected DF1 cells and Mock (Lipofectamine only) DF1 cells were infected with H3N8 (MOI = 0.1), H9N2 (MOI = 0.1) or H5N1 (MOI = 0.1) virus. Virus titers at 12 h, 24 h, 36 h and 48 h were determined by means of TCID 50 on MDCK cells. n = 3, *, p < 0.1; **, p < 0.01.
Article Snippet: The commercially obtained primary antibodies used in this study were as follows: mouse anti-Flag monoclonal antibody (mAb) (MA1-91878, Thermo, Waltham, MA, USA), rabbit anti-GAPDH mAb (MA1-16757, Thermo, Waltham, MA, USA), mouse anti-IgG mAb (A7028, Beyotime, Shanghai, China), rabbit anti-IgG mAb (A7016, Beyotime, Shanghai, China),
Techniques: Knockdown, Transfection, shRNA, Quantitative RT-PCR, CCK-8 Assay, Infection, Virus
Journal: Pathogens
Article Title: Comparative IP-MS Reveals HSPA5 and HSPA8 Interacting with Hemagglutinin Protein to Promote the Replication of Influenza A Virus
doi: 10.3390/pathogens14060535
Figure Lengend Snippet: HSPA8 or HSPA5 promotes IAV attachment and internalization. HSPA5 shRNA-, HSPA8 shRNA- or scrambled shRNA-transfected DF1 cells were infected with CK/0513 virus (MOI = 1) for 2 h at 4 °C or transferred to 37 °C for 30 min after 2 h. ( A ) Virion attachment and endocytosis were observed by electron microscope. ( B ) NP copies were detected by RT-qPCR. n = 3, **, p < 0.01; ***, p < 0.001. ( C ) The colocalization of H5N1 HA and HSPA5 or HSPA8 in DF1 cells was monitored at 48 h after co-transfection without permeabilization. Colocalization (yellow) between HSPA5 or HSPA8 (red) and HA (green) was observed under a Nikon confocal microscope. ( D ) The Pearson’s correlation and overlap coefficient from three independent experiments were analyzed. n = 3.
Article Snippet: The commercially obtained primary antibodies used in this study were as follows: mouse anti-Flag monoclonal antibody (mAb) (MA1-91878, Thermo, Waltham, MA, USA), rabbit anti-GAPDH mAb (MA1-16757, Thermo, Waltham, MA, USA), mouse anti-IgG mAb (A7028, Beyotime, Shanghai, China), rabbit anti-IgG mAb (A7016, Beyotime, Shanghai, China),
Techniques: shRNA, Transfection, Infection, Virus, Microscopy, Quantitative RT-PCR, Cotransfection