|
Addgene inc
paav camkiia 0 4 pdco mscarlet wpre Paav Camkiia 0 4 Pdco Mscarlet Wpre, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paav camkiia 0 4 pdco mscarlet wpre/product/Addgene inc Average 92 stars, based on 1 article reviews
paav camkiia 0 4 pdco mscarlet wpre - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
paav hsyn pdco mscarlet wpre Paav Hsyn Pdco Mscarlet Wpre, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paav hsyn pdco mscarlet wpre/product/Addgene inc Average 93 stars, based on 1 article reviews
paav hsyn pdco mscarlet wpre - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pcdna6 n3xflag ctnnb1 plasmid Pcdna6 N3xflag Ctnnb1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcdna6 n3xflag ctnnb1 plasmid/product/Addgene inc Average 93 stars, based on 1 article reviews
pcdna6 n3xflag ctnnb1 plasmid - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pegfp c3 plk4 s305a 3xflag plasmid Pegfp C3 Plk4 S305a 3xflag Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pegfp c3 plk4 s305a 3xflag plasmid/product/Addgene inc Average 92 stars, based on 1 article reviews
pegfp c3 plk4 s305a 3xflag plasmid - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pwallium dcas9 vpr Pwallium Dcas9 Vpr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pwallium dcas9 vpr/product/Addgene inc Average 93 stars, based on 1 article reviews
pwallium dcas9 vpr - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
paavs1 tet3g foxg1v3ns tev flag strep cloning backbone Paavs1 Tet3g Foxg1v3ns Tev Flag Strep Cloning Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paavs1 tet3g foxg1v3ns tev flag strep cloning backbone/product/Addgene inc Average 93 stars, based on 1 article reviews
paavs1 tet3g foxg1v3ns tev flag strep cloning backbone - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pdonor223 vector Pdonor223 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pdonor223 vector/product/Addgene inc Average 92 stars, based on 1 article reviews
pdonor223 vector - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
plv 3xflag Plv 3xflag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plv 3xflag/product/Addgene inc Average 93 stars, based on 1 article reviews
plv 3xflag - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
α synuclein α Synuclein, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/α synuclein/product/Addgene inc Average 92 stars, based on 1 article reviews
α synuclein - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
3xflag ifit5 addgene addgene plasmid ![]() 3xflag Ifit5 Addgene Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/3xflag ifit5 addgene addgene plasmid/product/Addgene inc Average 92 stars, based on 1 article reviews
3xflag ifit5 addgene addgene plasmid - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
designer drugs dreadd ![]() Designer Drugs Dreadd, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/designer drugs dreadd/product/Addgene inc Average 93 stars, based on 1 article reviews
designer drugs dreadd - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
xbp1 stalling sequence ![]() Xbp1 Stalling Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/xbp1 stalling sequence/product/Addgene inc Average 91 stars, based on 1 article reviews
xbp1 stalling sequence - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Developmental cell
Article Title: Usp25-Erlin1/2 activity limits cholesterol flux to restrict virus infection.
doi: 10.1016/j.devcel.2023.08.013
Figure Lengend Snippet: Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, FLAG-IFIT5, influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.
Article Snippet: Vero ATCC CCL-81 Oligonucleotides GGCACCAAGGCACATAACGG (sgRNA) This study N/A GAGACTGAAAGATTACCTCA (sgRNA) This study N/A AGCAAAAGCAGG (uni-12) This study N/A AGTAGAAACAAGG (uni-13) This study N/A GACCAATCCTGTCACCTCTGA (M Gene-Forward) This study N/A AGGGCATTTTGGACAAAGCGTCTA (M Gene-Reverse) This study N/A CACCATTGGCAATGAGCGGTTC (b-actin-Forward) This study N/A AGGTCTTTGCGGATGTCCACGT (b-actin-Reverse) This study N/A Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) V2.0 Addgene Addgene plasmid #62988 Usp25-PX459 This study N/A Flag-tagged-Usp25 Xu et al.49 N/A Flag-tagged-Usp25 (C178S) Xu et al.49 N/A Myc-tagged- RIG I te Velthuis et al.50 N/A Flag-tagged-M2 This study N/A 3xFlag IFIT1 Addgene Addgene plasmid #53554
Techniques: Infection, Immunoprecipitation, Mass Spectrometry, Isolation, Expressing, FLAG-tag, Western Blot, Control, SDS Page, Autoradiography, Transfection, Mutagenesis, Cell Culture, Quantitation Assay