3xflag Search Results


92
Addgene inc paav camkiia 0 4 pdco mscarlet wpre
Paav Camkiia 0 4 Pdco Mscarlet Wpre, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paav camkiia 0 4 pdco mscarlet wpre/product/Addgene inc
Average 92 stars, based on 1 article reviews
paav camkiia 0 4 pdco mscarlet wpre - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
Addgene inc paav hsyn pdco mscarlet wpre
Paav Hsyn Pdco Mscarlet Wpre, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paav hsyn pdco mscarlet wpre/product/Addgene inc
Average 93 stars, based on 1 article reviews
paav hsyn pdco mscarlet wpre - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc pcdna6 n3xflag ctnnb1 plasmid
Pcdna6 N3xflag Ctnnb1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna6 n3xflag ctnnb1 plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcdna6 n3xflag ctnnb1 plasmid - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
Addgene inc pegfp c3 plk4 s305a 3xflag plasmid
Pegfp C3 Plk4 S305a 3xflag Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pegfp c3 plk4 s305a 3xflag plasmid/product/Addgene inc
Average 92 stars, based on 1 article reviews
pegfp c3 plk4 s305a 3xflag plasmid - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
Addgene inc pwallium dcas9 vpr
Pwallium Dcas9 Vpr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pwallium dcas9 vpr/product/Addgene inc
Average 93 stars, based on 1 article reviews
pwallium dcas9 vpr - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc paavs1 tet3g foxg1v3ns tev flag strep cloning backbone
Paavs1 Tet3g Foxg1v3ns Tev Flag Strep Cloning Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paavs1 tet3g foxg1v3ns tev flag strep cloning backbone/product/Addgene inc
Average 93 stars, based on 1 article reviews
paavs1 tet3g foxg1v3ns tev flag strep cloning backbone - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
Addgene inc pdonor223 vector
Pdonor223 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pdonor223 vector/product/Addgene inc
Average 92 stars, based on 1 article reviews
pdonor223 vector - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
Addgene inc plv 3xflag
Plv 3xflag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plv 3xflag/product/Addgene inc
Average 93 stars, based on 1 article reviews
plv 3xflag - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
Addgene inc α synuclein
α Synuclein, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/α synuclein/product/Addgene inc
Average 92 stars, based on 1 article reviews
α synuclein - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

92
Addgene inc 3xflag ifit5 addgene addgene plasmid
Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, <t>FLAG-IFIT5,</t> influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.
3xflag Ifit5 Addgene Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/3xflag ifit5 addgene addgene plasmid/product/Addgene inc
Average 92 stars, based on 1 article reviews
3xflag ifit5 addgene addgene plasmid - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
Addgene inc designer drugs dreadd
Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, <t>FLAG-IFIT5,</t> influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.
Designer Drugs Dreadd, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/designer drugs dreadd/product/Addgene inc
Average 93 stars, based on 1 article reviews
designer drugs dreadd - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

91
Addgene inc xbp1 stalling sequence
Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, <t>FLAG-IFIT5,</t> influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.
Xbp1 Stalling Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xbp1 stalling sequence/product/Addgene inc
Average 91 stars, based on 1 article reviews
xbp1 stalling sequence - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

Image Search Results


Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, FLAG-IFIT5, influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.

Journal: Developmental cell

Article Title: Usp25-Erlin1/2 activity limits cholesterol flux to restrict virus infection.

doi: 10.1016/j.devcel.2023.08.013

Figure Lengend Snippet: Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, FLAG-IFIT5, influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.

Article Snippet: Vero ATCC CCL-81 Oligonucleotides GGCACCAAGGCACATAACGG (sgRNA) This study N/A GAGACTGAAAGATTACCTCA (sgRNA) This study N/A AGCAAAAGCAGG (uni-12) This study N/A AGTAGAAACAAGG (uni-13) This study N/A GACCAATCCTGTCACCTCTGA (M Gene-Forward) This study N/A AGGGCATTTTGGACAAAGCGTCTA (M Gene-Reverse) This study N/A CACCATTGGCAATGAGCGGTTC (b-actin-Forward) This study N/A AGGTCTTTGCGGATGTCCACGT (b-actin-Reverse) This study N/A Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) V2.0 Addgene Addgene plasmid #62988 Usp25-PX459 This study N/A Flag-tagged-Usp25 Xu et al.49 N/A Flag-tagged-Usp25 (C178S) Xu et al.49 N/A Myc-tagged- RIG I te Velthuis et al.50 N/A Flag-tagged-M2 This study N/A 3xFlag IFIT1 Addgene Addgene plasmid #53554 3xFlag IFIT5 Addgene Addgene plasmid #53556 HA-Ubiquitin Addgene Addgene plasmid #18712 HA-Ubiquitin-K6 Addgene Addgene plasmid #22900 HA-Ubiquitin-K11 Addgene Addgene plasmid #22901 HA-Ubiquitin-K27 Addgene Addgene plasmid #22902 HA-Ubiquitin-K29 Addgene Addgene plasmid #22903 HA-Ubiquitin-K33 Addgene Addgene plasmid #17607 HA-Ubiquitin-K48 Addgene Addgene plasmid #17605 HA-Ubiquitin-K63 Addgene Addgene plasmid #17606 mCherry-GFP-LC3 Addgene Addgene plasmid #110060 Myc-tagged-SMURF1 Addgene Addgene plasmid #13676 Flag-tagged-SMURF1 (C699A) Addgene Addgene plasmid #11753 VSV-G Addgene Addgene plasmid #8454 Software and Algorithms Prism 8.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ ImageJ NIH https://imagej.net/ImageJ ZEN confocal software Zeiss https://www.zeiss.com/microscopy/int/ products/microscope-software/zen.html FlowJo Flowjo https://www.flowjo.com/solutions/flowjo/ downloads Legendplex v8.0 Biolegend https://www.biolegend.com/en-us/ legendplex Ingenuity Pathway Analysis software QIAGEN https://digitalinsights.qiagen.com/ products-overview/discovery-insightsportfolio/analysis-and-visualization/ qiagen-ipa/ e3 Developmental Cell 58, 2495–2509.e1–e6, November 20, 2023

Techniques: Infection, Immunoprecipitation, Mass Spectrometry, Isolation, Expressing, FLAG-tag, Western Blot, Control, SDS Page, Autoradiography, Transfection, Mutagenesis, Cell Culture, Quantitation Assay