30320 Search Results


arabidopsis thaliana grf18u  (ATCC)
90
ATCC arabidopsis thaliana grf18u
Example of products and strains of S. cerevisiae
Arabidopsis Thaliana Grf18u, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/arabidopsis thaliana grf18u/product/ATCC
Average 90 stars, based on 1 article reviews
arabidopsis thaliana grf18u - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
plko 1 slug shrna2  (Addgene inc)
90
Addgene inc plko 1 slug shrna2
A: Western blot analysis of Slug expression in PC-3 cell lines harboring control shRNA or Slug shRNAs. PC-3 cells were infected with lentiviruses expressing control shRNA, Slug shRNA1, or Slug <t>shRNA2,</t> and selected with puromycin (1 µg/ ml). Proteins were extracted from the stable lines and analyzed by Western blot with anti-Slug antibody and anti-β-actin antibody.
Plko 1 Slug Shrna2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 slug shrna2/product/Addgene inc
Average 90 stars, based on 1 article reviews
plko 1 slug shrna2 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
custom-made zenith device 30320-mm scallop, 8-mm carotid fenestration, and 38–343150 tapered tube  (Cook Medical Inc)
90
Cook Medical Inc custom-made zenith device 30320-mm scallop, 8-mm carotid fenestration, and 38–343150 tapered tube
A: Western blot analysis of Slug expression in PC-3 cell lines harboring control shRNA or Slug shRNAs. PC-3 cells were infected with lentiviruses expressing control shRNA, Slug shRNA1, or Slug <t>shRNA2,</t> and selected with puromycin (1 µg/ ml). Proteins were extracted from the stable lines and analyzed by Western blot with anti-Slug antibody and anti-β-actin antibody.
Custom Made Zenith Device 30320 Mm Scallop, 8 Mm Carotid Fenestration, And 38–343150 Tapered Tube, supplied by Cook Medical Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom-made zenith device 30320-mm scallop, 8-mm carotid fenestration, and 38–343150 tapered tube/product/Cook Medical Inc
Average 90 stars, based on 1 article reviews
custom-made zenith device 30320-mm scallop, 8-mm carotid fenestration, and 38–343150 tapered tube - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


Example of products and strains of S. cerevisiae

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: Metabolic engineering of Saccharomyces cerevisiae : a key cell factory platform for future biorefineries

doi: 10.1007/s00018-012-0945-1

Figure Lengend Snippet: Example of products and strains of S. cerevisiae

Article Snippet: Without supplement of fatty acids, EPA/ARA were produced CEN.PK113-5D ( MATa MAL2 - 8c SUC2 ura3 - 52 ) [ 35 ] Farnese and geranyl geraniol ERG9 deletion and overexpression of two isozymes of HMGCoA reductases ( HMG1 and HMG2 ) was implemented in a host strain with overexpression of diverse FPP synthases and GGPP synthases FL100 ( MATa , ATCC: 28383) [ 36 ] l -ascorbic acid About 100 mg of l -ascorbic acid per liter was produced by overexpression of d -arabionono-1,4-lactose oxidase from S. cerevisiae and l -galactose dehydrogenase from Arabidopsis thaliana GRF18U (MATα his3 leu2 ura3; NRRL Y-30320).

Techniques: Over Expression, Amplification, Produced, Activity Assay, Polymer, Expressing, Mutagenesis, Construct, Isolation, Concentration Assay, Gene Expression, Knock-Out, In Silico, Functional Assay, Disruption, Virus, Molecular Weight, Glycoproteomics

A: Western blot analysis of Slug expression in PC-3 cell lines harboring control shRNA or Slug shRNAs. PC-3 cells were infected with lentiviruses expressing control shRNA, Slug shRNA1, or Slug shRNA2, and selected with puromycin (1 µg/ ml). Proteins were extracted from the stable lines and analyzed by Western blot with anti-Slug antibody and anti-β-actin antibody.

Journal:

Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression

doi: 10.1002/pros.21213

Figure Lengend Snippet: A: Western blot analysis of Slug expression in PC-3 cell lines harboring control shRNA or Slug shRNAs. PC-3 cells were infected with lentiviruses expressing control shRNA, Slug shRNA1, or Slug shRNA2, and selected with puromycin (1 µg/ ml). Proteins were extracted from the stable lines and analyzed by Western blot with anti-Slug antibody and anti-β-actin antibody.

Article Snippet: Plasmids The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA).

Techniques: Western Blot, Expressing, Control, shRNA, Infection