3.5.1 beta software Search Results


protein kinase kinase kinase kinase 5  (Sino Biological)
93
Sino Biological protein kinase kinase kinase kinase 5
Characterization of 3CL pro cleavage specificity (A and B) MALDI-TOF-MS spectra of synthetic peptides spanning P4–P4’ of protein cleavage sites after incubation with 3CL pro (1:20 molar ratio, E:S). Product generation (red) and substrate consumption (black) were calculated as the peak area normalized to the total peak area in the spectrum. Apparent (app) k cat / K M values for 1 μM 3CL pro to convert 50% of substrate in 5, 15, 30, 60, 120 or 240 min are listed alongside bins of 4 peptides that share similar kinetic values arranged on a row-by-row basis. P4–P4’ sequence alignment using the Shapley color scale. Green protein names had cut sites identified by Edman sequencing of recombinant substrate digests. Boxed peptides, no cleavage. (C–I) Structures of the highest-ranked of 50,000 models of the active site of 3CL pro protomer 1 (PDB: 6XHM ) docked with P4–P4’ peptides from six 3CL pro substrates exhibiting a range of app k cat / K M values (circled in B). (C) 3CL pro dimer. Protomer 1, gray surface or green ribbons with catalytic Cys 145 shown. Protomer 2, orange surface with Ser 1 shown. Docking models with P4–P4’ peptide of: (C and D) RPAP1 (I_sc = −31.7), (E) IMA4 (I_sc = −30.6), (F) PTBP1 (I_sc = −31.7), (G) RBM15 (I_sc = −39.65), (H) <t>MAP4K5</t> (I_sc = −28.1), and (I) CREB1 (I_sc = −30.3). Blue and red sticks, P and P’ amino acid residues, respectively. Yellow dashed sticks, hydrogen-bonds. See also <xref ref-type=Figure S2 . " width="250" height="auto" />
Protein Kinase Kinase Kinase Kinase 5, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/pmc08501228-602-38-53?v=Sino+Biological
Average 93 stars, based on 1 article reviews
protein kinase kinase kinase kinase 5 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier
metagenomeseq package  (RStudio)
90
RStudio metagenomeseq package
Characterization of 3CL pro cleavage specificity (A and B) MALDI-TOF-MS spectra of synthetic peptides spanning P4–P4’ of protein cleavage sites after incubation with 3CL pro (1:20 molar ratio, E:S). Product generation (red) and substrate consumption (black) were calculated as the peak area normalized to the total peak area in the spectrum. Apparent (app) k cat / K M values for 1 μM 3CL pro to convert 50% of substrate in 5, 15, 30, 60, 120 or 240 min are listed alongside bins of 4 peptides that share similar kinetic values arranged on a row-by-row basis. P4–P4’ sequence alignment using the Shapley color scale. Green protein names had cut sites identified by Edman sequencing of recombinant substrate digests. Boxed peptides, no cleavage. (C–I) Structures of the highest-ranked of 50,000 models of the active site of 3CL pro protomer 1 (PDB: 6XHM ) docked with P4–P4’ peptides from six 3CL pro substrates exhibiting a range of app k cat / K M values (circled in B). (C) 3CL pro dimer. Protomer 1, gray surface or green ribbons with catalytic Cys 145 shown. Protomer 2, orange surface with Ser 1 shown. Docking models with P4–P4’ peptide of: (C and D) RPAP1 (I_sc = −31.7), (E) IMA4 (I_sc = −30.6), (F) PTBP1 (I_sc = −31.7), (G) RBM15 (I_sc = −39.65), (H) <t>MAP4K5</t> (I_sc = −28.1), and (I) CREB1 (I_sc = −30.3). Blue and red sticks, P and P’ amino acid residues, respectively. Yellow dashed sticks, hydrogen-bonds. See also <xref ref-type=Figure S2 . " width="250" height="auto" />
Metagenomeseq Package, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/pmc08237351-162-16-22?v=RStudio
Average 90 stars, based on 1 article reviews
metagenomeseq package - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
flir sc325  (FLIR Systems)
90
FLIR Systems flir sc325
Characterization of 3CL pro cleavage specificity (A and B) MALDI-TOF-MS spectra of synthetic peptides spanning P4–P4’ of protein cleavage sites after incubation with 3CL pro (1:20 molar ratio, E:S). Product generation (red) and substrate consumption (black) were calculated as the peak area normalized to the total peak area in the spectrum. Apparent (app) k cat / K M values for 1 μM 3CL pro to convert 50% of substrate in 5, 15, 30, 60, 120 or 240 min are listed alongside bins of 4 peptides that share similar kinetic values arranged on a row-by-row basis. P4–P4’ sequence alignment using the Shapley color scale. Green protein names had cut sites identified by Edman sequencing of recombinant substrate digests. Boxed peptides, no cleavage. (C–I) Structures of the highest-ranked of 50,000 models of the active site of 3CL pro protomer 1 (PDB: 6XHM ) docked with P4–P4’ peptides from six 3CL pro substrates exhibiting a range of app k cat / K M values (circled in B). (C) 3CL pro dimer. Protomer 1, gray surface or green ribbons with catalytic Cys 145 shown. Protomer 2, orange surface with Ser 1 shown. Docking models with P4–P4’ peptide of: (C and D) RPAP1 (I_sc = −31.7), (E) IMA4 (I_sc = −30.6), (F) PTBP1 (I_sc = −31.7), (G) RBM15 (I_sc = −39.65), (H) <t>MAP4K5</t> (I_sc = −28.1), and (I) CREB1 (I_sc = −30.3). Blue and red sticks, P and P’ amino acid residues, respectively. Yellow dashed sticks, hydrogen-bonds. See also <xref ref-type=Figure S2 . " width="250" height="auto" />
Flir Sc325, supplied by FLIR Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/pm31430467-113-57-60?v=FLIR+Systems
Average 90 stars, based on 1 article reviews
flir sc325 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
human bid peptide  (GenScript corporation)
90
GenScript corporation human bid peptide
Characterization of 3CL pro cleavage specificity (A and B) MALDI-TOF-MS spectra of synthetic peptides spanning P4–P4’ of protein cleavage sites after incubation with 3CL pro (1:20 molar ratio, E:S). Product generation (red) and substrate consumption (black) were calculated as the peak area normalized to the total peak area in the spectrum. Apparent (app) k cat / K M values for 1 μM 3CL pro to convert 50% of substrate in 5, 15, 30, 60, 120 or 240 min are listed alongside bins of 4 peptides that share similar kinetic values arranged on a row-by-row basis. P4–P4’ sequence alignment using the Shapley color scale. Green protein names had cut sites identified by Edman sequencing of recombinant substrate digests. Boxed peptides, no cleavage. (C–I) Structures of the highest-ranked of 50,000 models of the active site of 3CL pro protomer 1 (PDB: 6XHM ) docked with P4–P4’ peptides from six 3CL pro substrates exhibiting a range of app k cat / K M values (circled in B). (C) 3CL pro dimer. Protomer 1, gray surface or green ribbons with catalytic Cys 145 shown. Protomer 2, orange surface with Ser 1 shown. Docking models with P4–P4’ peptide of: (C and D) RPAP1 (I_sc = −31.7), (E) IMA4 (I_sc = −30.6), (F) PTBP1 (I_sc = −31.7), (G) RBM15 (I_sc = −39.65), (H) <t>MAP4K5</t> (I_sc = −28.1), and (I) CREB1 (I_sc = −30.3). Blue and red sticks, P and P’ amino acid residues, respectively. Yellow dashed sticks, hydrogen-bonds. See also <xref ref-type=Figure S2 . " width="250" height="auto" />
Human Bid Peptide, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/10__7554_slash_elife__67336-314-37-42?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
human bid peptide - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
human noxa peptide  (GenScript corporation)
90
GenScript corporation human noxa peptide
Characterization of 3CL pro cleavage specificity (A and B) MALDI-TOF-MS spectra of synthetic peptides spanning P4–P4’ of protein cleavage sites after incubation with 3CL pro (1:20 molar ratio, E:S). Product generation (red) and substrate consumption (black) were calculated as the peak area normalized to the total peak area in the spectrum. Apparent (app) k cat / K M values for 1 μM 3CL pro to convert 50% of substrate in 5, 15, 30, 60, 120 or 240 min are listed alongside bins of 4 peptides that share similar kinetic values arranged on a row-by-row basis. P4–P4’ sequence alignment using the Shapley color scale. Green protein names had cut sites identified by Edman sequencing of recombinant substrate digests. Boxed peptides, no cleavage. (C–I) Structures of the highest-ranked of 50,000 models of the active site of 3CL pro protomer 1 (PDB: 6XHM ) docked with P4–P4’ peptides from six 3CL pro substrates exhibiting a range of app k cat / K M values (circled in B). (C) 3CL pro dimer. Protomer 1, gray surface or green ribbons with catalytic Cys 145 shown. Protomer 2, orange surface with Ser 1 shown. Docking models with P4–P4’ peptide of: (C and D) RPAP1 (I_sc = −31.7), (E) IMA4 (I_sc = −30.6), (F) PTBP1 (I_sc = −31.7), (G) RBM15 (I_sc = −39.65), (H) <t>MAP4K5</t> (I_sc = −28.1), and (I) CREB1 (I_sc = −30.3). Blue and red sticks, P and P’ amino acid residues, respectively. Yellow dashed sticks, hydrogen-bonds. See also <xref ref-type=Figure S2 . " width="250" height="auto" />
Human Noxa Peptide, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/10__7554_slash_elife__67336-314-50-60?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
human noxa peptide - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
psmatch2 stata ado 352 program  (STATA Corporation)
99
STATA Corporation psmatch2 stata ado 352 program
Characterization of 3CL pro cleavage specificity (A and B) MALDI-TOF-MS spectra of synthetic peptides spanning P4–P4’ of protein cleavage sites after incubation with 3CL pro (1:20 molar ratio, E:S). Product generation (red) and substrate consumption (black) were calculated as the peak area normalized to the total peak area in the spectrum. Apparent (app) k cat / K M values for 1 μM 3CL pro to convert 50% of substrate in 5, 15, 30, 60, 120 or 240 min are listed alongside bins of 4 peptides that share similar kinetic values arranged on a row-by-row basis. P4–P4’ sequence alignment using the Shapley color scale. Green protein names had cut sites identified by Edman sequencing of recombinant substrate digests. Boxed peptides, no cleavage. (C–I) Structures of the highest-ranked of 50,000 models of the active site of 3CL pro protomer 1 (PDB: 6XHM ) docked with P4–P4’ peptides from six 3CL pro substrates exhibiting a range of app k cat / K M values (circled in B). (C) 3CL pro dimer. Protomer 1, gray surface or green ribbons with catalytic Cys 145 shown. Protomer 2, orange surface with Ser 1 shown. Docking models with P4–P4’ peptide of: (C and D) RPAP1 (I_sc = −31.7), (E) IMA4 (I_sc = −30.6), (F) PTBP1 (I_sc = −31.7), (G) RBM15 (I_sc = −39.65), (H) <t>MAP4K5</t> (I_sc = −28.1), and (I) CREB1 (I_sc = −30.3). Blue and red sticks, P and P’ amino acid residues, respectively. Yellow dashed sticks, hydrogen-bonds. See also <xref ref-type=Figure S2 . " width="250" height="auto" />
Psmatch2 Stata Ado 352 Program, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/ppr0939714-157-93-94?v=STATA+Corporation
Average 99 stars, based on 1 article reviews
psmatch2 stata ado 352 program - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier
r studio version 3.5.1  (RStudio)
90
RStudio r studio version 3.5.1
Characterization of 3CL pro cleavage specificity (A and B) MALDI-TOF-MS spectra of synthetic peptides spanning P4–P4’ of protein cleavage sites after incubation with 3CL pro (1:20 molar ratio, E:S). Product generation (red) and substrate consumption (black) were calculated as the peak area normalized to the total peak area in the spectrum. Apparent (app) k cat / K M values for 1 μM 3CL pro to convert 50% of substrate in 5, 15, 30, 60, 120 or 240 min are listed alongside bins of 4 peptides that share similar kinetic values arranged on a row-by-row basis. P4–P4’ sequence alignment using the Shapley color scale. Green protein names had cut sites identified by Edman sequencing of recombinant substrate digests. Boxed peptides, no cleavage. (C–I) Structures of the highest-ranked of 50,000 models of the active site of 3CL pro protomer 1 (PDB: 6XHM ) docked with P4–P4’ peptides from six 3CL pro substrates exhibiting a range of app k cat / K M values (circled in B). (C) 3CL pro dimer. Protomer 1, gray surface or green ribbons with catalytic Cys 145 shown. Protomer 2, orange surface with Ser 1 shown. Docking models with P4–P4’ peptide of: (C and D) RPAP1 (I_sc = −31.7), (E) IMA4 (I_sc = −30.6), (F) PTBP1 (I_sc = −31.7), (G) RBM15 (I_sc = −39.65), (H) <t>MAP4K5</t> (I_sc = −28.1), and (I) CREB1 (I_sc = −30.3). Blue and red sticks, P and P’ amino acid residues, respectively. Yellow dashed sticks, hydrogen-bonds. See also <xref ref-type=Figure S2 . " width="250" height="auto" />
R Studio Version 3.5.1, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/pmc07324317__mmc4-346-192-193?v=RStudio
Average 90 stars, based on 1 article reviews
r studio version 3.5.1 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
prism 7.00  (GraphPad Software Inc)
90
GraphPad Software Inc prism 7.00
Characterization of 3CL pro cleavage specificity (A and B) MALDI-TOF-MS spectra of synthetic peptides spanning P4–P4’ of protein cleavage sites after incubation with 3CL pro (1:20 molar ratio, E:S). Product generation (red) and substrate consumption (black) were calculated as the peak area normalized to the total peak area in the spectrum. Apparent (app) k cat / K M values for 1 μM 3CL pro to convert 50% of substrate in 5, 15, 30, 60, 120 or 240 min are listed alongside bins of 4 peptides that share similar kinetic values arranged on a row-by-row basis. P4–P4’ sequence alignment using the Shapley color scale. Green protein names had cut sites identified by Edman sequencing of recombinant substrate digests. Boxed peptides, no cleavage. (C–I) Structures of the highest-ranked of 50,000 models of the active site of 3CL pro protomer 1 (PDB: 6XHM ) docked with P4–P4’ peptides from six 3CL pro substrates exhibiting a range of app k cat / K M values (circled in B). (C) 3CL pro dimer. Protomer 1, gray surface or green ribbons with catalytic Cys 145 shown. Protomer 2, orange surface with Ser 1 shown. Docking models with P4–P4’ peptide of: (C and D) RPAP1 (I_sc = −31.7), (E) IMA4 (I_sc = −30.6), (F) PTBP1 (I_sc = −31.7), (G) RBM15 (I_sc = −39.65), (H) <t>MAP4K5</t> (I_sc = −28.1), and (I) CREB1 (I_sc = −30.3). Blue and red sticks, P and P’ amino acid residues, respectively. Yellow dashed sticks, hydrogen-bonds. See also <xref ref-type=Figure S2 . " width="250" height="auto" />
Prism 7.00, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/pm36044858-238-140-141?v=GraphPad+Software+Inc
Average 90 stars, based on 1 article reviews
prism 7.00 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
antibodies against eif2b2  (ProSci Incorporated)
90
ProSci Incorporated antibodies against eif2b2
( A-D ) Depiction of zebrafish eif2b subunits exon structure and the location and nucleotide change for each mutant. ( A ) eif2b1 harbors a T/A transversion resulting in an early stop in exon 8. ( B ) <t>eif2b2</t> has a G/A transition in exon 5, mutating an essential splice site. ( C ) eif2b4 has a G/A transition in exon 12 mutating an essential splice site. ( D ) eif2b5 exon one was targeted for mutagenesis using a gRNA (red). Six distinct alleles were recovered (described in text). ( E ) Chromatograms of cDNA confirm presence of predicted mutations for eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 . ( F ) eif2b5 zc103/zc103 mutants survive until adulthood in Mendelian ratios, but show grow defects compared to their heterozygous and wild-type siblings. ( G ) Adult eif2b5 zc103/zc103 lengths are significantly shorter compared to their wild-type and heterozygous siblings. ( H ) Bright-field (BF) images of 6 dpf eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 larva. eif2b2 sa17223/sa17223 and eif2b5 zc102/zc102 have no swim bladder (arrowhead) and a small head. ( I ) Kaplan-Meyer survival curves from an eif2b2 sa17223/+ heterozygous in-cross shows 1% (n = 3) homozygote survival at 10 dpf (total n = 302); however no homozygotes live past 2 weeks of age. ( J ) Kaplan-Meyer survival curves from an eif2b5 zc102/+ heterozygous in-cross shows that all homozygotes were dead by 10 dpf (total n = 62). ( K ) Kaplan-Meyer survival curves from an eif2b5 zc103/+ heterozygous in-cross show no mortality of homozygotes. ( L ) Motor swimming analysis shows impaired swimming behavior in mutants. Distance moved, time spent moving, and velocity, for wild-type controls, and eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 mutants, at 5, 6, and 7 dpf. Mean shown with 95% confidence intervals. Figure 2—source data 1. Quantification of lengths. Figure 2—source data 2. Quantification of behavior results. Figure 2—source data 3. Quantification of behavior results of eif2b4 sa17367/sa17367 allele. Figure 2—source data 4. qRT-PCR for ISR transcripts for eif2b4 sa17367/sa17367 allele. Figure 2—source data 5. Survival quantification for eif2b4 sa17367/sa17367 allele. Figure 2—source data 6. Survival quantification for eif2b5 zc103/zc103 allele.
Antibodies Against Eif2b2, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/pmc07752137-105-7-23?v=ProSci+Incorporated
Average 90 stars, based on 1 article reviews
antibodies against eif2b2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
graphpad prism 8.0.2  (GraphPad Software Inc)
90
GraphPad Software Inc graphpad prism 8.0.2
( A-D ) Depiction of zebrafish eif2b subunits exon structure and the location and nucleotide change for each mutant. ( A ) eif2b1 harbors a T/A transversion resulting in an early stop in exon 8. ( B ) <t>eif2b2</t> has a G/A transition in exon 5, mutating an essential splice site. ( C ) eif2b4 has a G/A transition in exon 12 mutating an essential splice site. ( D ) eif2b5 exon one was targeted for mutagenesis using a gRNA (red). Six distinct alleles were recovered (described in text). ( E ) Chromatograms of cDNA confirm presence of predicted mutations for eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 . ( F ) eif2b5 zc103/zc103 mutants survive until adulthood in Mendelian ratios, but show grow defects compared to their heterozygous and wild-type siblings. ( G ) Adult eif2b5 zc103/zc103 lengths are significantly shorter compared to their wild-type and heterozygous siblings. ( H ) Bright-field (BF) images of 6 dpf eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 larva. eif2b2 sa17223/sa17223 and eif2b5 zc102/zc102 have no swim bladder (arrowhead) and a small head. ( I ) Kaplan-Meyer survival curves from an eif2b2 sa17223/+ heterozygous in-cross shows 1% (n = 3) homozygote survival at 10 dpf (total n = 302); however no homozygotes live past 2 weeks of age. ( J ) Kaplan-Meyer survival curves from an eif2b5 zc102/+ heterozygous in-cross shows that all homozygotes were dead by 10 dpf (total n = 62). ( K ) Kaplan-Meyer survival curves from an eif2b5 zc103/+ heterozygous in-cross show no mortality of homozygotes. ( L ) Motor swimming analysis shows impaired swimming behavior in mutants. Distance moved, time spent moving, and velocity, for wild-type controls, and eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 mutants, at 5, 6, and 7 dpf. Mean shown with 95% confidence intervals. Figure 2—source data 1. Quantification of lengths. Figure 2—source data 2. Quantification of behavior results. Figure 2—source data 3. Quantification of behavior results of eif2b4 sa17367/sa17367 allele. Figure 2—source data 4. qRT-PCR for ISR transcripts for eif2b4 sa17367/sa17367 allele. Figure 2—source data 5. Survival quantification for eif2b4 sa17367/sa17367 allele. Figure 2—source data 6. Survival quantification for eif2b5 zc103/zc103 allele.
Graphpad Prism 8.0.2, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/pmc07324317__mmc4-346-171-201?v=GraphPad+Software+Inc
Average 90 stars, based on 1 article reviews
graphpad prism 8.0.2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
resource source identifier 186 hactb qf caccattggcaatgagcggttc origene nm 001101 187 hactb qr  (OriGene)
94
OriGene resource source identifier 186 hactb qf caccattggcaatgagcggttc origene nm 001101 187 hactb qr
( A-D ) Depiction of zebrafish eif2b subunits exon structure and the location and nucleotide change for each mutant. ( A ) eif2b1 harbors a T/A transversion resulting in an early stop in exon 8. ( B ) <t>eif2b2</t> has a G/A transition in exon 5, mutating an essential splice site. ( C ) eif2b4 has a G/A transition in exon 12 mutating an essential splice site. ( D ) eif2b5 exon one was targeted for mutagenesis using a gRNA (red). Six distinct alleles were recovered (described in text). ( E ) Chromatograms of cDNA confirm presence of predicted mutations for eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 . ( F ) eif2b5 zc103/zc103 mutants survive until adulthood in Mendelian ratios, but show grow defects compared to their heterozygous and wild-type siblings. ( G ) Adult eif2b5 zc103/zc103 lengths are significantly shorter compared to their wild-type and heterozygous siblings. ( H ) Bright-field (BF) images of 6 dpf eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 larva. eif2b2 sa17223/sa17223 and eif2b5 zc102/zc102 have no swim bladder (arrowhead) and a small head. ( I ) Kaplan-Meyer survival curves from an eif2b2 sa17223/+ heterozygous in-cross shows 1% (n = 3) homozygote survival at 10 dpf (total n = 302); however no homozygotes live past 2 weeks of age. ( J ) Kaplan-Meyer survival curves from an eif2b5 zc102/+ heterozygous in-cross shows that all homozygotes were dead by 10 dpf (total n = 62). ( K ) Kaplan-Meyer survival curves from an eif2b5 zc103/+ heterozygous in-cross show no mortality of homozygotes. ( L ) Motor swimming analysis shows impaired swimming behavior in mutants. Distance moved, time spent moving, and velocity, for wild-type controls, and eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 mutants, at 5, 6, and 7 dpf. Mean shown with 95% confidence intervals. Figure 2—source data 1. Quantification of lengths. Figure 2—source data 2. Quantification of behavior results. Figure 2—source data 3. Quantification of behavior results of eif2b4 sa17367/sa17367 allele. Figure 2—source data 4. qRT-PCR for ISR transcripts for eif2b4 sa17367/sa17367 allele. Figure 2—source data 5. Survival quantification for eif2b4 sa17367/sa17367 allele. Figure 2—source data 6. Survival quantification for eif2b5 zc103/zc103 allele.
Resource Source Identifier 186 Hactb Qf Caccattggcaatgagcggttc Origene Nm 001101 187 Hactb Qr, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/pm41931389-277-2-8?v=OriGene
Average 94 stars, based on 1 article reviews
resource source identifier 186 hactb qf caccattggcaatgagcggttc origene nm 001101 187 hactb qr - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier
anti-sars-cov-2-elisa iga  (EUROIMMUN)
90
EUROIMMUN anti-sars-cov-2-elisa iga
( A-D ) Depiction of zebrafish eif2b subunits exon structure and the location and nucleotide change for each mutant. ( A ) eif2b1 harbors a T/A transversion resulting in an early stop in exon 8. ( B ) <t>eif2b2</t> has a G/A transition in exon 5, mutating an essential splice site. ( C ) eif2b4 has a G/A transition in exon 12 mutating an essential splice site. ( D ) eif2b5 exon one was targeted for mutagenesis using a gRNA (red). Six distinct alleles were recovered (described in text). ( E ) Chromatograms of cDNA confirm presence of predicted mutations for eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 . ( F ) eif2b5 zc103/zc103 mutants survive until adulthood in Mendelian ratios, but show grow defects compared to their heterozygous and wild-type siblings. ( G ) Adult eif2b5 zc103/zc103 lengths are significantly shorter compared to their wild-type and heterozygous siblings. ( H ) Bright-field (BF) images of 6 dpf eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 larva. eif2b2 sa17223/sa17223 and eif2b5 zc102/zc102 have no swim bladder (arrowhead) and a small head. ( I ) Kaplan-Meyer survival curves from an eif2b2 sa17223/+ heterozygous in-cross shows 1% (n = 3) homozygote survival at 10 dpf (total n = 302); however no homozygotes live past 2 weeks of age. ( J ) Kaplan-Meyer survival curves from an eif2b5 zc102/+ heterozygous in-cross shows that all homozygotes were dead by 10 dpf (total n = 62). ( K ) Kaplan-Meyer survival curves from an eif2b5 zc103/+ heterozygous in-cross show no mortality of homozygotes. ( L ) Motor swimming analysis shows impaired swimming behavior in mutants. Distance moved, time spent moving, and velocity, for wild-type controls, and eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 mutants, at 5, 6, and 7 dpf. Mean shown with 95% confidence intervals. Figure 2—source data 1. Quantification of lengths. Figure 2—source data 2. Quantification of behavior results. Figure 2—source data 3. Quantification of behavior results of eif2b4 sa17367/sa17367 allele. Figure 2—source data 4. qRT-PCR for ISR transcripts for eif2b4 sa17367/sa17367 allele. Figure 2—source data 5. Survival quantification for eif2b4 sa17367/sa17367 allele. Figure 2—source data 6. Survival quantification for eif2b5 zc103/zc103 allele.
Anti Sars Cov 2 Elisa Iga, supplied by EUROIMMUN, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%2E5%2E1+beta+software/pmc07324317__mmc4-346-88-91?v=EUROIMMUN
Average 90 stars, based on 1 article reviews
anti-sars-cov-2-elisa iga - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


Characterization of 3CL pro cleavage specificity (A and B) MALDI-TOF-MS spectra of synthetic peptides spanning P4–P4’ of protein cleavage sites after incubation with 3CL pro (1:20 molar ratio, E:S). Product generation (red) and substrate consumption (black) were calculated as the peak area normalized to the total peak area in the spectrum. Apparent (app) k cat / K M values for 1 μM 3CL pro to convert 50% of substrate in 5, 15, 30, 60, 120 or 240 min are listed alongside bins of 4 peptides that share similar kinetic values arranged on a row-by-row basis. P4–P4’ sequence alignment using the Shapley color scale. Green protein names had cut sites identified by Edman sequencing of recombinant substrate digests. Boxed peptides, no cleavage. (C–I) Structures of the highest-ranked of 50,000 models of the active site of 3CL pro protomer 1 (PDB: 6XHM ) docked with P4–P4’ peptides from six 3CL pro substrates exhibiting a range of app k cat / K M values (circled in B). (C) 3CL pro dimer. Protomer 1, gray surface or green ribbons with catalytic Cys 145 shown. Protomer 2, orange surface with Ser 1 shown. Docking models with P4–P4’ peptide of: (C and D) RPAP1 (I_sc = −31.7), (E) IMA4 (I_sc = −30.6), (F) PTBP1 (I_sc = −31.7), (G) RBM15 (I_sc = −39.65), (H) MAP4K5 (I_sc = −28.1), and (I) CREB1 (I_sc = −30.3). Blue and red sticks, P and P’ amino acid residues, respectively. Yellow dashed sticks, hydrogen-bonds. See also <xref ref-type=Figure S2 . " width="100%" height="100%">

Journal: Cell Reports

Article Title: Mechanistic insights into COVID-19 by global analysis of the SARS-CoV-2 3CL pro substrate degradome

doi: 10.1016/j.celrep.2021.109892

Figure Lengend Snippet: Characterization of 3CL pro cleavage specificity (A and B) MALDI-TOF-MS spectra of synthetic peptides spanning P4–P4’ of protein cleavage sites after incubation with 3CL pro (1:20 molar ratio, E:S). Product generation (red) and substrate consumption (black) were calculated as the peak area normalized to the total peak area in the spectrum. Apparent (app) k cat / K M values for 1 μM 3CL pro to convert 50% of substrate in 5, 15, 30, 60, 120 or 240 min are listed alongside bins of 4 peptides that share similar kinetic values arranged on a row-by-row basis. P4–P4’ sequence alignment using the Shapley color scale. Green protein names had cut sites identified by Edman sequencing of recombinant substrate digests. Boxed peptides, no cleavage. (C–I) Structures of the highest-ranked of 50,000 models of the active site of 3CL pro protomer 1 (PDB: 6XHM ) docked with P4–P4’ peptides from six 3CL pro substrates exhibiting a range of app k cat / K M values (circled in B). (C) 3CL pro dimer. Protomer 1, gray surface or green ribbons with catalytic Cys 145 shown. Protomer 2, orange surface with Ser 1 shown. Docking models with P4–P4’ peptide of: (C and D) RPAP1 (I_sc = −31.7), (E) IMA4 (I_sc = −30.6), (F) PTBP1 (I_sc = −31.7), (G) RBM15 (I_sc = −39.65), (H) MAP4K5 (I_sc = −28.1), and (I) CREB1 (I_sc = −30.3). Blue and red sticks, P and P’ amino acid residues, respectively. Yellow dashed sticks, hydrogen-bonds. See also Figure S2 .

Article Snippet: The recombinant proteins assayed were: RNA polymerase II-associated protein 1 (RPAP1), partial 6x His-tagged (1 – 351 aa, GenBank: BC000246, Proteintech); polypyrimidine-tract binding protein 1 (PTBP1), 6x His-tagged (1 – 557 aa, NCBI: NP_002810.1, Aviva System Biology); mitogen-activated protein kinase kinase kinase kinase 5 (MAP4K5), GST/6x His-tagged (1 – 846 aa, NCBI: NP_006566.2, Sino Biological); cyclic AMP-responsive element-binding protein 1 (CREB1), 6x His-tagged (1 – 327 aa, NCBI: NM_004379, Origene); galectin-8 (LGALS8) (1 – 317 aa, GenBank: AAF19370.1, Sino Biological); SARS-CoV-2 Spike S1, 6x His-tagged recombinant protein, (16 – 685 aa, NCBI: YP_009724390.1, Sino Biological); calcium-binding and coiled-coil domain-containing protein 2 (CALCOCO2/NDP52), GST-tagged recombinant protein (1 – 446 aa, NCBI: NP_005822.1, Abnova); importin subunit alpha-4 (IMA4), partial 6x His-tagged (3 – 220 aa, NCBI: NP_002258.2, Aviva System Biology).

Techniques: Incubation, Sequencing, Recombinant

Hippo pathway substrate validation (A) 3CL pro cleavage sites in MAP4K5 and CREB1 identified by TAILS neo-N-terminal peptides (red) and Edman sequencing (green). Representative MS/MS spectra of cleaved neo-N-terminal peptides. (B) MALDI-TOF-MS kinetic analyses of 3CL pro cleavage of P4–P4’ peptides of MAP4K5 and CREB1. (C) SDS-PAGE, Edman sequencing (green) and immunoblot validation of human MAP4K5 and CREB1 substrates incubated with 3CL pro +/− inhibitor GC376, or 3CL pro -C145A (1:5 mol/mol, E:S). ΔMAP4K5 or ΔCREB1, no sequence obtained. (D and H) (D) YAP1, MAP4K5, CREB1 and (H) FYCO1 and FAF1 immunoblots of lysates from primary HAECs incubated with 3CL pro or 3CL pro -C145A (1:200 w/w, E:S) for 18 h, 37°C. (E and F) (E) YAP1 and (F) MAP4K5 immunoblots of Vero E6 cells at 24 (n = 4) and 48 (n = 4) hpi (MOI 0.1) or mock (n = 3). MAP4K5 activity assay measured as ATP consumption using myelin basic protein as substrate. The area under the curve was calculated and compared by Student’s t test, (mean ± SD, n = 2, ∗∗ p ≤ 0.01). (G, I, and J) (G) Lysates of human Calu-3 lung cells infected with SARS-CoV-2 (MOI 0.1 and 1.0, n = 4, mock n = 2) were immunoblotted for (G) CREB1 48 hpi, (I) FYCO1 24 hpi and (J) FAF1 48 hpi. Statistical analysis of the relative amount of full-length protein (E and F) or proteolytic bands (G, I, and J) identified by molecular weights relative to β-actin was assessed by one-way ANOVA and Dunnett’s multiple comparisons test. Box and whiskers (min to max) plots, ∗∗∗ p ≤ 0.001, ∗∗ p ≤ 0.01, ∗ p ≤ 0.05, ns p > 0.05. β-actin and β-tubulin loading controls. See also and .

Journal: Cell Reports

Article Title: Mechanistic insights into COVID-19 by global analysis of the SARS-CoV-2 3CL pro substrate degradome

doi: 10.1016/j.celrep.2021.109892

Figure Lengend Snippet: Hippo pathway substrate validation (A) 3CL pro cleavage sites in MAP4K5 and CREB1 identified by TAILS neo-N-terminal peptides (red) and Edman sequencing (green). Representative MS/MS spectra of cleaved neo-N-terminal peptides. (B) MALDI-TOF-MS kinetic analyses of 3CL pro cleavage of P4–P4’ peptides of MAP4K5 and CREB1. (C) SDS-PAGE, Edman sequencing (green) and immunoblot validation of human MAP4K5 and CREB1 substrates incubated with 3CL pro +/− inhibitor GC376, or 3CL pro -C145A (1:5 mol/mol, E:S). ΔMAP4K5 or ΔCREB1, no sequence obtained. (D and H) (D) YAP1, MAP4K5, CREB1 and (H) FYCO1 and FAF1 immunoblots of lysates from primary HAECs incubated with 3CL pro or 3CL pro -C145A (1:200 w/w, E:S) for 18 h, 37°C. (E and F) (E) YAP1 and (F) MAP4K5 immunoblots of Vero E6 cells at 24 (n = 4) and 48 (n = 4) hpi (MOI 0.1) or mock (n = 3). MAP4K5 activity assay measured as ATP consumption using myelin basic protein as substrate. The area under the curve was calculated and compared by Student’s t test, (mean ± SD, n = 2, ∗∗ p ≤ 0.01). (G, I, and J) (G) Lysates of human Calu-3 lung cells infected with SARS-CoV-2 (MOI 0.1 and 1.0, n = 4, mock n = 2) were immunoblotted for (G) CREB1 48 hpi, (I) FYCO1 24 hpi and (J) FAF1 48 hpi. Statistical analysis of the relative amount of full-length protein (E and F) or proteolytic bands (G, I, and J) identified by molecular weights relative to β-actin was assessed by one-way ANOVA and Dunnett’s multiple comparisons test. Box and whiskers (min to max) plots, ∗∗∗ p ≤ 0.001, ∗∗ p ≤ 0.01, ∗ p ≤ 0.05, ns p > 0.05. β-actin and β-tubulin loading controls. See also and .

Article Snippet: The recombinant proteins assayed were: RNA polymerase II-associated protein 1 (RPAP1), partial 6x His-tagged (1 – 351 aa, GenBank: BC000246, Proteintech); polypyrimidine-tract binding protein 1 (PTBP1), 6x His-tagged (1 – 557 aa, NCBI: NP_002810.1, Aviva System Biology); mitogen-activated protein kinase kinase kinase kinase 5 (MAP4K5), GST/6x His-tagged (1 – 846 aa, NCBI: NP_006566.2, Sino Biological); cyclic AMP-responsive element-binding protein 1 (CREB1), 6x His-tagged (1 – 327 aa, NCBI: NM_004379, Origene); galectin-8 (LGALS8) (1 – 317 aa, GenBank: AAF19370.1, Sino Biological); SARS-CoV-2 Spike S1, 6x His-tagged recombinant protein, (16 – 685 aa, NCBI: YP_009724390.1, Sino Biological); calcium-binding and coiled-coil domain-containing protein 2 (CALCOCO2/NDP52), GST-tagged recombinant protein (1 – 446 aa, NCBI: NP_005822.1, Abnova); importin subunit alpha-4 (IMA4), partial 6x His-tagged (3 – 220 aa, NCBI: NP_002258.2, Aviva System Biology).

Techniques: Sequencing, Tandem Mass Spectroscopy, SDS Page, Western Blot, Incubation, Activity Assay, Infection

Journal: Cell Reports

Article Title: Mechanistic insights into COVID-19 by global analysis of the SARS-CoV-2 3CL pro substrate degradome

doi: 10.1016/j.celrep.2021.109892

Figure Lengend Snippet:

Article Snippet: The recombinant proteins assayed were: RNA polymerase II-associated protein 1 (RPAP1), partial 6x His-tagged (1 – 351 aa, GenBank: BC000246, Proteintech); polypyrimidine-tract binding protein 1 (PTBP1), 6x His-tagged (1 – 557 aa, NCBI: NP_002810.1, Aviva System Biology); mitogen-activated protein kinase kinase kinase kinase 5 (MAP4K5), GST/6x His-tagged (1 – 846 aa, NCBI: NP_006566.2, Sino Biological); cyclic AMP-responsive element-binding protein 1 (CREB1), 6x His-tagged (1 – 327 aa, NCBI: NM_004379, Origene); galectin-8 (LGALS8) (1 – 317 aa, GenBank: AAF19370.1, Sino Biological); SARS-CoV-2 Spike S1, 6x His-tagged recombinant protein, (16 – 685 aa, NCBI: YP_009724390.1, Sino Biological); calcium-binding and coiled-coil domain-containing protein 2 (CALCOCO2/NDP52), GST-tagged recombinant protein (1 – 446 aa, NCBI: NP_005822.1, Abnova); importin subunit alpha-4 (IMA4), partial 6x His-tagged (3 – 220 aa, NCBI: NP_002258.2, Aviva System Biology).

Techniques: Recombinant, Sequencing, Fluorescence, Modification, Protease Inhibitor, Staining, Blocking Assay, Binding Assay, Activity Assay, Western Blot, Synthesized, Software, Microscopy, Spectrophotometry, Mass Spectrometry

( A-D ) Depiction of zebrafish eif2b subunits exon structure and the location and nucleotide change for each mutant. ( A ) eif2b1 harbors a T/A transversion resulting in an early stop in exon 8. ( B ) eif2b2 has a G/A transition in exon 5, mutating an essential splice site. ( C ) eif2b4 has a G/A transition in exon 12 mutating an essential splice site. ( D ) eif2b5 exon one was targeted for mutagenesis using a gRNA (red). Six distinct alleles were recovered (described in text). ( E ) Chromatograms of cDNA confirm presence of predicted mutations for eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 . ( F ) eif2b5 zc103/zc103 mutants survive until adulthood in Mendelian ratios, but show grow defects compared to their heterozygous and wild-type siblings. ( G ) Adult eif2b5 zc103/zc103 lengths are significantly shorter compared to their wild-type and heterozygous siblings. ( H ) Bright-field (BF) images of 6 dpf eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 larva. eif2b2 sa17223/sa17223 and eif2b5 zc102/zc102 have no swim bladder (arrowhead) and a small head. ( I ) Kaplan-Meyer survival curves from an eif2b2 sa17223/+ heterozygous in-cross shows 1% (n = 3) homozygote survival at 10 dpf (total n = 302); however no homozygotes live past 2 weeks of age. ( J ) Kaplan-Meyer survival curves from an eif2b5 zc102/+ heterozygous in-cross shows that all homozygotes were dead by 10 dpf (total n = 62). ( K ) Kaplan-Meyer survival curves from an eif2b5 zc103/+ heterozygous in-cross show no mortality of homozygotes. ( L ) Motor swimming analysis shows impaired swimming behavior in mutants. Distance moved, time spent moving, and velocity, for wild-type controls, and eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 mutants, at 5, 6, and 7 dpf. Mean shown with 95% confidence intervals. Figure 2—source data 1. Quantification of lengths. Figure 2—source data 2. Quantification of behavior results. Figure 2—source data 3. Quantification of behavior results of eif2b4 sa17367/sa17367 allele. Figure 2—source data 4. qRT-PCR for ISR transcripts for eif2b4 sa17367/sa17367 allele. Figure 2—source data 5. Survival quantification for eif2b4 sa17367/sa17367 allele. Figure 2—source data 6. Survival quantification for eif2b5 zc103/zc103 allele.

Journal: eLife

Article Title: Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response

doi: 10.7554/eLife.56319

Figure Lengend Snippet: ( A-D ) Depiction of zebrafish eif2b subunits exon structure and the location and nucleotide change for each mutant. ( A ) eif2b1 harbors a T/A transversion resulting in an early stop in exon 8. ( B ) eif2b2 has a G/A transition in exon 5, mutating an essential splice site. ( C ) eif2b4 has a G/A transition in exon 12 mutating an essential splice site. ( D ) eif2b5 exon one was targeted for mutagenesis using a gRNA (red). Six distinct alleles were recovered (described in text). ( E ) Chromatograms of cDNA confirm presence of predicted mutations for eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 . ( F ) eif2b5 zc103/zc103 mutants survive until adulthood in Mendelian ratios, but show grow defects compared to their heterozygous and wild-type siblings. ( G ) Adult eif2b5 zc103/zc103 lengths are significantly shorter compared to their wild-type and heterozygous siblings. ( H ) Bright-field (BF) images of 6 dpf eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 larva. eif2b2 sa17223/sa17223 and eif2b5 zc102/zc102 have no swim bladder (arrowhead) and a small head. ( I ) Kaplan-Meyer survival curves from an eif2b2 sa17223/+ heterozygous in-cross shows 1% (n = 3) homozygote survival at 10 dpf (total n = 302); however no homozygotes live past 2 weeks of age. ( J ) Kaplan-Meyer survival curves from an eif2b5 zc102/+ heterozygous in-cross shows that all homozygotes were dead by 10 dpf (total n = 62). ( K ) Kaplan-Meyer survival curves from an eif2b5 zc103/+ heterozygous in-cross show no mortality of homozygotes. ( L ) Motor swimming analysis shows impaired swimming behavior in mutants. Distance moved, time spent moving, and velocity, for wild-type controls, and eif2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 mutants, at 5, 6, and 7 dpf. Mean shown with 95% confidence intervals. Figure 2—source data 1. Quantification of lengths. Figure 2—source data 2. Quantification of behavior results. Figure 2—source data 3. Quantification of behavior results of eif2b4 sa17367/sa17367 allele. Figure 2—source data 4. qRT-PCR for ISR transcripts for eif2b4 sa17367/sa17367 allele. Figure 2—source data 5. Survival quantification for eif2b4 sa17367/sa17367 allele. Figure 2—source data 6. Survival quantification for eif2b5 zc103/zc103 allele.

Article Snippet: We tried western blotting with several commercial antibodies against Eif2b2 and Eif2b5 (Eif2B2 Abcam 133848; Eif2B5 Abcam ab91563, GeneTex 30808, Santa Cruz 514056, ProSci 56–847, Bethyl A302-557A) but none gave a specific band.

Techniques: Mutagenesis, Quantitative RT-PCR

Confocal images, z-stack maximal projections. ( A–I ), dorsal views of the brain, rostral to the top, scale bar 50 μm; ( K–N ), lateral views of spinal cord, dorsal to the top, scale bar 50 um. ( P–S ), dorsal views of brain, rostral to top, scale bar 50 μm. *p<0.05. ( A–D ) TUNEL and DAPI staining shows increased apoptosis in homozygous mutant alleles compared to controls (wild-type and heterozygous siblings) in ei f2b5 zc103/zc103 eif2b5 zc102/zc102 and eif2b2 sa17223/sa17223 mutants. ( E ) Quantification of mean TUNEL+ cell counts in ei f2b5 zc103/zc103 eif2b5 zc102/zc102 and eif2b2 sa17223/sa17223 mutants compared to sibling controls. ( F–I ) Phospho-histone 3 and DAPI staining shows decreased cell proliferation in 5 dpf eif2b2 sa17223/sa17223 mutants compared to controls, while ei f2b5 zc103/zc103 eif2b5 zc102/zc102 mutants show a change in proliferation pattern, specifically in the optic tectum. ( J ) Quantification of mean number pH3+ cells counts in ei f2b5 zc103/zc103 eif2b5 zc102/zc102 and eif2b2 sa17223/sa17223 mutants compared to sibling controls. ( K–N ) Olig2dsRed and DAPI staining shows no change in OPC counts in the spinal cords of 5 dpf ei f2b5 zc103/zc103 eif2b5 zc102/zc102 and eif2b2 sa17223/sa17223 mutants compared to controls. ( O ) Quantification of mean number Olig2dsRed+ counts in ei f2b5 zc103/zc103 eif2b5 zc102/zc102 or eif2b2 sa17223/sa17223 mutants compared to sibling controls. ( P–S ) Co-labeled Olig2dsRed+/TUNEL+ cell counts staining shows increase in Olig2dsRed+ cells undergoing apoptosis in brains of 5 dpf ei f2b5 zc103/zc103 , eif2b5 zc102/zc102 , or eif2b2 sa17223/sa17223 mutants compared to sibling controls. ( O ) Quantification of mean number of co-labeled Olig2dsRed+/TUNEL+ cell counts in ei f2b5 zc103/zc103 , eif2b5 zc102/zc102 , or eif2b2 sa17223/sa17223 mutants compared to sibling controls. Figure 3—source data 1. Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results. Figure 3—source data 2. Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results. Figure 3—source data 3. Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results. Figure 3—source data 4. Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results.

Journal: eLife

Article Title: Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response

doi: 10.7554/eLife.56319

Figure Lengend Snippet: Confocal images, z-stack maximal projections. ( A–I ), dorsal views of the brain, rostral to the top, scale bar 50 μm; ( K–N ), lateral views of spinal cord, dorsal to the top, scale bar 50 um. ( P–S ), dorsal views of brain, rostral to top, scale bar 50 μm. *p<0.05. ( A–D ) TUNEL and DAPI staining shows increased apoptosis in homozygous mutant alleles compared to controls (wild-type and heterozygous siblings) in ei f2b5 zc103/zc103 eif2b5 zc102/zc102 and eif2b2 sa17223/sa17223 mutants. ( E ) Quantification of mean TUNEL+ cell counts in ei f2b5 zc103/zc103 eif2b5 zc102/zc102 and eif2b2 sa17223/sa17223 mutants compared to sibling controls. ( F–I ) Phospho-histone 3 and DAPI staining shows decreased cell proliferation in 5 dpf eif2b2 sa17223/sa17223 mutants compared to controls, while ei f2b5 zc103/zc103 eif2b5 zc102/zc102 mutants show a change in proliferation pattern, specifically in the optic tectum. ( J ) Quantification of mean number pH3+ cells counts in ei f2b5 zc103/zc103 eif2b5 zc102/zc102 and eif2b2 sa17223/sa17223 mutants compared to sibling controls. ( K–N ) Olig2dsRed and DAPI staining shows no change in OPC counts in the spinal cords of 5 dpf ei f2b5 zc103/zc103 eif2b5 zc102/zc102 and eif2b2 sa17223/sa17223 mutants compared to controls. ( O ) Quantification of mean number Olig2dsRed+ counts in ei f2b5 zc103/zc103 eif2b5 zc102/zc102 or eif2b2 sa17223/sa17223 mutants compared to sibling controls. ( P–S ) Co-labeled Olig2dsRed+/TUNEL+ cell counts staining shows increase in Olig2dsRed+ cells undergoing apoptosis in brains of 5 dpf ei f2b5 zc103/zc103 , eif2b5 zc102/zc102 , or eif2b2 sa17223/sa17223 mutants compared to sibling controls. ( O ) Quantification of mean number of co-labeled Olig2dsRed+/TUNEL+ cell counts in ei f2b5 zc103/zc103 , eif2b5 zc102/zc102 , or eif2b2 sa17223/sa17223 mutants compared to sibling controls. Figure 3—source data 1. Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results. Figure 3—source data 2. Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results. Figure 3—source data 3. Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results. Figure 3—source data 4. Quantification of TUNEL, pH3, olig2, and olig2/TUNEL results.

Article Snippet: We tried western blotting with several commercial antibodies against Eif2b2 and Eif2b5 (Eif2B2 Abcam 133848; Eif2B5 Abcam ab91563, GeneTex 30808, Santa Cruz 514056, ProSci 56–847, Bethyl A302-557A) but none gave a specific band.

Techniques: TUNEL Assay, Staining, Mutagenesis, Labeling

Confocal images of brain, z-stack, rostral to the top, double-labeling for TUNEL and olig1 (in situ probe), in WT, eif2b5 zc103/zc103 , eif2b5 zc102/zc102 or eif2b2 sa17223/sa172233 larvae. Region used for quantification shown by box. Inset in each panel shows example of double-labeled cell (TUNEL, olig1 ) for each genotype (except WT), single confocal slice image. Middle panels: no change in apoptosis of differentiated oligodendrocytes, co-labeled with myelin associated glycoprotein ( mag ) (in situ probe) and TUNEL. Confocal z-stack images of spinal cord, rostral to the left; quantified in lower right panel. Figure 4—source data 1. Quantification of olig1 , TUNEL and mag results.

Journal: eLife

Article Title: Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response

doi: 10.7554/eLife.56319

Figure Lengend Snippet: Confocal images of brain, z-stack, rostral to the top, double-labeling for TUNEL and olig1 (in situ probe), in WT, eif2b5 zc103/zc103 , eif2b5 zc102/zc102 or eif2b2 sa17223/sa172233 larvae. Region used for quantification shown by box. Inset in each panel shows example of double-labeled cell (TUNEL, olig1 ) for each genotype (except WT), single confocal slice image. Middle panels: no change in apoptosis of differentiated oligodendrocytes, co-labeled with myelin associated glycoprotein ( mag ) (in situ probe) and TUNEL. Confocal z-stack images of spinal cord, rostral to the left; quantified in lower right panel. Figure 4—source data 1. Quantification of olig1 , TUNEL and mag results.

Article Snippet: We tried western blotting with several commercial antibodies against Eif2b2 and Eif2b5 (Eif2B2 Abcam 133848; Eif2B5 Abcam ab91563, GeneTex 30808, Santa Cruz 514056, ProSci 56–847, Bethyl A302-557A) but none gave a specific band.

Techniques: Labeling, TUNEL Assay, In Situ

( A ) Confocal images of brain, z-stack, rostral to the top, in WT, eif2b5 zc103/zc103 , eif2b5 zc102/zc102 or eif2b2 sa17223/sa172233 larvae. Confocal images of brain, z-stack, rostral to the top. Top row, labeling for Zrf1, DAPI, and pH3. Middle row, labeling for HuC/D, DAPI, and pH3. Bottom row, labeling for apoeb , DAPI, and pH3. ( B ) Quantification of cell counts in ( A ). ( C ) Confocal images of brain, z-stack, rostral to the top, in WT, eif2b5 zc103/zc103 , eif2b5 zc102/zc102 or eif2b2 sa17223/sa172233 larvae. Confocal images of brain, z-stack, rostral to the top. Top row, labeling for Zrf1, DAPI, and TUNEL. Middle row, labeling for HuC/D, DAPI, and TUNEL. Bottom row, labeling for apoeb , DAPI, and TUNEL. ( D ) Quantification of cell counts in ( C ). Figure 5—source data 1. Quantification of Zrf1, HuC/D, and apoeb , double-labeling with pH3, results in tectum, midline, and eyes in eif2b5 zc103/zc103 , eif2b2 zc102/zc102 , and eif2b2 sa17223/sa172233 . Figure 5—source data 2. Quantification of Zrf1, HuC/D, and apoeb , double-labeling with TUNEL, results in tectum, midline, and eyes in eif2b5 zc103/zc103 , eif2b2 zc102/zc102 , and eif2b2 sa17223/sa172233 .

Journal: eLife

Article Title: Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response

doi: 10.7554/eLife.56319

Figure Lengend Snippet: ( A ) Confocal images of brain, z-stack, rostral to the top, in WT, eif2b5 zc103/zc103 , eif2b5 zc102/zc102 or eif2b2 sa17223/sa172233 larvae. Confocal images of brain, z-stack, rostral to the top. Top row, labeling for Zrf1, DAPI, and pH3. Middle row, labeling for HuC/D, DAPI, and pH3. Bottom row, labeling for apoeb , DAPI, and pH3. ( B ) Quantification of cell counts in ( A ). ( C ) Confocal images of brain, z-stack, rostral to the top, in WT, eif2b5 zc103/zc103 , eif2b5 zc102/zc102 or eif2b2 sa17223/sa172233 larvae. Confocal images of brain, z-stack, rostral to the top. Top row, labeling for Zrf1, DAPI, and TUNEL. Middle row, labeling for HuC/D, DAPI, and TUNEL. Bottom row, labeling for apoeb , DAPI, and TUNEL. ( D ) Quantification of cell counts in ( C ). Figure 5—source data 1. Quantification of Zrf1, HuC/D, and apoeb , double-labeling with pH3, results in tectum, midline, and eyes in eif2b5 zc103/zc103 , eif2b2 zc102/zc102 , and eif2b2 sa17223/sa172233 . Figure 5—source data 2. Quantification of Zrf1, HuC/D, and apoeb , double-labeling with TUNEL, results in tectum, midline, and eyes in eif2b5 zc103/zc103 , eif2b2 zc102/zc102 , and eif2b2 sa17223/sa172233 .

Article Snippet: We tried western blotting with several commercial antibodies against Eif2b2 and Eif2b5 (Eif2B2 Abcam 133848; Eif2B5 Abcam ab91563, GeneTex 30808, Santa Cruz 514056, ProSci 56–847, Bethyl A302-557A) but none gave a specific band.

Techniques: Labeling, TUNEL Assay

( A ) 11.1 kb zebrafish eif2b2 gene structure. ( B ) 9.5 kb human EIF2B2 gene structure. ( C ) Conservation of amino acid sequence between zebrafish eif2b2 and human EIF2B2. ( D ) Schematic of rescue construct containing Tol2, β-actin, human EIF2B2, and eGFP. ( E ) Genotype results (at adult age), of an eif2b2 sa17223/+ heterozygous incross, and an eif2b2 sa17223/+ heterozygous zebrafish crossed with two different transgenic alleles (#3 and #4): eif2b2 sa17223/+ ;Tg 3 ( β-actin:EIF2B2:2A:eGFP ) or eif2b2 sa17223/+ ;Tg 4 ( β-actin:EIF2B2:2A:eGFP ) heterozygous zebrafish. ( F ) Bright-field and immunofluorescent images of eif2b2 sa17223/sa17223 ;β-actin:EIF2B2:2A:eGFP mutant fish: showing a swim bladder and regular-sized head; or showing GFP expression in eif2b2 sa17223/sa17223 ;β-actin:EIF2B2:2A:eGFP mutant fish. ( G–J ) TUNEL and DAPI antibody staining of wild-type control; e if2b2 sa17223/sa17223 mutant; eif2b2 +/+ ;β-actin:EIF2B2:2A:eGFP wild-type control; and eif2b2 sa17223/sa17223 ;β-actin:EIF2B2:2A:eGFP mutant. ( K ) Quantification of TUNEL+ cells. Figure 7—source data 1. Quantification of TUNEL results. Figure 7—source data 2. Quantification of behavior results.

Journal: eLife

Article Title: Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response

doi: 10.7554/eLife.56319

Figure Lengend Snippet: ( A ) 11.1 kb zebrafish eif2b2 gene structure. ( B ) 9.5 kb human EIF2B2 gene structure. ( C ) Conservation of amino acid sequence between zebrafish eif2b2 and human EIF2B2. ( D ) Schematic of rescue construct containing Tol2, β-actin, human EIF2B2, and eGFP. ( E ) Genotype results (at adult age), of an eif2b2 sa17223/+ heterozygous incross, and an eif2b2 sa17223/+ heterozygous zebrafish crossed with two different transgenic alleles (#3 and #4): eif2b2 sa17223/+ ;Tg 3 ( β-actin:EIF2B2:2A:eGFP ) or eif2b2 sa17223/+ ;Tg 4 ( β-actin:EIF2B2:2A:eGFP ) heterozygous zebrafish. ( F ) Bright-field and immunofluorescent images of eif2b2 sa17223/sa17223 ;β-actin:EIF2B2:2A:eGFP mutant fish: showing a swim bladder and regular-sized head; or showing GFP expression in eif2b2 sa17223/sa17223 ;β-actin:EIF2B2:2A:eGFP mutant fish. ( G–J ) TUNEL and DAPI antibody staining of wild-type control; e if2b2 sa17223/sa17223 mutant; eif2b2 +/+ ;β-actin:EIF2B2:2A:eGFP wild-type control; and eif2b2 sa17223/sa17223 ;β-actin:EIF2B2:2A:eGFP mutant. ( K ) Quantification of TUNEL+ cells. Figure 7—source data 1. Quantification of TUNEL results. Figure 7—source data 2. Quantification of behavior results.

Article Snippet: We tried western blotting with several commercial antibodies against Eif2b2 and Eif2b5 (Eif2B2 Abcam 133848; Eif2B5 Abcam ab91563, GeneTex 30808, Santa Cruz 514056, ProSci 56–847, Bethyl A302-557A) but none gave a specific band.

Techniques: Sequencing, Construct, Transgenic Assay, Mutagenesis, Expressing, TUNEL Assay, Staining, Control

( A ) Schematic showing integrated stress response activated intron 12 retention of eif2b5 resulting in premature stop codon and truncated form of EIF2B5. ( B ) Fold change of eif2b5 intron 12 expression with qRT-PCR in ei f2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 mutants relative to controls. ( C ) qRT-PCR for intron 12 expression in a VWM patient and their control unaffected father. ( D ) Control-injected larvae, compared to those injected with truncated eif2b5 construct, shows impaired swimming behavior; distance moved, time spent moving, and velocity, at 5 dpf. ( E ) qRT-PCR for atf4 , bip , chopII , and perk ISR transcripts shows increased expression in ei f2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 mutants. ( F ) qRT-PCR for ISR transcripts ( atf 4 , bip , chop II , and perk ) shows increased expression following injection of truncated eif2b5 construct. Figure 8—source data 1. qRT-PCR for intron 12 expression changes ( eif2b5 , zebrafish). Figure 8—source data 2. qRT-PCR for intron 12 expression changes ( eif2b2 , zebrafish). Figure 8—source data 3. qRT-PCR for intron 12 expression changes (human). Figure 8—source data 4. Behavior data for truncated eif2b5 effects. Figure 8—source data 5. qRT-PCR for ISR transcript expression. Figure 8—source data 6. qRT-PCR for ISR transcript expression changes following injection with truncated eif2b5 .

Journal: eLife

Article Title: Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response

doi: 10.7554/eLife.56319

Figure Lengend Snippet: ( A ) Schematic showing integrated stress response activated intron 12 retention of eif2b5 resulting in premature stop codon and truncated form of EIF2B5. ( B ) Fold change of eif2b5 intron 12 expression with qRT-PCR in ei f2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 mutants relative to controls. ( C ) qRT-PCR for intron 12 expression in a VWM patient and their control unaffected father. ( D ) Control-injected larvae, compared to those injected with truncated eif2b5 construct, shows impaired swimming behavior; distance moved, time spent moving, and velocity, at 5 dpf. ( E ) qRT-PCR for atf4 , bip , chopII , and perk ISR transcripts shows increased expression in ei f2b5 zc103/zc103 , eif2b5 zc102/zc102 , and eif2b2 sa17223/sa17223 mutants. ( F ) qRT-PCR for ISR transcripts ( atf 4 , bip , chop II , and perk ) shows increased expression following injection of truncated eif2b5 construct. Figure 8—source data 1. qRT-PCR for intron 12 expression changes ( eif2b5 , zebrafish). Figure 8—source data 2. qRT-PCR for intron 12 expression changes ( eif2b2 , zebrafish). Figure 8—source data 3. qRT-PCR for intron 12 expression changes (human). Figure 8—source data 4. Behavior data for truncated eif2b5 effects. Figure 8—source data 5. qRT-PCR for ISR transcript expression. Figure 8—source data 6. qRT-PCR for ISR transcript expression changes following injection with truncated eif2b5 .

Article Snippet: We tried western blotting with several commercial antibodies against Eif2b2 and Eif2b5 (Eif2B2 Abcam 133848; Eif2B5 Abcam ab91563, GeneTex 30808, Santa Cruz 514056, ProSci 56–847, Bethyl A302-557A) but none gave a specific band.

Techniques: Expressing, Quantitative RT-PCR, Control, Injection, Construct

Journal: eLife

Article Title: Vanishing white matter disease expression of truncated EIF2B5 activates induced stress response

doi: 10.7554/eLife.56319

Figure Lengend Snippet:

Article Snippet: We tried western blotting with several commercial antibodies against Eif2b2 and Eif2b5 (Eif2B2 Abcam 133848; Eif2B5 Abcam ab91563, GeneTex 30808, Santa Cruz 514056, ProSci 56–847, Bethyl A302-557A) but none gave a specific band.

Techniques: Generated, Recombinant, Transfection, Construct, Labeling, Plasmid Preparation, SYBR Green Assay, Software, Staining