Journal: PLoS Pathogens

Article Title: PARP1-cGAS-NF-κB pathway of proinflammatory macrophage activation by extracellular vesicles released during Trypanosoma cruzi infection and Chagas disease

doi: 10.1371/journal.ppat.1008474

Figure Lengend Snippet: NEv and TEv were purified from supernatants of Raw 264.7 Mφ incubated for 72 h with media only or T . cruzi , respectively. Next, Raw Mφ were incubated with NEv or TEv for 3 h or 18 h in presence or absence of 5 μM chloroquine (inhibits endosomal TLR3/7/9), 5 μM quinacrine (inhibits TLR3/9), 5 μM ODN-2088 (ODN, inhibits TLR9), 10 μM PF-06928215 (inhibits cGAS) or 5 μM JSH-23 (inhibits NF-κB activation). The mRNA levels for genes encoding TNF-α (A) , IL-6 (B) , and IL-1β (C) were evaluated by RT-qPCR. Data are representative of ≥ 2 independent experiments (two biological replicates per treatment and three observations per sample) and presented as mean ± SD. Unless indicated with horizontal bar, statistical significance comparing TEv vs. TEv + inhibitor is annotated as + p ≤ 0.05, ++ p ≤ 0.01, and +++ p ≤ 0.001.

Article Snippet: For signaling studies, Raw 264.7 Mφ were incubated with TEv or NEv in the presence or absence of 5 μM chloroquine (inhibits endosomal TLRs, tlrl-chq, Invivogen, San Diego, CA), 5 μM quinacrine (inhibits TLR3/TLR9, NBP2-29385, Novus biological, Littleton, CO), 5 μM ODN-2088 (TLR9 antagonist, tlrl-2088, Invivogen), 5–10 μM PF-06928215 (cGAS inhibitor, PZ038, Sigma-Aldrich) or 5 μM JSH-23 (NFκB inhibitor, 481408-M, Millipore).

Techniques: Purification, Incubation, Activation Assay, Quantitative RT-PCR

Journal: The EMBO Journal

Article Title: RASSF 1A is required for the maintenance of nuclear actin levels

doi: 10.15252/embj.2018101168

Figure Lengend Snippet: Assessment of RASSF1A protein levels in HeLa cells transfected with siRASSF1A. Error bars derive from two independent experiments and represent the SEM. Representative confocal images of RASSF1A and Lamin A/C in siRASSF1A‐transfected HeLa cells. DNA was stained with DAPI. Scale bars = 10 μm. Immunofluorescence images of RASSF1A in MDA‐MB‐231 cells after treatment with DMSO or 5′‐aza‐dC demethylating reagent. DNA was stained with DAPI. Lower blot shows the expression levels of RASSF1A levels following treatment. Scale bars = 10 μm. Digitonin‐permeabilised HeLa cells stained with RASSF1A and the cytoplasmic α‐tubulin as a marker of plasma membrane permeabilisation. DNA was stained with DAPI. Scale bars = 10 μm. Immunofluorescence detection of phosphorylated RASSF1A (Ser 131). Fluorescence intensity profile of Lamin A/C (red) and pRASSF1A (Ser 131) (green) signals across the HeLa nuclei. Position of line scan indicated by the dashed white line. Scale bars = 10 μm. Immunofluorescence images of RASSF1A in HeLa cells treated with DMSO, ATR inhibitor VE821, ATM inhibitor KU5933 and the combination of both. Western blot (bottom) of RASSF1A protein levels following the corresponding treatments. Scale bars = 10 μm. Data information: Two‐tailed Student's t ‐test was used for statistical analysis. *** P < 0.001. Source data are available online for this figure.

Article Snippet: The oligos used were as follows: siMST2: siGENOME SMARTpool: M‐004874‐02 (Dharmacon), siRASSF1A: GACCUCUGUGGCGACUU, siLaminA/C: sc35776 (Santa Cruz Biotechnology, Inc), siIPO9: EHU102331 (Sigma). siRNA against luciferase with the sequence GCCAUUCUAUCCUCUAGAGGAUG was used as control.

Techniques: Transfection, Staining, Immunofluorescence, Expressing, Marker, Clinical Proteomics, Membrane, Fluorescence, Western Blot, Two Tailed Test

Journal: The EMBO Journal

Article Title: RASSF 1A is required for the maintenance of nuclear actin levels

doi: 10.15252/embj.2018101168

Figure Lengend Snippet: List of proteins identified by LC‐MS/MS in MST2 IP. The table includes the MASCOT score and number of significant peptides and unique peptides (in brackets) identified in each biological replicates after applying a 20 ion cut‐off and 1% FDR rate. Lamin B1 was identified only in 1 out of the 3 biological replicates with 1 unique peptide. However, interactions were verified by WB (Fig A). Representative confocal images of MST1 (top) and MST2 (bottom) co‐stained with the nuclear envelope marker Lamin B. DNA was stained with DAPI. Fluorescence intensity profile of Lamin B (green) and MST1 or MST2 (red) signals across the HeLa nuclei. Position of line scan indicated by the dashed white line. Scale bars = 10 μm. Immunofluorescence images of RASSF1A and MST2 in siCTRL‐, siRASSF1A‐ and siMST2‐treated cells. DNA was stained with DAPI. The graphs illustrate the fluorescence intensity profile of Lamin B (green) and MST2 (red) signals along the white lines shown in the merged panels. Scale bars = 10 μm.

Article Snippet: The oligos used were as follows: siMST2: siGENOME SMARTpool: M‐004874‐02 (Dharmacon), siRASSF1A: GACCUCUGUGGCGACUU, siLaminA/C: sc35776 (Santa Cruz Biotechnology, Inc), siIPO9: EHU102331 (Sigma). siRNA against luciferase with the sequence GCCAUUCUAUCCUCUAGAGGAUG was used as control.

Techniques: Liquid Chromatography with Mass Spectroscopy, Staining, Marker, Fluorescence, Immunofluorescence

Journal: The EMBO Journal

Article Title: RASSF 1A is required for the maintenance of nuclear actin levels

doi: 10.15252/embj.2018101168

Figure Lengend Snippet: Co‐immunoprecipitation of endogenous RASSF1A with endogenous RAN, CRM1/XPO1, XPO4, XPO5, XPO6 and XPO7 from HeLa cell lysates, compared with the IgG control. Upper: graphical representation of the domain structure of full‐length RASSF1A and mutant constructs used for mapping RASSF1A/XPO6 interaction. Different domains are abbreviated as follows: SARAH, Salvador‐RASSF‐Hippo domain; C1, N‐terminal C1 type zinc fingers; and RA, Ras‐binding domain. Lower: Western blot analysis of MYC immunoprecipitation from the indicated inputs from HeLa cells. Co‐immunoprecipitation of endogenous XPO6 with RAN in siRASSF1A from HeLa cell lysates. Co‐immunoprecipitation of endogenous XPO6 with endogenous RAN, RASSF1A and MST2 in siRASSF1A and siMST2 HeLa cells. Quantification of the interaction of XPO6 with RASSF1A, RAN and MST2 relative to XPO6 is shown. Error bars derive from three independent experiments and represent the SEM. Co‐immunoprecipitation of endogenous RASSF1A with endogenous XPO6 and RAN in siRNA‐mediated knockdown of MST2 HeLa cells. Quantification of the interaction of RASSF1A with XPO6, RAN and MST2 relative to RASSF1A is shown. Error bars derive from three independent experiments and represent the SEM. Data information: Two‐tailed Student's t ‐test was used for statistical analysis. * P < 0.05, ** P < 0.01. Source data are available online for this figure.

Article Snippet: The oligos used were as follows: siMST2: siGENOME SMARTpool: M‐004874‐02 (Dharmacon), siRASSF1A: GACCUCUGUGGCGACUU, siLaminA/C: sc35776 (Santa Cruz Biotechnology, Inc), siIPO9: EHU102331 (Sigma). siRNA against luciferase with the sequence GCCAUUCUAUCCUCUAGAGGAUG was used as control.

Techniques: Immunoprecipitation, Control, Mutagenesis, Construct, Zinc-Fingers, Binding Assay, Western Blot, Knockdown, Two Tailed Test

Journal: The EMBO Journal

Article Title: RASSF 1A is required for the maintenance of nuclear actin levels

doi: 10.15252/embj.2018101168

Figure Lengend Snippet: Co‐immunoprecipitation of endogenous XPO6 in MDA‐MB‐231 cells transfected with the empty vector pcDNA or with plasmid expressing RASSF1A. GST pull‐down assays were performed using recombinant GST‐RAN protein with siCTRL‐ or siRASSF1A‐transfected HeLa total cell lysate. Co‐immunoprecipitation of endogenous MST2 with endogenous XPO6, RAN and RASSF1A in siRNA‐mediated knockdown of either RASSF1A or siXPO6 HeLa cells. Source data are available online for this figure.

Article Snippet: The oligos used were as follows: siMST2: siGENOME SMARTpool: M‐004874‐02 (Dharmacon), siRASSF1A: GACCUCUGUGGCGACUU, siLaminA/C: sc35776 (Santa Cruz Biotechnology, Inc), siIPO9: EHU102331 (Sigma). siRNA against luciferase with the sequence GCCAUUCUAUCCUCUAGAGGAUG was used as control.

Techniques: Immunoprecipitation, Transfection, Plasmid Preparation, Expressing, Recombinant, Knockdown

Journal: The EMBO Journal

Article Title: RASSF 1A is required for the maintenance of nuclear actin levels

doi: 10.15252/embj.2018101168

Figure Lengend Snippet: HeLa cells treated with control or RASSF1A siRNA were fractionated into cytoplasmic and nuclear extracts. Lysates from each fraction were probed for actin and profilin alongside GAPDH (as a marker of the cytoplasmic fraction) and Lamin A/C (as a marker of the nuclear fraction). Right: quantification of nuclear actin and profilin relative to Lamin A/C is shown. Error bars derive from two independent experiments and represent the SEM. Immunofluorescence images of profilin in control and RASSF1A siRNA‐transfected HeLa cells. Right: the profilin localisation was scored as nuclear/cytoplasmic or predominantly cytoplasmic in approximately 100 cells. Error bars derive from three independent experiments and represent the SEM. Confocal images of endogenous monomeric globular actin (G‐actin) in siCTRL and siRASSF1A cells using DNase I staining (Alexa Fluor 488‐conjugated, green ). Scale bars = 10 μm. Western blot analysis of actin, profilin, GAPDH and Lamin A/C levels in nuclear and cytoplasmic fractions of MDA‐MB‐231 cells treated with control pcDNA3 or RASSF1A vector. The graph shows the nuclear levels of actin and profilin relative to Lamin A/C in MDA‐MB‐231 cells expressing RASSF1A. Error bars derive from two independent experiments and represent the SEM. Data information: Two‐tailed Student's t ‐test was used for statistical analysis. * P < 0.05, ** P < 0.01. Source data are available online for this figure.

Article Snippet: The oligos used were as follows: siMST2: siGENOME SMARTpool: M‐004874‐02 (Dharmacon), siRASSF1A: GACCUCUGUGGCGACUU, siLaminA/C: sc35776 (Santa Cruz Biotechnology, Inc), siIPO9: EHU102331 (Sigma). siRNA against luciferase with the sequence GCCAUUCUAUCCUCUAGAGGAUG was used as control.

Techniques: Control, Marker, Immunofluorescence, Transfection, Staining, Western Blot, Plasmid Preparation, Expressing, Two Tailed Test

Journal: The EMBO Journal

Article Title: RASSF 1A is required for the maintenance of nuclear actin levels

doi: 10.15252/embj.2018101168

Figure Lengend Snippet: Western blot analysis of actin and profilin levels in nuclear and cytoplasmic fractions of cells transfected with truncated RASSF1A mutants. Western blot analysis of actin and profilin levels in nuclear and cytoplasmic fractions of cells transfected with siRASSF1A and siRASSF1A together with XPO6 plasmid. Western blot analysis of actin and profilin levels in nuclear and cytoplasmic fractions of cells transfected with siRNA‐resistant FLAG‐RASSF1A plasmid. Western blot analysis of actin and profilin levels in nuclear and cytoplasmic fractions of cells transfected with siMST2. Quantification of nuclear actin and profilin relative to Lamin A/C is shown. Error bars derive from three independent experiments and represent the SEM. Western blot analysis of exportin‐6 (XPO6) and importin‐9 (IPO9) in the absence of RASSF1A. GAPDH was used as a loading control. Confocal images of endogenous filamentous actin (F‐actin) in siCTRL and siRASSF1A cells using phalloidin staining (Alexa Fluor 568‐conjugated, red ). DNA was stained with DAPI. Scale bars = 10 μm. Western blot analysis of actin, profilin, GAPDH and Lamin A/C levels in nuclear and cytoplasmic fractions of MDA‐MB‐231 cells treated with DMSO or 5′‐aza‐dC. The graph shows the nuclear levels of actin and profilin relative to Lamin A/C in MDA‐MB‐231 cells expressing RASSF1A. Error bars derive from two independent experiments and represent the SEM. Data information: Two‐tailed Student's t ‐test was used for statistical analysis.* P < 0.05, ** P < 0.01, *** P < 0.001. Source data are available online for this figure.

Article Snippet: The oligos used were as follows: siMST2: siGENOME SMARTpool: M‐004874‐02 (Dharmacon), siRASSF1A: GACCUCUGUGGCGACUU, siLaminA/C: sc35776 (Santa Cruz Biotechnology, Inc), siIPO9: EHU102331 (Sigma). siRNA against luciferase with the sequence GCCAUUCUAUCCUCUAGAGGAUG was used as control.

Techniques: Western Blot, Transfection, Plasmid Preparation, Control, Staining, Expressing, Two Tailed Test

Journal: The EMBO Journal

Article Title: RASSF 1A is required for the maintenance of nuclear actin levels

doi: 10.15252/embj.2018101168

Figure Lengend Snippet: qRT–PCR validation of selected genes known to be affected by the levels of nuclear actin. Transcript levels of MYL9 , ITGB1 , PAK1 and OCT4 from HeLa cells treated either with siRASSF1A or with siRASSF1A + siIPO9 are relative to GAPDH and normalised to siCTRL cells. Data represent SEM of three independent experiments. Adhesion assay. siRNA against RASSF1A significantly decreased HeLa cells’ adhesive rate at all the determined time points compared with control. The cells were cultured for 48 h before harvesting and reseeding for 1 h on 96‐well plates coated with FN. Data represent the SEM of three independent experiments. Representative immunofluorescence images of MRTF‐A localisation in siRASSF1A and siRASSF1A + siIPO9. Lower: the MRTF‐A localisation was scored as nuclear/cytoplasmic or predominantly cytoplasmic in 100‐200 cells. DNA was stained with DAPI. Error bars derive from two independent experiments and represent the SEM. Scale bars = 10 μm. Luciferase assay of SRF‐dependent promoter in cells transfected with siCTRL, siRASSF1A or siRASSF1A + siIPO9 following stimulation with 10% FBS for 5 h. Data are expressed as SRF luciferase activity relative to Renilla control and represent the SEM of two independent experiments. Data information: Two‐tailed Student's t ‐test was used for statistical analysis. * P < 0.05, ** P < 0.01.

Article Snippet: The oligos used were as follows: siMST2: siGENOME SMARTpool: M‐004874‐02 (Dharmacon), siRASSF1A: GACCUCUGUGGCGACUU, siLaminA/C: sc35776 (Santa Cruz Biotechnology, Inc), siIPO9: EHU102331 (Sigma). siRNA against luciferase with the sequence GCCAUUCUAUCCUCUAGAGGAUG was used as control.

Techniques: Quantitative RT-PCR, Biomarker Discovery, Cell Adhesion Assay, Adhesive, Control, Cell Culture, Immunofluorescence, Staining, Luciferase, Transfection, Activity Assay, Two Tailed Test

Journal: The EMBO Journal

Article Title: RASSF 1A is required for the maintenance of nuclear actin levels

doi: 10.15252/embj.2018101168

Figure Lengend Snippet: IPO9 mRNA levels in siIPO9‐transfected HeLa cells relative to GAPDH and normalised to control siRNA levels. Data represent the mean ± SEM of three independent experiments. Western blot analysis of actin protein levels following RASSF1A, IPO9 or RASSF1A/IPO9 knockdown in HeLa cells. Quantification of nuclear actin and IPO9 relative to Lamin A/C is shown. Error bars derive from three independent experiments and represent the SEM. Co‐immunoprecipitation of endogenous actin with endogenous MRTF‐A in siRASSF1A‐treated HeLa cells. SRF mRNA levels in siRASSF1A or siRASSF1A + siIPO9‐transfected HeLa cells relative to GAPDH and normalised to control siRNA levels. Data represent the mean ± SEM of three independent experiments. Data information: Two‐tailed Student's t ‐test was used for statistical analysis.* P < 0.05, ** P < 0.01. Source data are available online for this figure.

Article Snippet: The oligos used were as follows: siMST2: siGENOME SMARTpool: M‐004874‐02 (Dharmacon), siRASSF1A: GACCUCUGUGGCGACUU, siLaminA/C: sc35776 (Santa Cruz Biotechnology, Inc), siIPO9: EHU102331 (Sigma). siRNA against luciferase with the sequence GCCAUUCUAUCCUCUAGAGGAUG was used as control.

Techniques: Transfection, Control, Western Blot, Knockdown, Immunoprecipitation, Two Tailed Test