05604 Search Results


95
ATCC aaagtgtatattttacccttg abf3 agal bacteroides cellulosilyticus dsm 14838 baccell 05606 baccell 05604
Aaagtgtatattttacccttg Abf3 Agal Bacteroides Cellulosilyticus Dsm 14838 Baccell 05606 Baccell 05604, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aaagtgtatattttacccttg abf3 agal bacteroides cellulosilyticus dsm 14838 baccell 05606 baccell 05604/product/ATCC
Average 95 stars, based on 1 article reviews
aaagtgtatattttacccttg abf3 agal bacteroides cellulosilyticus dsm 14838 baccell 05606 baccell 05604 - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

90
Rockland Immunochemicals rabbit igg biotin antibody
Rabbit Igg Biotin Antibody, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit igg biotin antibody/product/Rockland Immunochemicals
Average 90 stars, based on 1 article reviews
rabbit igg biotin antibody - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier


N/A
Lenti ORF particles POU3F2 Myc DDK tagged Human POU class 3 homeobox 2 POU3F2 200ul 10 7 TU mL
  Buy from Supplier


N/A
qSTAR qPCR primer pairs against Mus musculus gene Gapdh
  Buy from Supplier

N/A
ADAMTS15 Overexpression Lysate
  Buy from Supplier

N/A
Mouse anti Human GDF15 Antibody, M onoclonal (6C1-9), is a Detection antibody could be used for ELISA, CLIA, LF, GICA, FIA.CLIA:100μg/4μg AEFLFIA: 1.0 mg/mL
  Buy from Supplier


N/A
Standard format Plasmid sent in bacteria as agar stab
  Buy from Supplier

N/A
Lenti ORF particles Nfkbie GFP tagged Mouse nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor epsilon Nfkbie 200ul 10 7 TU mL
  Buy from Supplier

N/A
DDT mouse monoclonal antibody clone 1H3 HRP conjugated
  Buy from Supplier

Image Search Results