95
|
ATCC
aaagtgtatattttacccttg abf3 agal bacteroides cellulosilyticus dsm 14838 baccell 05606 baccell 05604 Aaagtgtatattttacccttg Abf3 Agal Bacteroides Cellulosilyticus Dsm 14838 Baccell 05606 Baccell 05604, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aaagtgtatattttacccttg abf3 agal bacteroides cellulosilyticus dsm 14838 baccell 05606 baccell 05604/product/ATCC Average 95 stars, based on 1 article reviews
aaagtgtatattttacccttg abf3 agal bacteroides cellulosilyticus dsm 14838 baccell 05606 baccell 05604 - by Bioz Stars,
2026-02
95/100 stars
|
Buy from Supplier |
90
|
Rockland Immunochemicals
rabbit igg biotin antibody Rabbit Igg Biotin Antibody, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit igg biotin antibody/product/Rockland Immunochemicals Average 90 stars, based on 1 article reviews
rabbit igg biotin antibody - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
N/A
|
Lenti ORF particles POU3F2 Myc DDK tagged Human POU class 3 homeobox 2 POU3F2 200ul 10 7 TU mL
|
Buy from Supplier |
N/A
|
qSTAR qPCR primer pairs against Mus musculus gene Gapdh
|
Buy from Supplier |
N/A
|
ADAMTS15 Overexpression Lysate
|
Buy from Supplier |
N/A
|
Mouse anti Human GDF15 Antibody, M onoclonal (6C1-9), is a Detection antibody could be used for ELISA, CLIA, LF, GICA, FIA.CLIA:100μg/4μg AEFLFIA: 1.0 mg/mL
|
Buy from Supplier |
N/A
|
Standard format Plasmid sent in bacteria as agar stab
|
Buy from Supplier |
N/A
|
Lenti ORF particles Nfkbie GFP tagged Mouse nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor epsilon Nfkbie 200ul 10 7 TU mL
|
Buy from Supplier |
N/A
|
DDT mouse monoclonal antibody clone 1H3 HRP conjugated
|
Buy from Supplier |