zymotaq dna polymerase kit  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    ZymoTaq DNA Polymerase
    Description:
    ZymoTaq DNA Polymerase contains all the reagents needed to perform hot start PCR The inclusion of a heat activated thermostable DNA polymerase reduces primer dimer and nonspecific product formation that can occur during PCR This unique product is specifically designed for the amplification of bisulfite treated DNA for methylation detection but is applicable for conventional PCR The product generates specific amplicons with little or no by product formation Simple and easy to use Heat at 95°C for 10 minutes to initiate polymerization ZymoTaq DNA Polymerase is a heat activated hot start polymerase that has 3 terminal transferase activity The addition of A overhangs to amplified DNA makes it ideal for use in TA cloning
    Catalog Number:
    e2002
    Price:
    None
    Applications:
    PCR
    Size:
    50 units
    Category:
    Life Science Reagents and Media
    Buy from Supplier


    Structured Review

    Zymo Research zymotaq dna polymerase kit
    ZymoTaq DNA Polymerase
    ZymoTaq DNA Polymerase contains all the reagents needed to perform hot start PCR The inclusion of a heat activated thermostable DNA polymerase reduces primer dimer and nonspecific product formation that can occur during PCR This unique product is specifically designed for the amplification of bisulfite treated DNA for methylation detection but is applicable for conventional PCR The product generates specific amplicons with little or no by product formation Simple and easy to use Heat at 95°C for 10 minutes to initiate polymerization ZymoTaq DNA Polymerase is a heat activated hot start polymerase that has 3 terminal transferase activity The addition of A overhangs to amplified DNA makes it ideal for use in TA cloning
    https://www.bioz.com/result/zymotaq dna polymerase kit/product/Zymo Research
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    zymotaq dna polymerase kit - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Methylation Sequencing:

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: Paragraph title: Bisulfite sequencing ... Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research).

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Paragraph title: DNA methylation assay with bisulfite sequencing ... Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs.

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: Paragraph title: Bisulfite sequencing ... Four microlitres of treated DNA was amplified by PCR using primers specific to the bisulfite-converted DNA for each promoter region with ZymoTaq DNA Polymerase (Zymo Research).

    Article Title: Genome-wide DNA methylation analysis in cohesin mutant human cell lines
    Article Snippet: Paragraph title: Bisulfite sequencing validation ... Hot-start touchdown PCR was done in 25 μl reaction containing 0.25 mM dNTPs, 1× buffer, 0.4 μM forward and reverse primers and 1 U of ZymoTaq ™ DNA Polymerase (Zymo Research).

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: Paragraph title: Bisulfite Sequencing Polymerase Chain Reaction (BSP) ... We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP.

    Article Title: Hypomethylation of ETS Transcription Factor Binding Sites and Upregulation of PARP1 Expression in Endometrial Cancer
    Article Snippet: Paragraph title: 2.4. Bisulfite Sequencing ... PCR amplification was performed using the special Hot-Start DNA polymerase (ZymoTaq Premix, Zymo Research) with the following reaction conditions: 95°C for 2 min; 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 45 s; then 72°C for 7 min. Two pairs of primers were used: round I, 5′-TTGGGATAGAATAATTAAAG-3′ (F) and 5′-AACTTTTCCTACAACATCAA-3′ (R); round II, 5′-TAGAATAATTAAAGGGGTGG-3′ (F) and R: 5′-ACAACATCAACAAAACCTT-3′ (R).

    Clone Assay:

    Article Title: The effect of promoter methylation on MdMYB1 expression determines the level of anthocyanin accumulation in skins of two non-red apple cultivars
    Article Snippet: The treated DNA was used as template, and the MdMYB1 promoter fragments were amplified using ZymoTaq DNA Polymerase (Zymo Research Corp.). .. The PCR products were cloned into the PMD18-T vector (TaKaRa) and then sequenced.

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research). .. The PCR products were size verified, gel purified using the QIAQuick Gel Extraction Kit (Qiagen) and the purified PCR product subcloned into either the pCR® 2.1-TOPO vector using the TOPO cloning kit (Invitrogen) or pGEM-T vector (Promega).

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs. .. Purified PCR products were cloned into the pCR4-TOPO vector with TOPO TA Cloning Kit (Invitrogen) for subsequent sequencing.

    Article Title: A PRDX1 mutant allele causes a MMACHC secondary epimutation in cblC patients
    Article Snippet: Determination of DNA methylation The methylation status of the CpG island in the 5′-region of the MMACHC gene (RefSeq: Chr1:45,965,587 to Chr1:45,966,049) was determined by bisulfite conversion, cloning, and sequencing of individual clones. .. The bisulfite-treated DNA was amplified by PCR (primers: forward 5′-TTAAATTTGTGTTAGTGATAATTGT-3′, reverse 5′-AACTAACCTAAAAAAAATAAACCTC-3′) using ZymoTaq DNA Polymerase (Zymo Research).

    Article Title: Genome-wide DNA methylation analysis in cohesin mutant human cell lines
    Article Snippet: Hot-start touchdown PCR was done in 25 μl reaction containing 0.25 mM dNTPs, 1× buffer, 0.4 μM forward and reverse primers and 1 U of ZymoTaq ™ DNA Polymerase (Zymo Research). .. After that, amplification was continued with 36 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min, then ended with 72°C for 15–20 min. PCR products were verified by gel electrophoresis, 2 ul PCR product was subsequently cloned into pGEM-T vector and transformed into JM109 cells according to the manufacturer’s instruction (Promega).

    Article Title: Hypomethylation of ETS Transcription Factor Binding Sites and Upregulation of PARP1 Expression in Endometrial Cancer
    Article Snippet: PCR amplification was performed using the special Hot-Start DNA polymerase (ZymoTaq Premix, Zymo Research) with the following reaction conditions: 95°C for 2 min; 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 45 s; then 72°C for 7 min. Two pairs of primers were used: round I, 5′-TTGGGATAGAATAATTAAAG-3′ (F) and 5′-AACTTTTCCTACAACATCAA-3′ (R); round II, 5′-TAGAATAATTAAAGGGGTGG-3′ (F) and R: 5′-ACAACATCAACAAAACCTT-3′ (R). .. Ten positive clones of each sample were selected and sequenced on an ABI 3730 automated sequencer.

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC). .. The PCR products were TOPO cloned using the TOPO TA cloning kit (Invitrogen), and individual clones were subjected to Sanger sequencing using the M13 Forward primer.

    Amplification:

    Article Title: Focused, high accuracy 5-methylcytosine quantitation with base resolution by benchtop next-generation sequencing
    Article Snippet: .. PCR amplification of these regions was achieved by using ZymoTaq DNA polymerase, a DNA polymerase capable of amplifying low diversity DNA, specifically bisulfite converted DNA (Zymo Research, Irvine, CA, USA). ..

    Article Title: The effect of promoter methylation on MdMYB1 expression determines the level of anthocyanin accumulation in skins of two non-red apple cultivars
    Article Snippet: .. The treated DNA was used as template, and the MdMYB1 promoter fragments were amplified using ZymoTaq DNA Polymerase (Zymo Research Corp.). .. The PCR products were cloned into the PMD18-T vector (TaKaRa) and then sequenced.

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: .. Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research). ..

    Article Title: A PRDX1 mutant allele causes a MMACHC secondary epimutation in cblC patients
    Article Snippet: .. The bisulfite-treated DNA was amplified by PCR (primers: forward 5′-TTAAATTTGTGTTAGTGATAATTGT-3′, reverse 5′-AACTAACCTAAAAAAAATAAACCTC-3′) using ZymoTaq DNA Polymerase (Zymo Research). .. The amplicon was inserted into the pCR4-TOPO vector (Invitrogen, Life Technologies, Courtaboeuf, France), and individual clones were sequenced in both directions using universal M13 primers and the BigDye Terminator v.3.1 Sequencing Kit (Applied Biosystems, Courtaboeuf, France).

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: .. Four microlitres of treated DNA was amplified by PCR using primers specific to the bisulfite-converted DNA for each promoter region with ZymoTaq DNA Polymerase (Zymo Research). .. The conditions for the PCR were as follows: pre-denaturing step of 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 55–60 °C for 40 sec and 72 °C for 40 s, with a final extension at 72 °C for 7 min.

    Article Title: Genome-wide DNA methylation analysis in cohesin mutant human cell lines
    Article Snippet: Hot-start touchdown PCR was done in 25 μl reaction containing 0.25 mM dNTPs, 1× buffer, 0.4 μM forward and reverse primers and 1 U of ZymoTaq ™ DNA Polymerase (Zymo Research). .. After that, amplification was continued with 36 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min, then ended with 72°C for 15–20 min. PCR products were verified by gel electrophoresis, 2 ul PCR product was subsequently cloned into pGEM-T vector and transformed into JM109 cells according to the manufacturer’s instruction (Promega).

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: The modified DNA samples were diluted in 10 μL of distilled water and immediately used in BSP or stored at −80°C until PCR amplification. .. We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP.

    Article Title: Hypomethylation of ETS Transcription Factor Binding Sites and Upregulation of PARP1 Expression in Endometrial Cancer
    Article Snippet: .. PCR amplification was performed using the special Hot-Start DNA polymerase (ZymoTaq Premix, Zymo Research) with the following reaction conditions: 95°C for 2 min; 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 45 s; then 72°C for 7 min. Two pairs of primers were used: round I, 5′-TTGGGATAGAATAATTAAAG-3′ (F) and 5′-AACTTTTCCTACAACATCAA-3′ (R); round II, 5′-TAGAATAATTAAAGGGGTGG-3′ (F) and R: 5′-ACAACATCAACAAAACCTT-3′ (R). .. The PCR fragment was ligated into a pMD18-T Vector (TaKaRa), and the recombinant plasmid was transformed into JM109 cells (TaKaRa).

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: .. The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC). .. The PCR products were TOPO cloned using the TOPO TA cloning kit (Invitrogen), and individual clones were subjected to Sanger sequencing using the M13 Forward primer.

    Article Title: Low dose antigen promotes induction of FOXP3 in human CD4+ T cells
    Article Snippet: The region of the FOXP3 promoter immediately upstream of the transcription start site was amplified using bisulfite forward and reverse primers: PROMF-GTGAAGTGGATTGATAGAAAAGGATTA and PROMR-CATTTAAATCTCATAATCAAAAAAAA. .. PCR was performed in 25µL containing 1 X PCR buffer, 1U ZymoTaq DNA polymerase (Zymo Research), bisulfite-converted genomic DNA, dNTP at a final concentration of 1mM, and forward and reverse primers at 1mM each.

    Whole Genome Amplification:

    Article Title: LINE-1 methylation in peripheral blood leukocytes and clinical characteristics and prognosis of prostate cancer patients
    Article Snippet: PCR reactions were performed with ZymoTaq DNA Polymerase kit (Zymo Research, Irvine, CA) using 2 μl of bisulfite-treated DNA in a total volume of 15 μl, and the entire volume was used for each pyrosequencing reaction. .. Controls for high methylation (SssI-treated DNA), low methylation (WGA-amplified DNA) and no-DNA template were included in each run.

    Synthesized:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Lambda DNA Preparation:

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: Condition test using 4mC or 5mC-containing model DNA The 304 bp DNA with 4mC and CpG methylated lambda DNA were prepared as described above. .. The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC).

    TA Cloning:

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs. .. Purified PCR products were cloned into the pCR4-TOPO vector with TOPO TA Cloning Kit (Invitrogen) for subsequent sequencing.

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC). .. The PCR products were TOPO cloned using the TOPO TA cloning kit (Invitrogen), and individual clones were subjected to Sanger sequencing using the M13 Forward primer.

    Article Title: Low dose antigen promotes induction of FOXP3 in human CD4+ T cells
    Article Snippet: PCR was performed in 25µL containing 1 X PCR buffer, 1U ZymoTaq DNA polymerase (Zymo Research), bisulfite-converted genomic DNA, dNTP at a final concentration of 1mM, and forward and reverse primers at 1mM each. .. TSDR and promoter region PCR products were Exo-SAP purified (USB Corp) and subcloned using a TOPO TA Cloning Kit (Invitrogen), and the DNA from individual bacterial colonies were sequenced with M13 forward primer using Big Dye Terminator v1.1 chemistry (Applied Biosystems).

    Electrophoresis:

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs. .. PCR products were run on 1% (w/v) agarose gel in 1×TAE buffer by electrophoresis at 100 V. DNA fragments of interest were purified from the gel with Wizard SV Gel and PCR Clean-Up System (Promega), according to the manufacturer's instructions.

    Incubation:

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: The reactions were incubated at 37°C for 1.5 h. After proteinase K treatment, the oxidized DNA was purified with Micro Bio-Spin 30 Columns (Bio-Rad) and then by QIAquick PCR Purification Kit (QIAGEN). .. The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC).

    Activity Assay:

    Article Title: H19 lncRNA alters DNA methylation genome wide by regulating S-adenosylhomocysteine hydrolase
    Article Snippet: Production of RNA fragments for in vitro analyses Zymo Taq DNA polymerase (Zymo Research, E2001) was used to amplify hURE (128 nucleotide (nt)), mURE (122 nt) and hNSE (131 nt) using plasmid DNA containing human or mouse (accession no. NR_001592) H19 sequences as PCR templates. .. RNA fragments for EMSA and in vitro rSAHH activity analysis were generated by in vitro transcription using the T7 MEGAscript Kit (Ambion, AM1334).

    Expressing:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: To confirm the results from MeDIP-seq, six BSP primers were designed by the online MethPrimer software , including three genes with upregulated methylation and consequential downregulation of expression (P1–P3) and three genes with downregulated methylation and consequential upregulation of expression (P4–P6). .. We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP.

    Genome Wide:

    Article Title: A PRDX1 mutant allele causes a MMACHC secondary epimutation in cblC patients
    Article Snippet: The bisulfite-treated DNA was amplified by PCR (primers: forward 5′-TTAAATTTGTGTTAGTGATAATTGT-3′, reverse 5′-AACTAACCTAAAAAAAATAAACCTC-3′) using ZymoTaq DNA Polymerase (Zymo Research). .. Methylome analysis for genome-wide profiling of bisulfite-converted DNA was determined using the Infinium HumanMethylation450 BeadChip array (Illumina, Paris, France), according to the manufacturer’s instructions.

    Modification:

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: The modified DNA samples were diluted in 10 μL of distilled water and immediately used in BSP or stored at −80°C until PCR amplification. .. We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP.

    Article Title: Low dose antigen promotes induction of FOXP3 in human CD4+ T cells
    Article Snippet: The TSDR (Treg cell-specific demethylated region) was amplified using bisulfite forward and reverse primers: Amp5A1F–TTTGGGGGTAGAGGATTTAGAG and Amp5A1R–CCACCTAAACCAAACCTACTACAA (modified from Baron, et al. ( )). .. PCR was performed in 25µL containing 1 X PCR buffer, 1U ZymoTaq DNA polymerase (Zymo Research), bisulfite-converted genomic DNA, dNTP at a final concentration of 1mM, and forward and reverse primers at 1mM each.

    Filtration:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Transformation Assay:

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs. .. Plasmids including the DNA fragments of interest were transformed into the chemically competent One Shot TOP10 cells provided by the kit, according to the manufacturer's instructions.

    Article Title: Genome-wide DNA methylation analysis in cohesin mutant human cell lines
    Article Snippet: Hot-start touchdown PCR was done in 25 μl reaction containing 0.25 mM dNTPs, 1× buffer, 0.4 μM forward and reverse primers and 1 U of ZymoTaq ™ DNA Polymerase (Zymo Research). .. After that, amplification was continued with 36 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min, then ended with 72°C for 15–20 min. PCR products were verified by gel electrophoresis, 2 ul PCR product was subsequently cloned into pGEM-T vector and transformed into JM109 cells according to the manufacturer’s instruction (Promega).

    Article Title: Hypomethylation of ETS Transcription Factor Binding Sites and Upregulation of PARP1 Expression in Endometrial Cancer
    Article Snippet: PCR amplification was performed using the special Hot-Start DNA polymerase (ZymoTaq Premix, Zymo Research) with the following reaction conditions: 95°C for 2 min; 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 45 s; then 72°C for 7 min. Two pairs of primers were used: round I, 5′-TTGGGATAGAATAATTAAAG-3′ (F) and 5′-AACTTTTCCTACAACATCAA-3′ (R); round II, 5′-TAGAATAATTAAAGGGGTGG-3′ (F) and R: 5′-ACAACATCAACAAAACCTT-3′ (R). .. The PCR fragment was ligated into a pMD18-T Vector (TaKaRa), and the recombinant plasmid was transformed into JM109 cells (TaKaRa).

    Gel Purification:

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP. .. The PCR products were gel purified using a Gel Purification Kit (Sangon, Shanghai, China).

    Touchdown PCR:

    Article Title: Genome-wide DNA methylation analysis in cohesin mutant human cell lines
    Article Snippet: .. Hot-start touchdown PCR was done in 25 μl reaction containing 0.25 mM dNTPs, 1× buffer, 0.4 μM forward and reverse primers and 1 U of ZymoTaq ™ DNA Polymerase (Zymo Research). ..

    Generated:

    Article Title: H19 lncRNA alters DNA methylation genome wide by regulating S-adenosylhomocysteine hydrolase
    Article Snippet: Production of RNA fragments for in vitro analyses Zymo Taq DNA polymerase (Zymo Research, E2001) was used to amplify hURE (128 nucleotide (nt)), mURE (122 nt) and hNSE (131 nt) using plasmid DNA containing human or mouse (accession no. NR_001592) H19 sequences as PCR templates. .. RNA fragments for EMSA and in vitro rSAHH activity analysis were generated by in vitro transcription using the T7 MEGAscript Kit (Ambion, AM1334).

    Sequencing:

    Article Title: The effect of promoter methylation on MdMYB1 expression determines the level of anthocyanin accumulation in skins of two non-red apple cultivars
    Article Snippet: Methylation analysis Bisulfite sequencing-PCR was used to analyze methylation in the MdMYB1 promoter, and was performed as described by Telias et al. [ ] and Wang et al. [ ]. .. The treated DNA was used as template, and the MdMYB1 promoter fragments were amplified using ZymoTaq DNA Polymerase (Zymo Research Corp.).

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Article Title: LINE-1 methylation in peripheral blood leukocytes and clinical characteristics and prognosis of prostate cancer patients
    Article Snippet: The assayed LINE-1 sequence was TT CG TGGTG CG T CG , which contained three CpG sites. .. PCR reactions were performed with ZymoTaq DNA Polymerase kit (Zymo Research, Irvine, CA) using 2 μl of bisulfite-treated DNA in a total volume of 15 μl, and the entire volume was used for each pyrosequencing reaction.

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs. .. Purified PCR products were cloned into the pCR4-TOPO vector with TOPO TA Cloning Kit (Invitrogen) for subsequent sequencing.

    Article Title: A PRDX1 mutant allele causes a MMACHC secondary epimutation in cblC patients
    Article Snippet: Determination of DNA methylation The methylation status of the CpG island in the 5′-region of the MMACHC gene (RefSeq: Chr1:45,965,587 to Chr1:45,966,049) was determined by bisulfite conversion, cloning, and sequencing of individual clones. .. The bisulfite-treated DNA was amplified by PCR (primers: forward 5′-TTAAATTTGTGTTAGTGATAATTGT-3′, reverse 5′-AACTAACCTAAAAAAAATAAACCTC-3′) using ZymoTaq DNA Polymerase (Zymo Research).

    Article Title: H19 lncRNA alters DNA methylation genome wide by regulating S-adenosylhomocysteine hydrolase
    Article Snippet: Production of RNA fragments for in vitro analyses Zymo Taq DNA polymerase (Zymo Research, E2001) was used to amplify hURE (128 nucleotide (nt)), mURE (122 nt) and hNSE (131 nt) using plasmid DNA containing human or mouse (accession no. NR_001592) H19 sequences as PCR templates. .. All forward primers contained a T7 promoter sequence ( ).

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: Four microlitres of treated DNA was amplified by PCR using primers specific to the bisulfite-converted DNA for each promoter region with ZymoTaq DNA Polymerase (Zymo Research). .. PCR products were resolved in 1% agarose gels followed by sequencing for methylation analysis, which was performed by Secugen SL (CIB, Madrid).

    Article Title: Genome-wide DNA methylation analysis in cohesin mutant human cell lines
    Article Snippet: The genomic addresses and sequence information of each CpG dinucleotide on the BeadChip were downloaded from the company’s database (Illumina); ±200 bp surrounding the target CpG of CAPN2 and LMO2 were retrieved from the UCSC genome database ( http://genome.ucsc.edu/ ) and used as template sequence to design polymerase chain reaction (PCR) primers. .. Hot-start touchdown PCR was done in 25 μl reaction containing 0.25 mM dNTPs, 1× buffer, 0.4 μM forward and reverse primers and 1 U of ZymoTaq ™ DNA Polymerase (Zymo Research).

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC). .. The PCR products were TOPO cloned using the TOPO TA cloning kit (Invitrogen), and individual clones were subjected to Sanger sequencing using the M13 Forward primer.

    Sonication:

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: Oxidation reactions were performed in a 50 μl solution with 50 mM HEPES buffer (pH 8.0), 100 μM ammonium iron (II) sulfate, 1 mM α-ketoglutarate, 2 mM ascorbic acid, 2.5 mM DTT, 100 mM NaCl, 1.2 mM ATP, 6 ng/μl sonicated mouse embryonic stem cells (mESC) genomic DNA with 0.5% (w/w) 4mC or 5mC-containing model DNA and 4.5 μM Tet. .. The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC).

    Recombinant:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Article Title: Hypomethylation of ETS Transcription Factor Binding Sites and Upregulation of PARP1 Expression in Endometrial Cancer
    Article Snippet: PCR amplification was performed using the special Hot-Start DNA polymerase (ZymoTaq Premix, Zymo Research) with the following reaction conditions: 95°C for 2 min; 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 45 s; then 72°C for 7 min. Two pairs of primers were used: round I, 5′-TTGGGATAGAATAATTAAAG-3′ (F) and 5′-AACTTTTCCTACAACATCAA-3′ (R); round II, 5′-TAGAATAATTAAAGGGGTGG-3′ (F) and R: 5′-ACAACATCAACAAAACCTT-3′ (R). .. The PCR fragment was ligated into a pMD18-T Vector (TaKaRa), and the recombinant plasmid was transformed into JM109 cells (TaKaRa).

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: The recombinant catalytic domain of mouse Tet1 protein (Tet) was expressed and purified as previously described ( ). .. The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC).

    DNA Extraction:

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: Bisulfite sequencing Genomic DNA was isolated from SaOS-2 and U2OS cells using the Genomic DNA Isolation Kit (Zymo Research). .. Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research).

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: DNA methylation assay with bisulfite sequencing Genomic DNA isolation from B13 cells with no Ad-PNM and from B13 cells with 3 days after Ad-PNM, RIN-m5F cells or IRPT cells was performed with QIAamp DNA Mini Kit (Qiagen), according to the manufacturer's instructions. .. Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs.

    Nucleic Acid Electrophoresis:

    Article Title: Genome-wide DNA methylation analysis in cohesin mutant human cell lines
    Article Snippet: Hot-start touchdown PCR was done in 25 μl reaction containing 0.25 mM dNTPs, 1× buffer, 0.4 μM forward and reverse primers and 1 U of ZymoTaq ™ DNA Polymerase (Zymo Research). .. After that, amplification was continued with 36 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min, then ended with 72°C for 15–20 min. PCR products were verified by gel electrophoresis, 2 ul PCR product was subsequently cloned into pGEM-T vector and transformed into JM109 cells according to the manufacturer’s instruction (Promega).

    Methylated DNA Immunoprecipitation Sequencing:

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: To confirm the results from MeDIP-seq, six BSP primers were designed by the online MethPrimer software , including three genes with upregulated methylation and consequential downregulation of expression (P1–P3) and three genes with downregulated methylation and consequential upregulation of expression (P4–P6). .. We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP.

    DNA Purification:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Methylation:

    Article Title: Focused, high accuracy 5-methylcytosine quantitation with base resolution by benchtop next-generation sequencing
    Article Snippet: In all, 200 ng of methylated controls or 1 μg of genomic DNA (rat or mouse) were bisulfite converted using EZ DNA Methylation according to manufacturer’s protocol (Zymo Research, Irvine, CA, USA). .. PCR amplification of these regions was achieved by using ZymoTaq DNA polymerase, a DNA polymerase capable of amplifying low diversity DNA, specifically bisulfite converted DNA (Zymo Research, Irvine, CA, USA).

    Article Title: The effect of promoter methylation on MdMYB1 expression determines the level of anthocyanin accumulation in skins of two non-red apple cultivars
    Article Snippet: Paragraph title: Methylation analysis ... The treated DNA was used as template, and the MdMYB1 promoter fragments were amplified using ZymoTaq DNA Polymerase (Zymo Research Corp.).

    Article Title: LINE-1 methylation in peripheral blood leukocytes and clinical characteristics and prognosis of prostate cancer patients
    Article Snippet: Paragraph title: Methylation analysis with pyrosequencing ... PCR reactions were performed with ZymoTaq DNA Polymerase kit (Zymo Research, Irvine, CA) using 2 μl of bisulfite-treated DNA in a total volume of 15 μl, and the entire volume was used for each pyrosequencing reaction.

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Bisulfite conversion of isolated genomic DNA was performed with the EZ DNA methylation-gold kit (Zymo Research), according to the manufacturer's instructions. .. Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs.

    Article Title: A PRDX1 mutant allele causes a MMACHC secondary epimutation in cblC patients
    Article Snippet: Six-hundred nanograms of genomic DNA was converted by bisulfite using the EZ DNA Methylation-Gold kit (Zymo Research, Proteigene, Saint-Marcel, France). .. The bisulfite-treated DNA was amplified by PCR (primers: forward 5′-TTAAATTTGTGTTAGTGATAATTGT-3′, reverse 5′-AACTAACCTAAAAAAAATAAACCTC-3′) using ZymoTaq DNA Polymerase (Zymo Research).

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: Genomic DNA from 8 ×104 cells was bisulfite-modified using the EZ DNA Methylation-Direct Kit (Zymo Research). .. Four microlitres of treated DNA was amplified by PCR using primers specific to the bisulfite-converted DNA for each promoter region with ZymoTaq DNA Polymerase (Zymo Research).

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: To confirm the results from MeDIP-seq, six BSP primers were designed by the online MethPrimer software , including three genes with upregulated methylation and consequential downregulation of expression (P1–P3) and three genes with downregulated methylation and consequential upregulation of expression (P4–P6). .. We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP.

    Article Title: Hypomethylation of ETS Transcription Factor Binding Sites and Upregulation of PARP1 Expression in Endometrial Cancer
    Article Snippet: Sodium bisulfite conversion was performed using the EZ DNA Methylation-Direct kit (Zymo research, Orange, USA) according to the manufacturer's protocol. .. PCR amplification was performed using the special Hot-Start DNA polymerase (ZymoTaq Premix, Zymo Research) with the following reaction conditions: 95°C for 2 min; 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 45 s; then 72°C for 7 min. Two pairs of primers were used: round I, 5′-TTGGGATAGAATAATTAAAG-3′ (F) and 5′-AACTTTTCCTACAACATCAA-3′ (R); round II, 5′-TAGAATAATTAAAGGGGTGG-3′ (F) and R: 5′-ACAACATCAACAAAACCTT-3′ (R).

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: Condition test using 4mC or 5mC-containing model DNA The 304 bp DNA with 4mC and CpG methylated lambda DNA were prepared as described above. .. The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC).

    Article Title: Low dose antigen promotes induction of FOXP3 in human CD4+ T cells
    Article Snippet: Paragraph title: Methylation analysis ... PCR was performed in 25µL containing 1 X PCR buffer, 1U ZymoTaq DNA polymerase (Zymo Research), bisulfite-converted genomic DNA, dNTP at a final concentration of 1mM, and forward and reverse primers at 1mM each.

    Isolation:

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: Bisulfite sequencing Genomic DNA was isolated from SaOS-2 and U2OS cells using the Genomic DNA Isolation Kit (Zymo Research). .. Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research).

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Bisulfite conversion of isolated genomic DNA was performed with the EZ DNA methylation-gold kit (Zymo Research), according to the manufacturer's instructions. .. Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs.

    Article Title: Low dose antigen promotes induction of FOXP3 in human CD4+ T cells
    Article Snippet: Genomic DNA was isolated by DNeasy Blood and Tissue Kit (Qiagen) and bisulfite converted using the EpiTect Bisulfite Kit (Qiagen) according to the manufacturers’ instructions. .. PCR was performed in 25µL containing 1 X PCR buffer, 1U ZymoTaq DNA polymerase (Zymo Research), bisulfite-converted genomic DNA, dNTP at a final concentration of 1mM, and forward and reverse primers at 1mM each.

    Size-exclusion Chromatography:

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research). .. The other amplification parameters were identical: pre-incubation for 95°C for 10 min.; denaturation at 95°C for 30 sec; extension at 63°C for 30 sec.

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: Four microlitres of treated DNA was amplified by PCR using primers specific to the bisulfite-converted DNA for each promoter region with ZymoTaq DNA Polymerase (Zymo Research). .. The conditions for the PCR were as follows: pre-denaturing step of 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 55–60 °C for 40 sec and 72 °C for 40 s, with a final extension at 72 °C for 7 min.

    Purification:

    Article Title: Focused, high accuracy 5-methylcytosine quantitation with base resolution by benchtop next-generation sequencing
    Article Snippet: PCR amplification of these regions was achieved by using ZymoTaq DNA polymerase, a DNA polymerase capable of amplifying low diversity DNA, specifically bisulfite converted DNA (Zymo Research, Irvine, CA, USA). .. PCR products were purified by QIAquick PCR columns, to eliminate primers and enzymes, and eluted in 30 μl elution buffer (Qiagen, Germantown, MD, USA).

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Article Title: LINE-1 methylation in peripheral blood leukocytes and clinical characteristics and prognosis of prostate cancer patients
    Article Snippet: PCR reactions were performed with ZymoTaq DNA Polymerase kit (Zymo Research, Irvine, CA) using 2 μl of bisulfite-treated DNA in a total volume of 15 μl, and the entire volume was used for each pyrosequencing reaction. .. In preparation for the pyrosequencing reaction, PCR product purification was done with streptavidin-sepharose high-performance beads (GE Healthcare Life Sciences, Piscataway, NJ), and co-denaturation of the biotinylated PCR products and sequencing primer (3.6 pmol/reaction) was conducted following the PSQ96 sample preparation guide.

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research). .. The PCR products were size verified, gel purified using the QIAQuick Gel Extraction Kit (Qiagen) and the purified PCR product subcloned into either the pCR® 2.1-TOPO vector using the TOPO cloning kit (Invitrogen) or pGEM-T vector (Promega).

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs. .. PCR products were run on 1% (w/v) agarose gel in 1×TAE buffer by electrophoresis at 100 V. DNA fragments of interest were purified from the gel with Wizard SV Gel and PCR Clean-Up System (Promega), according to the manufacturer's instructions.

    Article Title: H19 lncRNA alters DNA methylation genome wide by regulating S-adenosylhomocysteine hydrolase
    Article Snippet: Production of RNA fragments for in vitro analyses Zymo Taq DNA polymerase (Zymo Research, E2001) was used to amplify hURE (128 nucleotide (nt)), mURE (122 nt) and hNSE (131 nt) using plasmid DNA containing human or mouse (accession no. NR_001592) H19 sequences as PCR templates. .. The PCR products were purified using Zymo DNA clean and concentrator kit (Zymo Research, D4003) and used as templates for subsequent in vitro transcription.

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP. .. The PCR products were gel purified using a Gel Purification Kit (Sangon, Shanghai, China).

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: .. The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC). .. The PCR products were TOPO cloned using the TOPO TA cloning kit (Invitrogen), and individual clones were subjected to Sanger sequencing using the M13 Forward primer.

    Article Title: Low dose antigen promotes induction of FOXP3 in human CD4+ T cells
    Article Snippet: PCR was performed in 25µL containing 1 X PCR buffer, 1U ZymoTaq DNA polymerase (Zymo Research), bisulfite-converted genomic DNA, dNTP at a final concentration of 1mM, and forward and reverse primers at 1mM each. .. TSDR and promoter region PCR products were Exo-SAP purified (USB Corp) and subcloned using a TOPO TA Cloning Kit (Invitrogen), and the DNA from individual bacterial colonies were sequenced with M13 forward primer using Big Dye Terminator v1.1 chemistry (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Focused, high accuracy 5-methylcytosine quantitation with base resolution by benchtop next-generation sequencing
    Article Snippet: .. PCR amplification of these regions was achieved by using ZymoTaq DNA polymerase, a DNA polymerase capable of amplifying low diversity DNA, specifically bisulfite converted DNA (Zymo Research, Irvine, CA, USA). ..

    Article Title: The effect of promoter methylation on MdMYB1 expression determines the level of anthocyanin accumulation in skins of two non-red apple cultivars
    Article Snippet: The treated DNA was used as template, and the MdMYB1 promoter fragments were amplified using ZymoTaq DNA Polymerase (Zymo Research Corp.). .. The PCR products were cloned into the PMD18-T vector (TaKaRa) and then sequenced.

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! .. QIAquick PCR purification kit (Qiagen, cat. no. 28104) MinElute gel extraction kit (Qiagen, cat. no. 28004) HEPES (500 mM and 1 M, pH 8.0; GenScript, cat. no. ) MgCl2 ·6H2 O (Fluka, cat. no. 63064; dissolved in H2 O at 250 mM) β-GT protection buffer 10× (Reagent Setup) T4 Phage β-GT (T4-βGT; NEB, cat. no. M0357S) UDP-glucose (Wako, cat. no. EPL1144; dissolved in H2 O at 10 mM) ▲ CRITICAL UDP-glucose should be stored at − 20 °C.

    Article Title: LINE-1 methylation in peripheral blood leukocytes and clinical characteristics and prognosis of prostate cancer patients
    Article Snippet: .. PCR reactions were performed with ZymoTaq DNA Polymerase kit (Zymo Research, Irvine, CA) using 2 μl of bisulfite-treated DNA in a total volume of 15 μl, and the entire volume was used for each pyrosequencing reaction. .. Controls for high methylation (SssI-treated DNA), low methylation (WGA-amplified DNA) and no-DNA template were included in each run.

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research). .. The PCR products were size verified, gel purified using the QIAQuick Gel Extraction Kit (Qiagen) and the purified PCR product subcloned into either the pCR® 2.1-TOPO vector using the TOPO cloning kit (Invitrogen) or pGEM-T vector (Promega).

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: To amplify the bisulfite-treated genomic DNA, PCR was performed as follows: 95°C for 10 min initial denaturation, 95°C for 30 s denaturation, 50°C for 40 s annealing, 72°C for 1 min extension and 72°C for 7 min final extension, and overall 40 cycles were performed. .. Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs.

    Article Title: A PRDX1 mutant allele causes a MMACHC secondary epimutation in cblC patients
    Article Snippet: .. The bisulfite-treated DNA was amplified by PCR (primers: forward 5′-TTAAATTTGTGTTAGTGATAATTGT-3′, reverse 5′-AACTAACCTAAAAAAAATAAACCTC-3′) using ZymoTaq DNA Polymerase (Zymo Research). .. The amplicon was inserted into the pCR4-TOPO vector (Invitrogen, Life Technologies, Courtaboeuf, France), and individual clones were sequenced in both directions using universal M13 primers and the BigDye Terminator v.3.1 Sequencing Kit (Applied Biosystems, Courtaboeuf, France).

    Article Title: H19 lncRNA alters DNA methylation genome wide by regulating S-adenosylhomocysteine hydrolase
    Article Snippet: .. Production of RNA fragments for in vitro analyses Zymo Taq DNA polymerase (Zymo Research, E2001) was used to amplify hURE (128 nucleotide (nt)), mURE (122 nt) and hNSE (131 nt) using plasmid DNA containing human or mouse (accession no. NR_001592) H19 sequences as PCR templates. .. All forward primers contained a T7 promoter sequence ( ).

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: .. Four microlitres of treated DNA was amplified by PCR using primers specific to the bisulfite-converted DNA for each promoter region with ZymoTaq DNA Polymerase (Zymo Research). .. The conditions for the PCR were as follows: pre-denaturing step of 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 55–60 °C for 40 sec and 72 °C for 40 s, with a final extension at 72 °C for 7 min.

    Article Title: Genome-wide DNA methylation analysis in cohesin mutant human cell lines
    Article Snippet: The genomic addresses and sequence information of each CpG dinucleotide on the BeadChip were downloaded from the company’s database (Illumina); ±200 bp surrounding the target CpG of CAPN2 and LMO2 were retrieved from the UCSC genome database ( http://genome.ucsc.edu/ ) and used as template sequence to design polymerase chain reaction (PCR) primers. .. Hot-start touchdown PCR was done in 25 μl reaction containing 0.25 mM dNTPs, 1× buffer, 0.4 μM forward and reverse primers and 1 U of ZymoTaq ™ DNA Polymerase (Zymo Research).

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: Paragraph title: Bisulfite Sequencing Polymerase Chain Reaction (BSP) ... We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP.

    Article Title: Hypomethylation of ETS Transcription Factor Binding Sites and Upregulation of PARP1 Expression in Endometrial Cancer
    Article Snippet: .. PCR amplification was performed using the special Hot-Start DNA polymerase (ZymoTaq Premix, Zymo Research) with the following reaction conditions: 95°C for 2 min; 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 45 s; then 72°C for 7 min. Two pairs of primers were used: round I, 5′-TTGGGATAGAATAATTAAAG-3′ (F) and 5′-AACTTTTCCTACAACATCAA-3′ (R); round II, 5′-TAGAATAATTAAAGGGGTGG-3′ (F) and R: 5′-ACAACATCAACAAAACCTT-3′ (R). .. The PCR fragment was ligated into a pMD18-T Vector (TaKaRa), and the recombinant plasmid was transformed into JM109 cells (TaKaRa).

    Article Title: Base-resolution detection of N4-methylcytosine in genomic DNA using 4mC-Tet-assisted-bisulfite- sequencing
    Article Snippet: .. The untreated or Tet-treated mESC genomic DNA with 4mC or 5mC-containing model DNA was applied to MethylCode Bisulfite Conversion Kit (Invitrogen) using thermal cycling program: (i) 98°C 10 min, 64°C 2.5 h or (ii) 98°C 10 min, 53°C 30 min, 8 cycles of 53°C 6 min and 37°C 30 min. After bisulfite conversion, 3 μl of purified converted DNA was PCR amplified using ZymoTaq DNA polymerase (Zymo Research) following the manufacturers’ instructions (for 4mC model, forward primer: 5′-GAATGAAAATTTATGTTAAGGG; reverse primer: 5′-ATTTAAAACTTCATTTTTAATTTAAAA; for 5mC model, forward primer: 5′-TTTGGGTTATGTAAGTTGATTTTATG; reverse primer: 5′-CACCCTACTTACTAAAATTTACACC). .. The PCR products were TOPO cloned using the TOPO TA cloning kit (Invitrogen), and individual clones were subjected to Sanger sequencing using the M13 Forward primer.

    Article Title: Low dose antigen promotes induction of FOXP3 in human CD4+ T cells
    Article Snippet: .. PCR was performed in 25µL containing 1 X PCR buffer, 1U ZymoTaq DNA polymerase (Zymo Research), bisulfite-converted genomic DNA, dNTP at a final concentration of 1mM, and forward and reverse primers at 1mM each. ..

    Gel Extraction:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research). .. The PCR products were size verified, gel purified using the QIAQuick Gel Extraction Kit (Qiagen) and the purified PCR product subcloned into either the pCR® 2.1-TOPO vector using the TOPO cloning kit (Invitrogen) or pGEM-T vector (Promega).

    Sample Prep:

    Article Title: LINE-1 methylation in peripheral blood leukocytes and clinical characteristics and prognosis of prostate cancer patients
    Article Snippet: PCR reactions were performed with ZymoTaq DNA Polymerase kit (Zymo Research, Irvine, CA) using 2 μl of bisulfite-treated DNA in a total volume of 15 μl, and the entire volume was used for each pyrosequencing reaction. .. In preparation for the pyrosequencing reaction, PCR product purification was done with streptavidin-sepharose high-performance beads (GE Healthcare Life Sciences, Piscataway, NJ), and co-denaturation of the biotinylated PCR products and sequencing primer (3.6 pmol/reaction) was conducted following the PSQ96 sample preparation guide.

    Plasmid Preparation:

    Article Title: The effect of promoter methylation on MdMYB1 expression determines the level of anthocyanin accumulation in skins of two non-red apple cultivars
    Article Snippet: The treated DNA was used as template, and the MdMYB1 promoter fragments were amplified using ZymoTaq DNA Polymerase (Zymo Research Corp.). .. The PCR products were cloned into the PMD18-T vector (TaKaRa) and then sequenced.

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research). .. The PCR products were size verified, gel purified using the QIAQuick Gel Extraction Kit (Qiagen) and the purified PCR product subcloned into either the pCR® 2.1-TOPO vector using the TOPO cloning kit (Invitrogen) or pGEM-T vector (Promega).

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs. .. Purified PCR products were cloned into the pCR4-TOPO vector with TOPO TA Cloning Kit (Invitrogen) for subsequent sequencing.

    Article Title: A PRDX1 mutant allele causes a MMACHC secondary epimutation in cblC patients
    Article Snippet: The bisulfite-treated DNA was amplified by PCR (primers: forward 5′-TTAAATTTGTGTTAGTGATAATTGT-3′, reverse 5′-AACTAACCTAAAAAAAATAAACCTC-3′) using ZymoTaq DNA Polymerase (Zymo Research). .. The amplicon was inserted into the pCR4-TOPO vector (Invitrogen, Life Technologies, Courtaboeuf, France), and individual clones were sequenced in both directions using universal M13 primers and the BigDye Terminator v.3.1 Sequencing Kit (Applied Biosystems, Courtaboeuf, France).

    Article Title: H19 lncRNA alters DNA methylation genome wide by regulating S-adenosylhomocysteine hydrolase
    Article Snippet: .. Production of RNA fragments for in vitro analyses Zymo Taq DNA polymerase (Zymo Research, E2001) was used to amplify hURE (128 nucleotide (nt)), mURE (122 nt) and hNSE (131 nt) using plasmid DNA containing human or mouse (accession no. NR_001592) H19 sequences as PCR templates. .. All forward primers contained a T7 promoter sequence ( ).

    Article Title: Genome-wide DNA methylation analysis in cohesin mutant human cell lines
    Article Snippet: Hot-start touchdown PCR was done in 25 μl reaction containing 0.25 mM dNTPs, 1× buffer, 0.4 μM forward and reverse primers and 1 U of ZymoTaq ™ DNA Polymerase (Zymo Research). .. After that, amplification was continued with 36 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 1 min, then ended with 72°C for 15–20 min. PCR products were verified by gel electrophoresis, 2 ul PCR product was subsequently cloned into pGEM-T vector and transformed into JM109 cells according to the manufacturer’s instruction (Promega).

    Article Title: Hypomethylation of ETS Transcription Factor Binding Sites and Upregulation of PARP1 Expression in Endometrial Cancer
    Article Snippet: PCR amplification was performed using the special Hot-Start DNA polymerase (ZymoTaq Premix, Zymo Research) with the following reaction conditions: 95°C for 2 min; 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 45 s; then 72°C for 7 min. Two pairs of primers were used: round I, 5′-TTGGGATAGAATAATTAAAG-3′ (F) and 5′-AACTTTTCCTACAACATCAA-3′ (R); round II, 5′-TAGAATAATTAAAGGGGTGG-3′ (F) and R: 5′-ACAACATCAACAAAACCTT-3′ (R). .. The PCR fragment was ligated into a pMD18-T Vector (TaKaRa), and the recombinant plasmid was transformed into JM109 cells (TaKaRa).

    Software:

    Article Title: The effect of promoter methylation on MdMYB1 expression determines the level of anthocyanin accumulation in skins of two non-red apple cultivars
    Article Snippet: The treated DNA was used as template, and the MdMYB1 promoter fragments were amplified using ZymoTaq DNA Polymerase (Zymo Research Corp.). .. Twenty independent clones of each fragment were sequenced and analyzed with the online software Kismeth [ ].

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Bisulfite-treated DNA-specific primer pairs (Supplementary Table S1) which span the proximal promoters and first exons of Ins1, Ins2 and Pdx1 genes (Supplementary Figure S1) were designed by using MethPrimer software [ ]. .. Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs.

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: Four microlitres of treated DNA was amplified by PCR using primers specific to the bisulfite-converted DNA for each promoter region with ZymoTaq DNA Polymerase (Zymo Research). .. The primer sequences were designed using MethPrimer software ( http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi ) ( ).

    Article Title: Genome-wide DNA methylation analysis in cohesin mutant human cell lines
    Article Snippet: Primers were designed by Methyl Primer Express v1.0 software (Applied Biosystems) using default settings. .. Hot-start touchdown PCR was done in 25 μl reaction containing 0.25 mM dNTPs, 1× buffer, 0.4 μM forward and reverse primers and 1 U of ZymoTaq ™ DNA Polymerase (Zymo Research).

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: To confirm the results from MeDIP-seq, six BSP primers were designed by the online MethPrimer software , including three genes with upregulated methylation and consequential downregulation of expression (P1–P3) and three genes with downregulated methylation and consequential upregulation of expression (P4–P6). .. We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP.

    Agarose Gel Electrophoresis:

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs. .. PCR products were run on 1% (w/v) agarose gel in 1×TAE buffer by electrophoresis at 100 V. DNA fragments of interest were purified from the gel with Wizard SV Gel and PCR Clean-Up System (Promega), according to the manufacturer's instructions.

    In Vitro:

    Article Title: H19 lncRNA alters DNA methylation genome wide by regulating S-adenosylhomocysteine hydrolase
    Article Snippet: .. Production of RNA fragments for in vitro analyses Zymo Taq DNA polymerase (Zymo Research, E2001) was used to amplify hURE (128 nucleotide (nt)), mURE (122 nt) and hNSE (131 nt) using plasmid DNA containing human or mouse (accession no. NR_001592) H19 sequences as PCR templates. .. All forward primers contained a T7 promoter sequence ( ).

    DNA Methylation Assay:

    Article Title: Focused, high accuracy 5-methylcytosine quantitation with base resolution by benchtop next-generation sequencing
    Article Snippet: In all, 200 ng of methylated controls or 1 μg of genomic DNA (rat or mouse) were bisulfite converted using EZ DNA Methylation according to manufacturer’s protocol (Zymo Research, Irvine, CA, USA). .. PCR amplification of these regions was achieved by using ZymoTaq DNA polymerase, a DNA polymerase capable of amplifying low diversity DNA, specifically bisulfite converted DNA (Zymo Research, Irvine, CA, USA).

    Article Title: LINE-1 methylation in peripheral blood leukocytes and clinical characteristics and prognosis of prostate cancer patients
    Article Snippet: The samples were eluted in 20 μl of M-Elution Buffer and transferred to DNA Methylation Analysis Core at The University of Texas MD Anderson Cancer Center for subsequent PCR and pyrosequencing analysis. .. PCR reactions were performed with ZymoTaq DNA Polymerase kit (Zymo Research, Irvine, CA) using 2 μl of bisulfite-treated DNA in a total volume of 15 μl, and the entire volume was used for each pyrosequencing reaction.

    Article Title: Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2
    Article Snippet: 500–550 μg of genomic DNA was bisulfite converted using the EZ DNA Methylation Kit (Zymo Research) according to the manufacturer’s instructions. .. Typically 15–60 ng of converted DNA was amplified using ZymoTaq DNA polymerase (Zymo Research).

    Article Title: Reprogramming of pancreatic exocrine cells towards a beta (?) cell character using Pdx1, Ngn3 and MafA
    Article Snippet: Paragraph title: DNA methylation assay with bisulfite sequencing ... Hot Taq DNA Polymerase (Zymo Research) was used in these PCRs.

    Article Title: A PRDX1 mutant allele causes a MMACHC secondary epimutation in cblC patients
    Article Snippet: Paragraph title: Determination of DNA methylation ... The bisulfite-treated DNA was amplified by PCR (primers: forward 5′-TTAAATTTGTGTTAGTGATAATTGT-3′, reverse 5′-AACTAACCTAAAAAAAATAAACCTC-3′) using ZymoTaq DNA Polymerase (Zymo Research).

    Article Title: Genome-wide DNA Methylation Profiles and Their Relationships with mRNA and the microRNA Transcriptome in Bovine Muscle Tissue (Bos taurine)
    Article Snippet: Two micrograms of pooled DNA from the fetal and adult bovine groups was treated with sodium bisulfite using the EZ DNA Methylation Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer's protocol, except that the conversion temperature was changed to 55°C. .. We used hot start DNA polymerase (Zymo Taq ™ Premix, Zymo Research) for BSP.

    Concentration Assay:

    Article Title: Low dose antigen promotes induction of FOXP3 in human CD4+ T cells
    Article Snippet: .. PCR was performed in 25µL containing 1 X PCR buffer, 1U ZymoTaq DNA polymerase (Zymo Research), bisulfite-converted genomic DNA, dNTP at a final concentration of 1mM, and forward and reverse primers at 1mM each. ..

    BAC Assay:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Lysis:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. Genomic DNA sample (3 μg of genomic DNA purified with a genomic DNA purification kit (Wizard, cat. no. A1120 or similar)) Milli-Q water Recombinant mTet1 (3 mg ml − 1 ; Box 1 for expression and purification procedures) pFastBac dual-mTet1 (available on request from the corresponding author; sequence in ) Bac-to-Bac baculovirus expression system (Invitrogen, cat. no. 10359-016) High Five cells (Invitrogen, cat. no. B855-02) Grace's insect medium, supplemented (Invitrogen, cat. no. 11605102) Medium for mTet1 expression (Reagent Setup) Penicillin-streptomycin, liquid (Invitrogen, cat. no. 15140-163) FBS (Gemini Bio, cat. no. GBP-900198) Tris hydrochloride (Tris-HCl; 20 mM, pH 8.0; Fisher BioReagents, cat. no. BP1531) Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich, cat. no. C4706) Phenylmethylsulfonyl fluoride (PMSF; Chem-impex international, cat. no. 00632) Leupeptin hemisulfate salt (Sigma-Aldrich, cat. no. L2884) Pepstatin A (Fisher BioReagents, cat. no. BP2671-100) Anti-flag M2 affinity gel (Sigma-Aldrich, cat. no. A2220) 3× Flag peptide (Sigma-Aldrich, cat. no. F4799; dissolved in 150 mM NaCl at 0.2 mg ml − 1 ) mTet1 cell lysis buffer (Reagent Setup) mTet1 gel filtration running buffer (Reagent Setup) Unmethylated λ-DNA (Promega, cat. no. D1521) SssI CpG methyltransferase (NEB, cat. no. M0226M; kit contains NEBuffer 2 and SAM) QIAEX II gel extraction kit (Qiagen, cat. no. 20021) ZymoTaq DNA polymerase (Zymo Research, cat. no. E2001) Hydroxymethyl dCTP (hmdCTP; Bioline, cat. no. BIO-39046) Ultrapure dATP (USB, cat. no. 77102) Ultrapure dGTP (USB, cat. no. 77106) Ultrapure dTTP (USB, cat. no. 77108) 5-hmC dNTP mix, 10 mM (Reagent Setup) 5-hmC_F_1, 5-hmC_R_1, 5-hmC_F_2, and 5-hmC_R_2 primers (synthesized by Operon; ) pUC 19 vector (NEB, cat. no. N3041S; dilute in H2 O to 1 ng μl − 1 ) Agarose (Denville, cat. no. CA3510-8) Ethidium bromide (Acros, cat. no. 170960050; dissolved in H2 O at 10 mg ml − 1 ) ! ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Zymo Research zymotaq dna polymerase kit
    Zymotaq Dna Polymerase Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zymotaq dna polymerase kit/product/Zymo Research
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    zymotaq dna polymerase kit - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results