yeast torula rna  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Yeast RNA 10 mg mL
    Description:
    Purified Torulla Ambion yeast RNA is suitable as a coprecipitant in nucleic acid precipitations It cannot be used in reactions inhibited by exogenous RNA and it is the most inexpensive source of a high quality coprecipitant This total RNA preparation is supplied in ten 1 mL tubes at a concentration of 10 mg mL in diethyl pyrocarbonate treated distilled water It is typically used at a working concentration of 10 20 µg mL What is a Coprecipitant Coprecipitants are inert substances used to aid recovery of nucleic acids during alcohol precipitations While they can be used for precipitating large amounts of nucleic acids they are essential for quantitative recovery of small amounts of nucleic acids in dilute solutions Often the use of such molecules is desirable for no other reason but visualization of the pelleted precipitate after centrifugation
    Catalog Number:
    am7118
    Price:
    None
    Applications:
    DNA & RNA Purification & Analysis|DNA Extraction|General gDNA Purification Reagents & Accessories|Genomic DNA Purification|Nuclease Protection Assays|Nucleic Acid Gel Electrophoresis & Blotting
    Category:
    Lab Reagents and Chemicals
    Buy from Supplier


    Structured Review

    Thermo Fisher yeast torula rna
    Purified Torulla Ambion yeast RNA is suitable as a coprecipitant in nucleic acid precipitations It cannot be used in reactions inhibited by exogenous RNA and it is the most inexpensive source of a high quality coprecipitant This total RNA preparation is supplied in ten 1 mL tubes at a concentration of 10 mg mL in diethyl pyrocarbonate treated distilled water It is typically used at a working concentration of 10 20 µg mL What is a Coprecipitant Coprecipitants are inert substances used to aid recovery of nucleic acids during alcohol precipitations While they can be used for precipitating large amounts of nucleic acids they are essential for quantitative recovery of small amounts of nucleic acids in dilute solutions Often the use of such molecules is desirable for no other reason but visualization of the pelleted precipitate after centrifugation
    https://www.bioz.com/result/yeast torula rna/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    yeast torula rna - by Bioz Stars, 2020-07
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: A single blastocyst assay optimized for detecting CRISPR/Cas9 system-induced indel mutations in mice
    Article Snippet: .. Optimization of crude DNA template preparation from a single blastocyst for highly reproducible direct PCR amplification To achieve highly reproducible PCR amplification using a single blastocyst as the source of the crude DNA template, we first checked several carriers, including yeast tRNA (Ambion), yeast total RNA (Ambion), herring sperm DNA (Promega), and glycogen (Life Technologies), all of which have been used to precipitate very low amounts of DNA. .. In preliminary tests, yeast tRNA was better than the other reagents, when evaluated in view of successful PCR amplification (data not shown).

    Polymerase Chain Reaction:

    Article Title: A single blastocyst assay optimized for detecting CRISPR/Cas9 system-induced indel mutations in mice
    Article Snippet: .. Optimization of crude DNA template preparation from a single blastocyst for highly reproducible direct PCR amplification To achieve highly reproducible PCR amplification using a single blastocyst as the source of the crude DNA template, we first checked several carriers, including yeast tRNA (Ambion), yeast total RNA (Ambion), herring sperm DNA (Promega), and glycogen (Life Technologies), all of which have been used to precipitate very low amounts of DNA. .. In preliminary tests, yeast tRNA was better than the other reagents, when evaluated in view of successful PCR amplification (data not shown).

    Article Title: Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells
    Article Snippet: .. High-throughput screening High-throughput screening proceeds in three major stages: (i) Digital droplet PCR: DNA libraries were diluted in 200 µg/mL yeast total RNA solution (Ambion) as described before to have a final average number of DNA molecule per droplet (λ ) of ~0.2–1 (Supplementary Tables – ). .. One microlitre of this solution was introduced in 100 µL of a PCR mixture containing 0.2 µM of forward primer (5′−CTTTAATACGACTCACTATAGGAACCCGCAAGCCATC), 0.2 mM of reverse primer (5′−CAGAATCTCACACAGCC), 0.2 mM of each dNTP, 0.67 mg/mL Dextran-Texas Red 70 kDa (Molecular Probes), 0.1% Pluronic F68, 2 µL Phire II DNA polymerase (Thermo Scientific, concentration unavailable) and the supplied buffer (proprietary to Thermo Fisher) to recommended concentrations.

    Northern Blot:

    Article Title: Immunity of the Saccharomyces cerevisiae SSY5 mRNA to nonsense-mediated mRNA decay
    Article Snippet: .. Briefly, 5 μg of yeast total RNA from W303 or AAY320 used for quantitative northern analysis was utilized to make cDNA using SuperScript™ II RT (Life Technologies, Grand Island, NY). .. The cDNA was subsequently used as template DNA for the primary PCR reactions using the Abridged Universal Amplification Primer (AUAP) provided with the 3′-RACE kit and a SSY5 or CYC1 gene-specific primer.

    Sequencing:

    Article Title: The LhrC sRNAs control expression of T cell-stimulating antigen TcsA in Listeria monocytogenes by decreasing tcsA mRNA stability
    Article Snippet: .. Similarly, for the RNase T1 ladder, 0.1 pmol radiolabeled RNA and 1 μg yeast tRNA in 1X Sequencing Buffer (Invitrogen) was heated, iced, and treated with 1 μl RNase T1 (0.1 U) for 5 min at 37°C. .. For chemical probing, 1 μl 25 mM lead(II) acetate was added to the RNAs and reactions were incubated for 2.5 min at 37°C.

    Incubation:

    Article Title: Hfq-dependent regulation of OmpA synthesis is mediated by an antisense RNA
    Article Snippet: .. In total, 0.1 pmol of 5′-end-labeled ompA mRNA leader, or MicA RNA, was incubated with 1 μg of yeast RNA (Ambion) in 10 μL of TMN buffer at 37°C for 15 min. .. Subsequently, 2 μL of a fresh solution of lead(II) acetate (25 mM; Sigma-Aldrich), 1 μL of RNase T1 (0.01 U; Ambion), or RNase T2 (0.02 U; Invitrogen) were added, and incubations continued for 1, 2, or 5 min.

    Article Title: Distinct RNA Elements Confer Specificity to Flavivirus RNA Cap Methylation Events ▿
    Article Snippet: .. The hydrolysis ladder was prepared by incubation of 106 cpm of WNV RNA with 10 μg of yeast RNA in an alkali hydrolysis buffer (Ambion) at 95°C for 10 min. .. The G ladder was generated by digestion of 106 cpm of WNV RNA and 10 μg of yeast RNA with 1 U of RNase T1 in an RNA sequencing buffer (Ambion) at room temperature for 8 min.

    Radioactivity:

    Article Title: Characterization of the mouse CP27 promoter and NF-Y mediated gene regulation
    Article Snippet: .. The probe was annealed to 10 μg of total RNA from NIH 3T3 cells or yeast RNA at 42°C for 16 h. Following digestion with RNase A and RNase T1 (Ambion, Austin, TX) according to manufacturer’s instructions, the RNase-resistant radioactivity was size-fractionated in an 8% denaturing urea polyacrylamide gel and autoradiographed. ..

    High Throughput Screening Assay:

    Article Title: Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells
    Article Snippet: .. High-throughput screening High-throughput screening proceeds in three major stages: (i) Digital droplet PCR: DNA libraries were diluted in 200 µg/mL yeast total RNA solution (Ambion) as described before to have a final average number of DNA molecule per droplet (λ ) of ~0.2–1 (Supplementary Tables – ). .. One microlitre of this solution was introduced in 100 µL of a PCR mixture containing 0.2 µM of forward primer (5′−CTTTAATACGACTCACTATAGGAACCCGCAAGCCATC), 0.2 mM of reverse primer (5′−CAGAATCTCACACAGCC), 0.2 mM of each dNTP, 0.67 mg/mL Dextran-Texas Red 70 kDa (Molecular Probes), 0.1% Pluronic F68, 2 µL Phire II DNA polymerase (Thermo Scientific, concentration unavailable) and the supplied buffer (proprietary to Thermo Fisher) to recommended concentrations.

    Binding Assay:

    Article Title: Giardiavirus Internal Ribosome Entry Site Has an Apparently Unique Mechanism of Initiating Translation
    Article Snippet: .. Moreover, this binding was effectively competed off by a 10-fold excess of unlabeled GLV IRES ( , lane 6) but not by a 100-fold excess of yeast RNA of random 300–400 nt sequences (Ambion) ( , lane 5). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher yeast rna
    Yeast Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/yeast rna/product/Thermo Fisher
    Average 99 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    yeast rna - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results