Structured Review

Stratagene e coli xl 10 gold kanr
E Coli Xl 10 Gold Kanr, supplied by Stratagene, used in various techniques. Bioz Stars score: 80/100, based on 69 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e coli xl 10 gold kanr/product/Stratagene
Average 80 stars, based on 69 article reviews
Price from $9.99 to $1999.99
e coli xl 10 gold kanr - by Bioz Stars, 2020-01
80/100 stars

Images

Related Articles

Clone Assay:

Article Title: Phenotypic heterogeneity promotes adaptive evolution
Article Snippet: .. All cloning procedures were performed in Escherichia coli XL-10 Gold strain (Stratagene, La Jolla, CA), using ampicillin as selection marker (Sigma, St. Louis, MO). ..

Article Title: Heterologous coexpression of the benzoate‐para‐hydroxylase CYP53B1 with different cytochrome P450 reductases in various yeasts
Article Snippet: .. Escherichia coli XL‐10 Gold (Stratagene) was used for cloning and plasmid propagation. .. Yeast strains used as hosts for heterologous expression are listed in Table and were all obtained from the University of the Free State (UFS) culture collection.

Article Title: Mutated and Bacteriophage T4 Nanoparticle Arrayed F1-V Immunogens from Yersinia pestis as Next Generation Plague Vaccines
Article Snippet: .. E. coli XL-10 Gold cells (Stratagene, CA) were used for the initial transformation of clones. .. The plasmid DNAs were then re-transformed into E. coli BL21 (DE3) RIPL (Novagen, MA) for expression of recombinant proteins.

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: The retroviral cDNA expression library was constructed using the pFB retroviral vector (Stratagene), and the multiple cloning region was replaced with a PCR fragment containing a Kozak sequence, ATG start codon, and FLAG tag sequence followed by the EcoRI and XhoI recognition sequences. .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

Article Title: Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle
Article Snippet: Transformation was performed using Escherichia coli XL-10 Gold ultracompetent cells (Stratagene, Santa Clara, CA, USA). .. Screening of positive clones was carried out by direct colony PCR, using SP6 and T7 universal primers ( ).

Article Title: Expression, Characterization and Synergistic Interactions of Myxobacter Sp. AL-1 Cel9 and Cel48 Glycosyl Hydrolases
Article Snippet: Plasmid construct to overexpress cel48 and generate a His6 -Cel48 protein The open reading frame of cel48 was amplified by PCR, using plasmid pPERM123 ( ) with specific oligonucleotide primers designed to insert Bam HI and Sal I restriction sites into the cloned DNA. .. The PCR fragment was first introduced into PCR-Blunt-II-TOPO plasmid to generate pPERM400 which was replicated into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA). pPERM400 was digested with Sal I and Bam HI and the cel48 ORF fragment was inserted in-frame into the Bam HI/Sal I site of the expression vector pQE30 (QIAGEN Inc. Valencia, CA); the resulting construction pPERM407 was introduced into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA) generating strain E. coli PERM407.

Amplification:

Article Title: Heterologous coexpression of the benzoate‐para‐hydroxylase CYP53B1 with different cytochrome P450 reductases in various yeasts
Article Snippet: Escherichia coli XL‐10 Gold (Stratagene) was used for cloning and plasmid propagation. .. These plasmids were used as templates for the PCR amplification of these genes together with the introduction of EcoRV (5′) and AvrII (3′) restriction sites.

Article Title: The MTH1 inhibitor TH588 is a microtubule-modulating agent that eliminates cancer cells by activating the mitotic surveillance pathway
Article Snippet: .. Briefly, plasmid libraries were amplified by transformation in XL-10 gold chemical competent Escherichia coli (Stratagene) and harvested using endotoxin-free plasmid maxiprep kit (Qiagen) according to the manufacturer’s protocol. .. For virus production, HEK293T cells were co-transfected with plasmid libraries and pCMV-dR8.2 (Addgene # 8455) and pCMV-VSV-G vectors (Addgene # 8454) using the Xtreme gene 9 transfection reagent (Roche).

Article Title: Development of Fluorescent Substrates and Assays for the Key Autophagy-Related Cysteine Protease Enzyme, ATG4B
Article Snippet: DNA coding for YFP (F2, residues 1772–2479) was amplified by PCR from pCAG-YFP plasmid (Addgene; Plasmid 11180) and engineered to contain an N-terminal Sal1 site and C-terminal EcoR1 site. .. The resulting plasmid was transformed into Escherichia coli XL-10 Gold Ultracompetent cells (Stratagene; cat. # 200314).

Article Title: An in-frame deletion at the polymerase active site of POLD1 causes a multisystem disorder with lipodystrophy
Article Snippet: Products of the PCR were gel purified and ligated prior to transformation into XL 10 Gold Ultracompetent Cells (Stratagene). .. A region between the Age1 and Cla1 sites of POLD1 was amplified and sequence-verified, and then subcloned back into Age1/Cla1-digested pET303-hpold1 vector that had not been PCR amplified.

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation. .. The bacterial colonies were amplified in semisolid 2× LB-agarose (Stratagene) to reduce the potential for underrepresentation of particular clones due to overgrowth of faster growing colonies.

Article Title: Role of the N-acetylation polymorphism in solithromycin metabolism
Article Snippet: The coding regions of NAT1*4 (reference NAT1 ), NAT2*4 (reference NAT2 associated with rapid acetylators), NAT2*5B, NAT2*6A and NAT2*14B (associated with slow acetylators) were amplified by PCR using previously constructed plasmids as previously described [ , ]. .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: Daily Rhythm in Plasma N-Acetyltryptamine
Article Snippet: Briefly, the coding regions of the NAT1*4 (high NAT1 activity), NAT1*14B (low NAT1 activity), NAT2*4 (rapid NAT2 acetylator), and NAT2*5B (slow NAT2 acetylator) were amplified by polymerase chain reaction (PCR) using previously constructed plasmids as previously described ( ; ; ). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: N-Acetyltransferase 2 Genotype-Dependent N-Acetylation of Hydralazine in Human Hepatocytes
Article Snippet: The coding regions of NAT1*4 (reference NAT1 ) and NAT2*4 (reference NAT2 ) were amplified by polymerase chain reaction using previously constructed plasmids, as previously described ( ). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle
Article Snippet: PCR amplification was performed using satellite specific primers ( ) [ ]. .. Transformation was performed using Escherichia coli XL-10 Gold ultracompetent cells (Stratagene, Santa Clara, CA, USA).

Article Title: Expression, Characterization and Synergistic Interactions of Myxobacter Sp. AL-1 Cel9 and Cel48 Glycosyl Hydrolases
Article Snippet: Plasmid construct to overexpress cel48 and generate a His6 -Cel48 protein The open reading frame of cel48 was amplified by PCR, using plasmid pPERM123 ( ) with specific oligonucleotide primers designed to insert Bam HI and Sal I restriction sites into the cloned DNA. .. The PCR fragment was first introduced into PCR-Blunt-II-TOPO plasmid to generate pPERM400 which was replicated into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA). pPERM400 was digested with Sal I and Bam HI and the cel48 ORF fragment was inserted in-frame into the Bam HI/Sal I site of the expression vector pQE30 (QIAGEN Inc. Valencia, CA); the resulting construction pPERM407 was introduced into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA) generating strain E. coli PERM407.

Construct:

Article Title: Mapping replication dynamics in Trypanosoma brucei reveals a link with telomere transcription and antigenic variation
Article Snippet: .. Significant difficulty was encountered in propagating the HYG-TK construct without rearrangement, and growth in E. coli XL 10 Gold Cells (Stratagene) and ZYM-5 medium appeared to provide greatest stability. .. Prior to transformation with HYG-TK, the eGFP-PUR cells were cultured in medium lacking thymidine, and transformants were selected in the same medium using 0.2 μg.mL-1 puromycin and 10 μg.mL-1 hygromycin.

Article Title: Identification of Selective Inhibitors of the Potassium Channel Kv1.1-1.2(3) by High-Throughput Virtual Screening and Automated Patch Clamp
Article Snippet: .. Constructs were transformed into Escherichia coli XL-10 Gold (Stratagene) cells for sequencing, which confirmed all of the constructs. .. Transfection and dilution cloning of CHO-K1 with hKv1.1–1.2(3) CHO-K1 cells (European Collection of Cell Culture: ECACC) were maintained in F12-Ham supplemented with 2 mM glutamine growth media (Invitrogen) with 10 % HyClone fetalclone II bovine serum (FBS) and incubated at 37 °C in 5 % CO2.

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: Furthermore, the modified pFB-GFP construct was used as a reference virus to calculate the titer of the retroviral cDNA expression library ( ). .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

Article Title: Role of the N-acetylation polymorphism in solithromycin metabolism
Article Snippet: The coding regions of NAT1*4 (reference NAT1 ), NAT2*4 (reference NAT2 associated with rapid acetylators), NAT2*5B, NAT2*6A and NAT2*14B (associated with slow acetylators) were amplified by PCR using previously constructed plasmids as previously described [ , ]. .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: Daily Rhythm in Plasma N-Acetyltryptamine
Article Snippet: Briefly, the coding regions of the NAT1*4 (high NAT1 activity), NAT1*14B (low NAT1 activity), NAT2*4 (rapid NAT2 acetylator), and NAT2*5B (slow NAT2 acetylator) were amplified by polymerase chain reaction (PCR) using previously constructed plasmids as previously described ( ; ; ). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: N-Acetyltransferase 2 Genotype-Dependent N-Acetylation of Hydralazine in Human Hepatocytes
Article Snippet: The coding regions of NAT1*4 (reference NAT1 ) and NAT2*4 (reference NAT2 ) were amplified by polymerase chain reaction using previously constructed plasmids, as previously described ( ). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: Expression, Characterization and Synergistic Interactions of Myxobacter Sp. AL-1 Cel9 and Cel48 Glycosyl Hydrolases
Article Snippet: Paragraph title: Plasmid construct to overexpress cel48 and generate a His6 -Cel48 protein ... The PCR fragment was first introduced into PCR-Blunt-II-TOPO plasmid to generate pPERM400 which was replicated into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA). pPERM400 was digested with Sal I and Bam HI and the cel48 ORF fragment was inserted in-frame into the Bam HI/Sal I site of the expression vector pQE30 (QIAGEN Inc. Valencia, CA); the resulting construction pPERM407 was introduced into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA) generating strain E. coli PERM407.

Activity Assay:

Article Title: Daily Rhythm in Plasma N-Acetyltryptamine
Article Snippet: Briefly, the coding regions of the NAT1*4 (high NAT1 activity), NAT1*14B (low NAT1 activity), NAT2*4 (rapid NAT2 acetylator), and NAT2*5B (slow NAT2 acetylator) were amplified by polymerase chain reaction (PCR) using previously constructed plasmids as previously described ( ; ; ). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Expressing:

Article Title: Phenotypic heterogeneity promotes adaptive evolution
Article Snippet: All cloning procedures were performed in Escherichia coli XL-10 Gold strain (Stratagene, La Jolla, CA), using ampicillin as selection marker (Sigma, St. Louis, MO). .. The expression of the rtTA-MF is either controlled by a synthetic tet-inducible tetreg promoter (PTetreg2 in pDN-T2dMFot) or by a constitutive glyceraldehyde-3-phosphate dehydrogenase promoter (PGPD in pDN-GPMFot).

Article Title: Heterologous coexpression of the benzoate‐para‐hydroxylase CYP53B1 with different cytochrome P450 reductases in various yeasts
Article Snippet: Escherichia coli XL‐10 Gold (Stratagene) was used for cloning and plasmid propagation. .. Yeast strains used as hosts for heterologous expression are listed in Table and were all obtained from the University of the Free State (UFS) culture collection.

Article Title: Identification of Selective Inhibitors of the Potassium Channel Kv1.1-1.2(3) by High-Throughput Virtual Screening and Automated Patch Clamp
Article Snippet: Paragraph title: Creation of a human Kv1.1–1.2(3) expression plasmid ... Constructs were transformed into Escherichia coli XL-10 Gold (Stratagene) cells for sequencing, which confirmed all of the constructs.

Article Title: Development of Fluorescent Substrates and Assays for the Key Autophagy-Related Cysteine Protease Enzyme, ATG4B
Article Snippet: Paragraph title: Protein expression and purification ... The resulting plasmid was transformed into Escherichia coli XL-10 Gold Ultracompetent cells (Stratagene; cat. # 200314).

Article Title: Mutated and Bacteriophage T4 Nanoparticle Arrayed F1-V Immunogens from Yersinia pestis as Next Generation Plague Vaccines
Article Snippet: DNA, bacteria, and bacteriophage The T7 promoter containing E. coli expression vector pET28b (Novagen, MA) was used for recombinant plasmid construction. .. E. coli XL-10 Gold cells (Stratagene, CA) were used for the initial transformation of clones.

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: Paragraph title: Construction of Retroviral cDNA Expression Library ... The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

Article Title: Expression, Characterization and Synergistic Interactions of Myxobacter Sp. AL-1 Cel9 and Cel48 Glycosyl Hydrolases
Article Snippet: .. The PCR fragment was first introduced into PCR-Blunt-II-TOPO plasmid to generate pPERM400 which was replicated into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA). pPERM400 was digested with Sal I and Bam HI and the cel48 ORF fragment was inserted in-frame into the Bam HI/Sal I site of the expression vector pQE30 (QIAGEN Inc. Valencia, CA); the resulting construction pPERM407 was introduced into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA) generating strain E. coli PERM407. .. The proper in-frame insertion of the cel48 fragment was assessed by both restriction analysis and DNA sequencing.

Modification:

Article Title: Phenotypic heterogeneity promotes adaptive evolution
Article Snippet: This resulted in the pDN-T2dPGxh reporter plasmid that contains the PDR5-GFP gene downstream of PTetreg2 , a modified version of PCYC1 containing two tetO2 sites. .. All cloning procedures were performed in Escherichia coli XL-10 Gold strain (Stratagene, La Jolla, CA), using ampicillin as selection marker (Sigma, St. Louis, MO).

Article Title: Heterologous coexpression of the benzoate‐para‐hydroxylase CYP53B1 with different cytochrome P450 reductases in various yeasts
Article Snippet: DNA modification enzymes were obtained from Thermo Scientific (Johannesburg, South Africa), New England Biolabs (Pretoria, South Africa), Lucigen (Johannesburg, South Africa) and Kapa Biosystems (Cape Town, South Africa). .. Escherichia coli XL‐10 Gold (Stratagene) was used for cloning and plasmid propagation.

Article Title: Mapping replication dynamics in Trypanosoma brucei reveals a link with telomere transcription and antigenic variation
Article Snippet: In order to N-terminally epitope tag TbRECQ2 with 12myc, a modified version of the construct pEnT6B ( ) was used. .. Significant difficulty was encountered in propagating the HYG-TK construct without rearrangement, and growth in E. coli XL 10 Gold Cells (Stratagene) and ZYM-5 medium appeared to provide greatest stability.

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation. .. The bacterial colonies were amplified in semisolid 2× LB-agarose (Stratagene) to reduce the potential for underrepresentation of particular clones due to overgrowth of faster growing colonies.

Transformation Assay:

Article Title: The MTH1 inhibitor TH588 is a microtubule-modulating agent that eliminates cancer cells by activating the mitotic surveillance pathway
Article Snippet: .. Briefly, plasmid libraries were amplified by transformation in XL-10 gold chemical competent Escherichia coli (Stratagene) and harvested using endotoxin-free plasmid maxiprep kit (Qiagen) according to the manufacturer’s protocol. .. For virus production, HEK293T cells were co-transfected with plasmid libraries and pCMV-dR8.2 (Addgene # 8455) and pCMV-VSV-G vectors (Addgene # 8454) using the Xtreme gene 9 transfection reagent (Roche).

Article Title: Mapping replication dynamics in Trypanosoma brucei reveals a link with telomere transcription and antigenic variation
Article Snippet: These cells were then transformed with the construct HYG-TK, which was digested with NotI and HindIII prior to transformation. .. Significant difficulty was encountered in propagating the HYG-TK construct without rearrangement, and growth in E. coli XL 10 Gold Cells (Stratagene) and ZYM-5 medium appeared to provide greatest stability.

Article Title: Identification of Selective Inhibitors of the Potassium Channel Kv1.1-1.2(3) by High-Throughput Virtual Screening and Automated Patch Clamp
Article Snippet: .. Constructs were transformed into Escherichia coli XL-10 Gold (Stratagene) cells for sequencing, which confirmed all of the constructs. .. Transfection and dilution cloning of CHO-K1 with hKv1.1–1.2(3) CHO-K1 cells (European Collection of Cell Culture: ECACC) were maintained in F12-Ham supplemented with 2 mM glutamine growth media (Invitrogen) with 10 % HyClone fetalclone II bovine serum (FBS) and incubated at 37 °C in 5 % CO2.

Article Title: Development of Fluorescent Substrates and Assays for the Key Autophagy-Related Cysteine Protease Enzyme, ATG4B
Article Snippet: .. The resulting plasmid was transformed into Escherichia coli XL-10 Gold Ultracompetent cells (Stratagene; cat. # 200314). .. A colony of freshly transformed cells was cultured in lysogeny broth (LB) medium that contained 100 μg/mL ampicillin.

Article Title: Mutated and Bacteriophage T4 Nanoparticle Arrayed F1-V Immunogens from Yersinia pestis as Next Generation Plague Vaccines
Article Snippet: .. E. coli XL-10 Gold cells (Stratagene, CA) were used for the initial transformation of clones. .. The plasmid DNAs were then re-transformed into E. coli BL21 (DE3) RIPL (Novagen, MA) for expression of recombinant proteins.

Article Title: An in-frame deletion at the polymerase active site of POLD1 causes a multisystem disorder with lipodystrophy
Article Snippet: .. Products of the PCR were gel purified and ligated prior to transformation into XL 10 Gold Ultracompetent Cells (Stratagene). .. A region between the Age1 and Cla1 sites of POLD1 was amplified and sequence-verified, and then subcloned back into Age1/Cla1-digested pET303-hpold1 vector that had not been PCR amplified.

Article Title: Role of the N-acetylation polymorphism in solithromycin metabolism
Article Snippet: .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene). .. Plasmids were isolated from cultures grown from selected colonies using the Qiagen Plasmid Midi kit (Qiagen, CA, USA) and sequenced using Thermo Sequenase (Amersham, IL, USA).

Article Title: Daily Rhythm in Plasma N-Acetyltryptamine
Article Snippet: .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene). .. Plasmids were isolated from cultures grown from selected colonies using the Qiagen Plasmid Midi kit (Qiagen, Valencia, CA) and sequenced.

Article Title: N-Acetyltransferase 2 Genotype-Dependent N-Acetylation of Hydralazine in Human Hepatocytes
Article Snippet: .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene). .. Plasmids were isolated from cultures grown from selected colonies using the Plasmid Midi Kit (QIAGEN, Valencia, CA) and sequenced using Thermosequenase (Amersham, Arlington Heights, IL).

Article Title: Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle
Article Snippet: .. Transformation was performed using Escherichia coli XL-10 Gold ultracompetent cells (Stratagene, Santa Clara, CA, USA). .. Screening of positive clones was carried out by direct colony PCR, using SP6 and T7 universal primers ( ).

Derivative Assay:

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: The coding sequence for the GFP derived from pAcGFP1-1 (Clontech) was inserted into the modified pFB vector using the EcoRI and XhoI sites and served as a stuffer fragment to reduce the background of parental vector in the cDNA library. .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

Electroporation:

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation. .. The bacterial colonies were amplified in semisolid 2× LB-agarose (Stratagene) to reduce the potential for underrepresentation of particular clones due to overgrowth of faster growing colonies.

Transfection:

Article Title: The MTH1 inhibitor TH588 is a microtubule-modulating agent that eliminates cancer cells by activating the mitotic surveillance pathway
Article Snippet: Briefly, plasmid libraries were amplified by transformation in XL-10 gold chemical competent Escherichia coli (Stratagene) and harvested using endotoxin-free plasmid maxiprep kit (Qiagen) according to the manufacturer’s protocol. .. For virus production, HEK293T cells were co-transfected with plasmid libraries and pCMV-dR8.2 (Addgene # 8455) and pCMV-VSV-G vectors (Addgene # 8454) using the Xtreme gene 9 transfection reagent (Roche).

Article Title: Mapping replication dynamics in Trypanosoma brucei reveals a link with telomere transcription and antigenic variation
Article Snippet: The resulting plasmid was then linearized using KpnI prior to transfection into BSF cells, and transformants were selected with 10 µg.ml-1 blasticidin. .. Significant difficulty was encountered in propagating the HYG-TK construct without rearrangement, and growth in E. coli XL 10 Gold Cells (Stratagene) and ZYM-5 medium appeared to provide greatest stability.

Ligation:

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: First strand synthesis was carried out on 5 μg of purified mRNA using a hybrid XhoI-oligo(dT) primer (Stratagene), and the resulting cDNAs had 5′-EcoRI and 3′-XhoI cohesive ends for directional ligation into the retroviral vector. .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

Cell Culture:

Article Title: Mapping replication dynamics in Trypanosoma brucei reveals a link with telomere transcription and antigenic variation
Article Snippet: Significant difficulty was encountered in propagating the HYG-TK construct without rearrangement, and growth in E. coli XL 10 Gold Cells (Stratagene) and ZYM-5 medium appeared to provide greatest stability. .. Prior to transformation with HYG-TK, the eGFP-PUR cells were cultured in medium lacking thymidine, and transformants were selected in the same medium using 0.2 μg.mL-1 puromycin and 10 μg.mL-1 hygromycin.

Article Title: Development of Fluorescent Substrates and Assays for the Key Autophagy-Related Cysteine Protease Enzyme, ATG4B
Article Snippet: The resulting plasmid was transformed into Escherichia coli XL-10 Gold Ultracompetent cells (Stratagene; cat. # 200314). .. A colony of freshly transformed cells was cultured in lysogeny broth (LB) medium that contained 100 μg/mL ampicillin.

Generated:

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: Two additional constructs were generated by inserting A and AA nucleotides immediately before the EcoRI site to ensure in-frame expression of the cDNA library. .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

DNA Sequencing:

Article Title: Expression, Characterization and Synergistic Interactions of Myxobacter Sp. AL-1 Cel9 and Cel48 Glycosyl Hydrolases
Article Snippet: The PCR fragment was first introduced into PCR-Blunt-II-TOPO plasmid to generate pPERM400 which was replicated into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA). pPERM400 was digested with Sal I and Bam HI and the cel48 ORF fragment was inserted in-frame into the Bam HI/Sal I site of the expression vector pQE30 (QIAGEN Inc. Valencia, CA); the resulting construction pPERM407 was introduced into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA) generating strain E. coli PERM407. .. The proper in-frame insertion of the cel48 fragment was assessed by both restriction analysis and DNA sequencing.

Polymerase Chain Reaction:

Article Title: Heterologous coexpression of the benzoate‐para‐hydroxylase CYP53B1 with different cytochrome P450 reductases in various yeasts
Article Snippet: Escherichia coli XL‐10 Gold (Stratagene) was used for cloning and plasmid propagation. .. These plasmids were used as templates for the PCR amplification of these genes together with the introduction of EcoRV (5′) and AvrII (3′) restriction sites.

Article Title: Mapping replication dynamics in Trypanosoma brucei reveals a link with telomere transcription and antigenic variation
Article Snippet: In this case, two fragments were PCR-amplified: a region of the TbRECQ2 ORF immediately downstream of the start codon, using the primers CAGACTAGTTCTGTCCACAGAATTCAT (containing an SpeI restriction site) and CAGGGTACCAGGACAAAACACTAAAAAATA (containing a KpnI site); and a section from the 5’ flanking un-translated region immediately upstream of the TbRECQ2 ORF, using the primers CAGGGTACCGACAAAGATTTAAGTTGCGTCT (containing a KpnI site) and CAGGGATCCTCGCCGCGGTAATAGTTG (containing a BamHI site). .. Significant difficulty was encountered in propagating the HYG-TK construct without rearrangement, and growth in E. coli XL 10 Gold Cells (Stratagene) and ZYM-5 medium appeared to provide greatest stability.

Article Title: Identification of Selective Inhibitors of the Potassium Channel Kv1.1-1.2(3) by High-Throughput Virtual Screening and Automated Patch Clamp
Article Snippet: The hKv1.1–1.2(3) construct was made by PCR of Kv1.2–pcDNA3.1 with the primers 5′-TAG GCT ATG GAG ACA TGG TTC CGA C-3′ and 5′-TTT TTT AAG CTT AAT CTC GAG TGT GCT TCT ACC AAA ATT CAG AGT TTC TTT CTG CGT GTC GAC ATC AGT TAA CAT TTT GG-3′. .. Constructs were transformed into Escherichia coli XL-10 Gold (Stratagene) cells for sequencing, which confirmed all of the constructs.

Article Title: Development of Fluorescent Substrates and Assays for the Key Autophagy-Related Cysteine Protease Enzyme, ATG4B
Article Snippet: DNA coding for YFP (F2, residues 1772–2479) was amplified by PCR from pCAG-YFP plasmid (Addgene; Plasmid 11180) and engineered to contain an N-terminal Sal1 site and C-terminal EcoR1 site. .. The resulting plasmid was transformed into Escherichia coli XL-10 Gold Ultracompetent cells (Stratagene; cat. # 200314).

Article Title: An in-frame deletion at the polymerase active site of POLD1 causes a multisystem disorder with lipodystrophy
Article Snippet: .. Products of the PCR were gel purified and ligated prior to transformation into XL 10 Gold Ultracompetent Cells (Stratagene). .. A region between the Age1 and Cla1 sites of POLD1 was amplified and sequence-verified, and then subcloned back into Age1/Cla1-digested pET303-hpold1 vector that had not been PCR amplified.

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: The retroviral cDNA expression library was constructed using the pFB retroviral vector (Stratagene), and the multiple cloning region was replaced with a PCR fragment containing a Kozak sequence, ATG start codon, and FLAG tag sequence followed by the EcoRI and XhoI recognition sequences. .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

Article Title: Role of the N-acetylation polymorphism in solithromycin metabolism
Article Snippet: Purified PCR products and 80 ng of plasmid were ligated overnight at 16°C with T4 DNA ligase (New England Biolabs, Inc, MA, USA). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: Daily Rhythm in Plasma N-Acetyltryptamine
Article Snippet: Purified PCR products and 80 ng of digested plasmid were ligated overnig 16 ° C with T4 DNA ligase (New England Biolabs, Inc, Beverly, MA). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: N-Acetyltransferase 2 Genotype-Dependent N-Acetylation of Hydralazine in Human Hepatocytes
Article Snippet: Purified polymerase chain reaction products and 80 ng of plasmid were ligated overnight at 16°C with T4 DNA ligase (New England BioLabs Inc., Beverly, MA). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle
Article Snippet: PCR products were purified using the Invisorb® Fragment Cleanup system (Stratec Molecular GmbH, Berlin, Germany). .. Transformation was performed using Escherichia coli XL-10 Gold ultracompetent cells (Stratagene, Santa Clara, CA, USA).

Article Title: Expression, Characterization and Synergistic Interactions of Myxobacter Sp. AL-1 Cel9 and Cel48 Glycosyl Hydrolases
Article Snippet: .. The PCR fragment was first introduced into PCR-Blunt-II-TOPO plasmid to generate pPERM400 which was replicated into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA). pPERM400 was digested with Sal I and Bam HI and the cel48 ORF fragment was inserted in-frame into the Bam HI/Sal I site of the expression vector pQE30 (QIAGEN Inc. Valencia, CA); the resulting construction pPERM407 was introduced into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA) generating strain E. coli PERM407. .. The proper in-frame insertion of the cel48 fragment was assessed by both restriction analysis and DNA sequencing.

Recombinant:

Article Title: Mutated and Bacteriophage T4 Nanoparticle Arrayed F1-V Immunogens from Yersinia pestis as Next Generation Plague Vaccines
Article Snippet: DNA, bacteria, and bacteriophage The T7 promoter containing E. coli expression vector pET28b (Novagen, MA) was used for recombinant plasmid construction. .. E. coli XL-10 Gold cells (Stratagene, CA) were used for the initial transformation of clones.

Article Title: Role of the N-acetylation polymorphism in solithromycin metabolism
Article Snippet: Paragraph title: Production of human recombinant NATs ... Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: N-Acetyltransferase 2 Genotype-Dependent N-Acetylation of Hydralazine in Human Hepatocytes
Article Snippet: Paragraph title: Production of Recombinant Human N -Acetyltransferases. ... Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Crocin Bleaching Assay:

Article Title: Development of Fluorescent Substrates and Assays for the Key Autophagy-Related Cysteine Protease Enzyme, ATG4B
Article Snippet: DNA coding for human LC3-B (F1, residues 1363–1737) was amplified by polymerase chain reaction (PCR) from pCMV-GFP-LC3 expression vector (Cell Biolabs, Inc.; Product #CBA-401) and engineered to contain an N-terminal BamH1 restriction site and a C-terminal Sal1 restriction site. .. The resulting plasmid was transformed into Escherichia coli XL-10 Gold Ultracompetent cells (Stratagene; cat. # 200314).

DNA Extraction:

Article Title: Heterologous coexpression of the benzoate‐para‐hydroxylase CYP53B1 with different cytochrome P450 reductases in various yeasts
Article Snippet: BioFlux Biospin gel extraction kits and Biospin plasmid DNA extraction kits for DNA/RNA extraction and purification were supplied by Separations Scientific (Johannesburg, South Africa). .. Escherichia coli XL‐10 Gold (Stratagene) was used for cloning and plasmid propagation.

Mutagenesis:

Article Title: An in-frame deletion at the polymerase active site of POLD1 causes a multisystem disorder with lipodystrophy
Article Snippet: Paragraph title: Site Directed Mutagenesis ... Products of the PCR were gel purified and ligated prior to transformation into XL 10 Gold Ultracompetent Cells (Stratagene).

Isolation:

Article Title: Role of the N-acetylation polymorphism in solithromycin metabolism
Article Snippet: Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene). .. Plasmids were isolated from cultures grown from selected colonies using the Qiagen Plasmid Midi kit (Qiagen, CA, USA) and sequenced using Thermo Sequenase (Amersham, IL, USA).

Article Title: Daily Rhythm in Plasma N-Acetyltryptamine
Article Snippet: Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene). .. Plasmids were isolated from cultures grown from selected colonies using the Qiagen Plasmid Midi kit (Qiagen, Valencia, CA) and sequenced.

Article Title: N-Acetyltransferase 2 Genotype-Dependent N-Acetylation of Hydralazine in Human Hepatocytes
Article Snippet: Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene). .. Plasmids were isolated from cultures grown from selected colonies using the Plasmid Midi Kit (QIAGEN, Valencia, CA) and sequenced using Thermosequenase (Amersham, Arlington Heights, IL).

Purification:

Article Title: Heterologous coexpression of the benzoate‐para‐hydroxylase CYP53B1 with different cytochrome P450 reductases in various yeasts
Article Snippet: BioFlux Biospin gel extraction kits and Biospin plasmid DNA extraction kits for DNA/RNA extraction and purification were supplied by Separations Scientific (Johannesburg, South Africa). .. Escherichia coli XL‐10 Gold (Stratagene) was used for cloning and plasmid propagation.

Article Title: Development of Fluorescent Substrates and Assays for the Key Autophagy-Related Cysteine Protease Enzyme, ATG4B
Article Snippet: Paragraph title: Protein expression and purification ... The resulting plasmid was transformed into Escherichia coli XL-10 Gold Ultracompetent cells (Stratagene; cat. # 200314).

Article Title: Mutated and Bacteriophage T4 Nanoparticle Arrayed F1-V Immunogens from Yersinia pestis as Next Generation Plague Vaccines
Article Snippet: E. coli XL-10 Gold cells (Stratagene, CA) were used for the initial transformation of clones. .. The Hoc− Soc− phage T4 was propagated on E. coli P301 and purified by CsCl gradient centrifugation.

Article Title: An in-frame deletion at the polymerase active site of POLD1 causes a multisystem disorder with lipodystrophy
Article Snippet: .. Products of the PCR were gel purified and ligated prior to transformation into XL 10 Gold Ultracompetent Cells (Stratagene). .. A region between the Age1 and Cla1 sites of POLD1 was amplified and sequence-verified, and then subcloned back into Age1/Cla1-digested pET303-hpold1 vector that had not been PCR amplified.

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: First strand synthesis was carried out on 5 μg of purified mRNA using a hybrid XhoI-oligo(dT) primer (Stratagene), and the resulting cDNAs had 5′-EcoRI and 3′-XhoI cohesive ends for directional ligation into the retroviral vector. .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

Article Title: Role of the N-acetylation polymorphism in solithromycin metabolism
Article Snippet: Purified PCR products and 80 ng of plasmid were ligated overnight at 16°C with T4 DNA ligase (New England Biolabs, Inc, MA, USA). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: Daily Rhythm in Plasma N-Acetyltryptamine
Article Snippet: Purified PCR products and 80 ng of digested plasmid were ligated overnig 16 ° C with T4 DNA ligase (New England Biolabs, Inc, Beverly, MA). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: N-Acetyltransferase 2 Genotype-Dependent N-Acetylation of Hydralazine in Human Hepatocytes
Article Snippet: Purified polymerase chain reaction products and 80 ng of plasmid were ligated overnight at 16°C with T4 DNA ligase (New England BioLabs Inc., Beverly, MA). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle
Article Snippet: PCR products were purified using the Invisorb® Fragment Cleanup system (Stratec Molecular GmbH, Berlin, Germany). .. Transformation was performed using Escherichia coli XL-10 Gold ultracompetent cells (Stratagene, Santa Clara, CA, USA).

Sequencing:

Article Title: Identification of Selective Inhibitors of the Potassium Channel Kv1.1-1.2(3) by High-Throughput Virtual Screening and Automated Patch Clamp
Article Snippet: .. Constructs were transformed into Escherichia coli XL-10 Gold (Stratagene) cells for sequencing, which confirmed all of the constructs. .. Transfection and dilution cloning of CHO-K1 with hKv1.1–1.2(3) CHO-K1 cells (European Collection of Cell Culture: ECACC) were maintained in F12-Ham supplemented with 2 mM glutamine growth media (Invitrogen) with 10 % HyClone fetalclone II bovine serum (FBS) and incubated at 37 °C in 5 % CO2.

Article Title: Development of Fluorescent Substrates and Assays for the Key Autophagy-Related Cysteine Protease Enzyme, ATG4B
Article Snippet: The final sequence of the expression vector is YFP-LC3B-EmGFP. .. The resulting plasmid was transformed into Escherichia coli XL-10 Gold Ultracompetent cells (Stratagene; cat. # 200314).

Article Title: An in-frame deletion at the polymerase active site of POLD1 causes a multisystem disorder with lipodystrophy
Article Snippet: Products of the PCR were gel purified and ligated prior to transformation into XL 10 Gold Ultracompetent Cells (Stratagene). .. A region between the Age1 and Cla1 sites of POLD1 was amplified and sequence-verified, and then subcloned back into Age1/Cla1-digested pET303-hpold1 vector that had not been PCR amplified.

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: The coding sequence for the GFP derived from pAcGFP1-1 (Clontech) was inserted into the modified pFB vector using the EcoRI and XhoI sites and served as a stuffer fragment to reduce the background of parental vector in the cDNA library. .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

Article Title: Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle
Article Snippet: Transformation was performed using Escherichia coli XL-10 Gold ultracompetent cells (Stratagene, Santa Clara, CA, USA). .. The BiQ Analyzer program (MPI for Informatics, Saarland, Germany) [ ] was used for sequence processing.

CRISPR:

Article Title: The MTH1 inhibitor TH588 is a microtubule-modulating agent that eliminates cancer cells by activating the mitotic surveillance pathway
Article Snippet: Paragraph title: Production of lentiviral human CRISPR knockout pooled gRNA libraries ... Briefly, plasmid libraries were amplified by transformation in XL-10 gold chemical competent Escherichia coli (Stratagene) and harvested using endotoxin-free plasmid maxiprep kit (Qiagen) according to the manufacturer’s protocol.

cDNA Library Assay:

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: The coding sequence for the GFP derived from pAcGFP1-1 (Clontech) was inserted into the modified pFB vector using the EcoRI and XhoI sites and served as a stuffer fragment to reduce the background of parental vector in the cDNA library. .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

Chloramphenicol Acetyltransferase Assay:

Article Title: Identification of Selective Inhibitors of the Potassium Channel Kv1.1-1.2(3) by High-Throughput Virtual Screening and Automated Patch Clamp
Article Snippet: The hKv1.1–1.2(3) construct was made by PCR of Kv1.2–pcDNA3.1 with the primers 5′-TAG GCT ATG GAG ACA TGG TTC CGA C-3′ and 5′-TTT TTT AAG CTT AAT CTC GAG TGT GCT TCT ACC AAA ATT CAG AGT TTC TTT CTG CGT GTC GAC ATC AGT TAA CAT TTT GG-3′. .. Constructs were transformed into Escherichia coli XL-10 Gold (Stratagene) cells for sequencing, which confirmed all of the constructs.

Plasmid Preparation:

Article Title: Phenotypic heterogeneity promotes adaptive evolution
Article Snippet: Paragraph title: Plasmid construction ... All cloning procedures were performed in Escherichia coli XL-10 Gold strain (Stratagene, La Jolla, CA), using ampicillin as selection marker (Sigma, St. Louis, MO).

Article Title: Heterologous coexpression of the benzoate‐para‐hydroxylase CYP53B1 with different cytochrome P450 reductases in various yeasts
Article Snippet: .. Escherichia coli XL‐10 Gold (Stratagene) was used for cloning and plasmid propagation. .. Yeast strains used as hosts for heterologous expression are listed in Table and were all obtained from the University of the Free State (UFS) culture collection.

Article Title: The MTH1 inhibitor TH588 is a microtubule-modulating agent that eliminates cancer cells by activating the mitotic surveillance pathway
Article Snippet: .. Briefly, plasmid libraries were amplified by transformation in XL-10 gold chemical competent Escherichia coli (Stratagene) and harvested using endotoxin-free plasmid maxiprep kit (Qiagen) according to the manufacturer’s protocol. .. For virus production, HEK293T cells were co-transfected with plasmid libraries and pCMV-dR8.2 (Addgene # 8455) and pCMV-VSV-G vectors (Addgene # 8454) using the Xtreme gene 9 transfection reagent (Roche).

Article Title: Mapping replication dynamics in Trypanosoma brucei reveals a link with telomere transcription and antigenic variation
Article Snippet: The resulting plasmid was then linearized using KpnI prior to transfection into BSF cells, and transformants were selected with 10 µg.ml-1 blasticidin. .. Significant difficulty was encountered in propagating the HYG-TK construct without rearrangement, and growth in E. coli XL 10 Gold Cells (Stratagene) and ZYM-5 medium appeared to provide greatest stability.

Article Title: Identification of Selective Inhibitors of the Potassium Channel Kv1.1-1.2(3) by High-Throughput Virtual Screening and Automated Patch Clamp
Article Snippet: Paragraph title: Creation of a human Kv1.1–1.2(3) expression plasmid ... Constructs were transformed into Escherichia coli XL-10 Gold (Stratagene) cells for sequencing, which confirmed all of the constructs.

Article Title: Development of Fluorescent Substrates and Assays for the Key Autophagy-Related Cysteine Protease Enzyme, ATG4B
Article Snippet: .. The resulting plasmid was transformed into Escherichia coli XL-10 Gold Ultracompetent cells (Stratagene; cat. # 200314). .. A colony of freshly transformed cells was cultured in lysogeny broth (LB) medium that contained 100 μg/mL ampicillin.

Article Title: Mutated and Bacteriophage T4 Nanoparticle Arrayed F1-V Immunogens from Yersinia pestis as Next Generation Plague Vaccines
Article Snippet: DNA, bacteria, and bacteriophage The T7 promoter containing E. coli expression vector pET28b (Novagen, MA) was used for recombinant plasmid construction. .. E. coli XL-10 Gold cells (Stratagene, CA) were used for the initial transformation of clones.

Article Title: An in-frame deletion at the polymerase active site of POLD1 causes a multisystem disorder with lipodystrophy
Article Snippet: Site Directed Mutagenesis The 3-nucleotide deletion was introduced into the pET303-hpold1 plasmid by using 5′ phosphorylated primers flanking the deletion site ( ). .. Products of the PCR were gel purified and ligated prior to transformation into XL 10 Gold Ultracompetent Cells (Stratagene).

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation. .. The bacterial colonies were amplified in semisolid 2× LB-agarose (Stratagene) to reduce the potential for underrepresentation of particular clones due to overgrowth of faster growing colonies.

Article Title: Role of the N-acetylation polymorphism in solithromycin metabolism
Article Snippet: Purified PCR products and 80 ng of plasmid were ligated overnight at 16°C with T4 DNA ligase (New England Biolabs, Inc, MA, USA). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: Daily Rhythm in Plasma N-Acetyltryptamine
Article Snippet: Purified PCR products and 80 ng of digested plasmid were ligated overnig 16 ° C with T4 DNA ligase (New England Biolabs, Inc, Beverly, MA). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: N-Acetyltransferase 2 Genotype-Dependent N-Acetylation of Hydralazine in Human Hepatocytes
Article Snippet: Purified polymerase chain reaction products and 80 ng of plasmid were ligated overnight at 16°C with T4 DNA ligase (New England BioLabs Inc., Beverly, MA). .. Ligated plasmids were transformed into XL-10 Gold Ultracompetent Escherichia coli (Stratagene).

Article Title: Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle
Article Snippet: Fragments were ligated into the pGEM® -T-Easy Vector (Promega) according to manufacturer instructions overnight at 4°C. .. Transformation was performed using Escherichia coli XL-10 Gold ultracompetent cells (Stratagene, Santa Clara, CA, USA).

Article Title: Expression, Characterization and Synergistic Interactions of Myxobacter Sp. AL-1 Cel9 and Cel48 Glycosyl Hydrolases
Article Snippet: .. The PCR fragment was first introduced into PCR-Blunt-II-TOPO plasmid to generate pPERM400 which was replicated into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA). pPERM400 was digested with Sal I and Bam HI and the cel48 ORF fragment was inserted in-frame into the Bam HI/Sal I site of the expression vector pQE30 (QIAGEN Inc. Valencia, CA); the resulting construction pPERM407 was introduced into E. coli XL-10 Gold KanR (Stratagene, La Jolla, CA) generating strain E. coli PERM407. .. The proper in-frame insertion of the cel48 fragment was assessed by both restriction analysis and DNA sequencing.

Selection:

Article Title: Phenotypic heterogeneity promotes adaptive evolution
Article Snippet: .. All cloning procedures were performed in Escherichia coli XL-10 Gold strain (Stratagene, La Jolla, CA), using ampicillin as selection marker (Sigma, St. Louis, MO). ..

Knock-Out:

Article Title: The MTH1 inhibitor TH588 is a microtubule-modulating agent that eliminates cancer cells by activating the mitotic surveillance pathway
Article Snippet: Paragraph title: Production of lentiviral human CRISPR knockout pooled gRNA libraries ... Briefly, plasmid libraries were amplified by transformation in XL-10 gold chemical competent Escherichia coli (Stratagene) and harvested using endotoxin-free plasmid maxiprep kit (Qiagen) according to the manufacturer’s protocol.

DNA Methylation Assay:

Article Title: Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle
Article Snippet: Paragraph title: DNA methylation profiles assay ... Transformation was performed using Escherichia coli XL-10 Gold ultracompetent cells (Stratagene, Santa Clara, CA, USA).

Produced:

Article Title: Identification of Selective Inhibitors of the Potassium Channel Kv1.1-1.2(3) by High-Throughput Virtual Screening and Automated Patch Clamp
Article Snippet: This produced a construct containing Age I (5′) and a Hind III (3′) site. .. Constructs were transformed into Escherichia coli XL-10 Gold (Stratagene) cells for sequencing, which confirmed all of the constructs.

FLAG-tag:

Article Title: Impaired Infectivity of Ritonavir-resistant HIV Is Rescued by Heat Shock Protein 90AB1 *
Article Snippet: The retroviral cDNA expression library was constructed using the pFB retroviral vector (Stratagene), and the multiple cloning region was replaced with a PCR fragment containing a Kozak sequence, ATG start codon, and FLAG tag sequence followed by the EcoRI and XhoI recognition sequences. .. The cDNA was ligated directionally into the modified pFB plasmid by replacing the stuffer fragment, and the reaction products were used to transform XL-10 GOLD Escherichia coli (Stratagene) by electroporation.

CTG Assay:

Article Title: Identification of Selective Inhibitors of the Potassium Channel Kv1.1-1.2(3) by High-Throughput Virtual Screening and Automated Patch Clamp
Article Snippet: The hKv1.1–1.2(3) construct was made by PCR of Kv1.2–pcDNA3.1 with the primers 5′-TAG GCT ATG GAG ACA TGG TTC CGA C-3′ and 5′-TTT TTT AAG CTT AAT CTC GAG TGT GCT TCT ACC AAA ATT CAG AGT TTC TTT CTG CGT GTC GAC ATC AGT TAA CAT TTT GG-3′. .. Constructs were transformed into Escherichia coli XL-10 Gold (Stratagene) cells for sequencing, which confirmed all of the constructs.

Marker:

Article Title: Phenotypic heterogeneity promotes adaptive evolution
Article Snippet: .. All cloning procedures were performed in Escherichia coli XL-10 Gold strain (Stratagene, La Jolla, CA), using ampicillin as selection marker (Sigma, St. Louis, MO). ..

Gel Extraction:

Article Title: Heterologous coexpression of the benzoate‐para‐hydroxylase CYP53B1 with different cytochrome P450 reductases in various yeasts
Article Snippet: BioFlux Biospin gel extraction kits and Biospin plasmid DNA extraction kits for DNA/RNA extraction and purification were supplied by Separations Scientific (Johannesburg, South Africa). .. Escherichia coli XL‐10 Gold (Stratagene) was used for cloning and plasmid propagation.

Gradient Centrifugation:

Article Title: Mutated and Bacteriophage T4 Nanoparticle Arrayed F1-V Immunogens from Yersinia pestis as Next Generation Plague Vaccines
Article Snippet: E. coli XL-10 Gold cells (Stratagene, CA) were used for the initial transformation of clones. .. The Hoc− Soc− phage T4 was propagated on E. coli P301 and purified by CsCl gradient centrifugation.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Stratagene e coli strain xl 1 blue
    Selection of Phabs binding to TouRΔA. The number of phage bound to ELISA plates coated with 6xhis TouRΔA after each panning round is indicated. The bound phage were eluted from the plates by incubation with 0.1 M glycine (pH 2.5) as explained in Materials and Methods. After recovery, the titers of these phage were determined on E . coli <t>XL-1</t> Blue cells and selected for AMP resistance. In each panning round, the number of input phage was kept constant at 2 × 10 11 PFU and the phage that did not bind 6xhis TouRΔA were removed by 40 washing steps with PBS. The increase in the number of bound phage after the second round of panning is indicative of a preferential amplification of Phab clones binding to 6xhis TouRΔA.
    E Coli Strain Xl 1 Blue, supplied by Stratagene, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli strain xl 1 blue/product/Stratagene
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    e coli strain xl 1 blue - by Bioz Stars, 2020-01
    89/100 stars
      Buy from Supplier

    80
    Stratagene e coli xl 10 gold kanr
    Selection of Phabs binding to TouRΔA. The number of phage bound to ELISA plates coated with 6xhis TouRΔA after each panning round is indicated. The bound phage were eluted from the plates by incubation with 0.1 M glycine (pH 2.5) as explained in Materials and Methods. After recovery, the titers of these phage were determined on E . coli <t>XL-1</t> Blue cells and selected for AMP resistance. In each panning round, the number of input phage was kept constant at 2 × 10 11 PFU and the phage that did not bind 6xhis TouRΔA were removed by 40 washing steps with PBS. The increase in the number of bound phage after the second round of panning is indicative of a preferential amplification of Phab clones binding to 6xhis TouRΔA.
    E Coli Xl 10 Gold Kanr, supplied by Stratagene, used in various techniques. Bioz Stars score: 80/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli xl 10 gold kanr/product/Stratagene
    Average 80 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    e coli xl 10 gold kanr - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    88
    Stratagene e coli xl 10 gold
    Selection of Phabs binding to TouRΔA. The number of phage bound to ELISA plates coated with 6xhis TouRΔA after each panning round is indicated. The bound phage were eluted from the plates by incubation with 0.1 M glycine (pH 2.5) as explained in Materials and Methods. After recovery, the titers of these phage were determined on E . coli <t>XL-1</t> Blue cells and selected for AMP resistance. In each panning round, the number of input phage was kept constant at 2 × 10 11 PFU and the phage that did not bind 6xhis TouRΔA were removed by 40 washing steps with PBS. The increase in the number of bound phage after the second round of panning is indicative of a preferential amplification of Phab clones binding to 6xhis TouRΔA.
    E Coli Xl 10 Gold, supplied by Stratagene, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli xl 10 gold/product/Stratagene
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    e coli xl 10 gold - by Bioz Stars, 2020-01
    88/100 stars
      Buy from Supplier

    Image Search Results


    Selection of Phabs binding to TouRΔA. The number of phage bound to ELISA plates coated with 6xhis TouRΔA after each panning round is indicated. The bound phage were eluted from the plates by incubation with 0.1 M glycine (pH 2.5) as explained in Materials and Methods. After recovery, the titers of these phage were determined on E . coli XL-1 Blue cells and selected for AMP resistance. In each panning round, the number of input phage was kept constant at 2 × 10 11 PFU and the phage that did not bind 6xhis TouRΔA were removed by 40 washing steps with PBS. The increase in the number of bound phage after the second round of panning is indicative of a preferential amplification of Phab clones binding to 6xhis TouRΔA.

    Journal: Journal of Bacteriology

    Article Title: Monitoring Intracellular Levels of XylR in Pseudomonas putida with a Single-Chain Antibody Specific for Aromatic-Responsive Enhancer-Binding Proteins

    doi: 10.1128/JB.183.19.5571-5579.2001

    Figure Lengend Snippet: Selection of Phabs binding to TouRΔA. The number of phage bound to ELISA plates coated with 6xhis TouRΔA after each panning round is indicated. The bound phage were eluted from the plates by incubation with 0.1 M glycine (pH 2.5) as explained in Materials and Methods. After recovery, the titers of these phage were determined on E . coli XL-1 Blue cells and selected for AMP resistance. In each panning round, the number of input phage was kept constant at 2 × 10 11 PFU and the phage that did not bind 6xhis TouRΔA were removed by 40 washing steps with PBS. The increase in the number of bound phage after the second round of panning is indicative of a preferential amplification of Phab clones binding to 6xhis TouRΔA.

    Article Snippet: The E. coli strain XL-1 Blue ( recA1 gyrA96 relA1 endA1 hsdR17 supE44 thi1 lac [F′ proAB lacI q lacZ ΔM15 Tn 10 ] Tcr ; Stratagene) was used as host for bacteriophages and phagemids.

    Techniques: Selection, Binding Assay, Enzyme-linked Immunosorbent Assay, Incubation, Amplification, Clone Assay

    Amino acid sequence of scFv B7. The amino acid sequence of the scFv B7 polypeptide encoded by the phagemid is shown. The positions of the N-terminal signal peptide, the V H domain, the (Gly 4 Ser) 3 linker peptide, the V L domain, and the E tag are indicated. The complementarity-determining regions (CDR) of the V H and V L domains are labeled and underlined. The site of cleavage of the bacterial signal peptidase is marked by an arrow. The five amino acid changes found in the scFv B9 are marked below the sequence of scFv B7. When produced in E . coli XL-1 Blue cells ( supE ), these scFvs are also synthesized as hybrids with protein 3 of M13. The location of the suppressed stop codon (amber), which is placed between the scFv and protein 3 coding sequences, is indicated.

    Journal: Journal of Bacteriology

    Article Title: Monitoring Intracellular Levels of XylR in Pseudomonas putida with a Single-Chain Antibody Specific for Aromatic-Responsive Enhancer-Binding Proteins

    doi: 10.1128/JB.183.19.5571-5579.2001

    Figure Lengend Snippet: Amino acid sequence of scFv B7. The amino acid sequence of the scFv B7 polypeptide encoded by the phagemid is shown. The positions of the N-terminal signal peptide, the V H domain, the (Gly 4 Ser) 3 linker peptide, the V L domain, and the E tag are indicated. The complementarity-determining regions (CDR) of the V H and V L domains are labeled and underlined. The site of cleavage of the bacterial signal peptidase is marked by an arrow. The five amino acid changes found in the scFv B9 are marked below the sequence of scFv B7. When produced in E . coli XL-1 Blue cells ( supE ), these scFvs are also synthesized as hybrids with protein 3 of M13. The location of the suppressed stop codon (amber), which is placed between the scFv and protein 3 coding sequences, is indicated.

    Article Snippet: The E. coli strain XL-1 Blue ( recA1 gyrA96 relA1 endA1 hsdR17 supE44 thi1 lac [F′ proAB lacI q lacZ ΔM15 Tn 10 ] Tcr ; Stratagene) was used as host for bacteriophages and phagemids.

    Techniques: Sequencing, Labeling, Produced, Synthesized