xbai psti digested pmalc 2x plasmid  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 82

    Structured Review

    New England Biolabs xbai psti digested pmalc 2x plasmid
    Xbai Psti Digested Pmalc 2x Plasmid, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai psti digested pmalc 2x plasmid/product/New England Biolabs
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xbai psti digested pmalc 2x plasmid - by Bioz Stars, 2020-03
    82/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: p33-Independent Activation of a Truncated p92 RNA-Dependent RNA Polymerase of Tomato Bushy Stunt Virus in Yeast Cell-Free Extract
    Article Snippet: .. In the first step, the TBSV p92 open reading frame (ORF) was PCR amplified using pMalTBSV92 ( ) and primers 2079 (GTCGTCTAGAATGGAGACCATCAAGAGAATG) and 3529 (CCAGCTGCAGTCAAGCTACGGCGGAGTCGAGG), digested with XbaI and PstI, and cloned into XbaI-PstI-digested pMalc-2X plasmid (NEB) to create the pMalTBSV92XP plasmid, with restriction sites suitable for further cloning steps. .. In the second step, the RPR motif ( ) was deleted from pMalTBSV92XP, creating pMalTBSV92ΔRPR: the N-terminal portion was PCR amplified with primers 2079 and 3522 (GGAGGCTAGCCCCAGTGGACGCGATCACC), while the C-terminal portion was amplified using primers 3521 (GGAGGCTAGCTATGCGGCAAAGATCGCAC) and 3529.

    Amplification:

    Article Title: p33-Independent Activation of a Truncated p92 RNA-Dependent RNA Polymerase of Tomato Bushy Stunt Virus in Yeast Cell-Free Extract
    Article Snippet: .. In the first step, the TBSV p92 open reading frame (ORF) was PCR amplified using pMalTBSV92 ( ) and primers 2079 (GTCGTCTAGAATGGAGACCATCAAGAGAATG) and 3529 (CCAGCTGCAGTCAAGCTACGGCGGAGTCGAGG), digested with XbaI and PstI, and cloned into XbaI-PstI-digested pMalc-2X plasmid (NEB) to create the pMalTBSV92XP plasmid, with restriction sites suitable for further cloning steps. .. In the second step, the RPR motif ( ) was deleted from pMalTBSV92XP, creating pMalTBSV92ΔRPR: the N-terminal portion was PCR amplified with primers 2079 and 3522 (GGAGGCTAGCCCCAGTGGACGCGATCACC), while the C-terminal portion was amplified using primers 3521 (GGAGGCTAGCTATGCGGCAAAGATCGCAC) and 3529.

    Ligation:

    Article Title: p33-Independent Activation of a Truncated p92 RNA-Dependent RNA Polymerase of Tomato Bushy Stunt Virus in Yeast Cell-Free Extract
    Article Snippet: In the first step, the TBSV p92 open reading frame (ORF) was PCR amplified using pMalTBSV92 ( ) and primers 2079 (GTCGTCTAGAATGGAGACCATCAAGAGAATG) and 3529 (CCAGCTGCAGTCAAGCTACGGCGGAGTCGAGG), digested with XbaI and PstI, and cloned into XbaI-PstI-digested pMalc-2X plasmid (NEB) to create the pMalTBSV92XP plasmid, with restriction sites suitable for further cloning steps. .. The final PCR product was PCR amplified using the previous ligation mix and primers 2079 and 3692 (CCAGTTCGAACCATCTTCCAACCGCCTTG) and then digested with XbaI and Bsp119I, followed by ligation into a similarly digested pMalTBSV92XP plasmid, thus producing pMalTBSV92ΔRPR.

    Construct:

    Article Title: p33-Independent Activation of a Truncated p92 RNA-Dependent RNA Polymerase of Tomato Bushy Stunt Virus in Yeast Cell-Free Extract
    Article Snippet: The E. coli -based expression plasmid pMalTBSV92Δ167AAΔRPR was constructed in 3 steps. .. In the first step, the TBSV p92 open reading frame (ORF) was PCR amplified using pMalTBSV92 ( ) and primers 2079 (GTCGTCTAGAATGGAGACCATCAAGAGAATG) and 3529 (CCAGCTGCAGTCAAGCTACGGCGGAGTCGAGG), digested with XbaI and PstI, and cloned into XbaI-PstI-digested pMalc-2X plasmid (NEB) to create the pMalTBSV92XP plasmid, with restriction sites suitable for further cloning steps.

    Expressing:

    Article Title: p33-Independent Activation of a Truncated p92 RNA-Dependent RNA Polymerase of Tomato Bushy Stunt Virus in Yeast Cell-Free Extract
    Article Snippet: Paragraph title: Yeast and Escherichia coli expression plasmids. ... In the first step, the TBSV p92 open reading frame (ORF) was PCR amplified using pMalTBSV92 ( ) and primers 2079 (GTCGTCTAGAATGGAGACCATCAAGAGAATG) and 3529 (CCAGCTGCAGTCAAGCTACGGCGGAGTCGAGG), digested with XbaI and PstI, and cloned into XbaI-PstI-digested pMalc-2X plasmid (NEB) to create the pMalTBSV92XP plasmid, with restriction sites suitable for further cloning steps.

    Polymerase Chain Reaction:

    Article Title: p33-Independent Activation of a Truncated p92 RNA-Dependent RNA Polymerase of Tomato Bushy Stunt Virus in Yeast Cell-Free Extract
    Article Snippet: .. In the first step, the TBSV p92 open reading frame (ORF) was PCR amplified using pMalTBSV92 ( ) and primers 2079 (GTCGTCTAGAATGGAGACCATCAAGAGAATG) and 3529 (CCAGCTGCAGTCAAGCTACGGCGGAGTCGAGG), digested with XbaI and PstI, and cloned into XbaI-PstI-digested pMalc-2X plasmid (NEB) to create the pMalTBSV92XP plasmid, with restriction sites suitable for further cloning steps. .. In the second step, the RPR motif ( ) was deleted from pMalTBSV92XP, creating pMalTBSV92ΔRPR: the N-terminal portion was PCR amplified with primers 2079 and 3522 (GGAGGCTAGCCCCAGTGGACGCGATCACC), while the C-terminal portion was amplified using primers 3521 (GGAGGCTAGCTATGCGGCAAAGATCGCAC) and 3529.

    Plasmid Preparation:

    Article Title: p33-Independent Activation of a Truncated p92 RNA-Dependent RNA Polymerase of Tomato Bushy Stunt Virus in Yeast Cell-Free Extract
    Article Snippet: .. In the first step, the TBSV p92 open reading frame (ORF) was PCR amplified using pMalTBSV92 ( ) and primers 2079 (GTCGTCTAGAATGGAGACCATCAAGAGAATG) and 3529 (CCAGCTGCAGTCAAGCTACGGCGGAGTCGAGG), digested with XbaI and PstI, and cloned into XbaI-PstI-digested pMalc-2X plasmid (NEB) to create the pMalTBSV92XP plasmid, with restriction sites suitable for further cloning steps. .. In the second step, the RPR motif ( ) was deleted from pMalTBSV92XP, creating pMalTBSV92ΔRPR: the N-terminal portion was PCR amplified with primers 2079 and 3522 (GGAGGCTAGCCCCAGTGGACGCGATCACC), while the C-terminal portion was amplified using primers 3521 (GGAGGCTAGCTATGCGGCAAAGATCGCAC) and 3529.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 82
    New England Biolabs xbai psti digested pmalc 2x plasmid
    Xbai Psti Digested Pmalc 2x Plasmid, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai psti digested pmalc 2x plasmid/product/New England Biolabs
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xbai psti digested pmalc 2x plasmid - by Bioz Stars, 2020-03
    82/100 stars
      Buy from Supplier

    Image Search Results