wt expression kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    WT Expression Kit
    Description:
    The WT Expression Kit is an RNA amplification kit that is designed to generate amplified sense-strand cDNA ready for fragmentation and labeling using the Affymetrix GeneChip WT Terminal Labeling Kit.Features of the WT Expression Kit:• Optimized for use with Affymetrix GeneChip Human, Mouse, and Rat 1.0 ST Arrays• Allows RNA samples as small as 50 ng to be analyzed on Affymetrix GeneChip Arrays• Supports a streamlined workflow that does not require a separate rRNA depletion step• Is ideal for high-sensitivity expression profilingEliminates separate rRNA depletion step, preserves transcriptome coverageThe first-generation Affymetrix amplification method requires depletion of ribosomal RNA (rRNA) from RNA samples for optimal exon-level analysis. Conversely, the Ambion WT Expression Kit uses a novel reverse transcription (RT) priming method that eliminates the need for a separate rRNA depletion step. The kit includes RT primers designed using a proprietary oligonucleotide matching algorithm that eliminates primer sequences with homology to known ribosomal RNAs. The result is complete and unbiased coverage of the transcriptome, with rRNA amplification levels significantly lower than those of other methods.Consistent results from less input RNAWith the Ambion WT Expression Kit, samples as small as 50 ng of total RNA can be analyzed on Affymetrix GeneChip Human, Mouse, and Rat Exon and Gene 1.0 ST Arrays. Previous methods required 1 µg of total RNA—often difficult or impossible to obtain from limited sources such as stem cells or small tissue samples. The modest requirement for input RNA permits the analysis of rare samples and provides for more efficient and cost-effective experimentation for most sample types. To demonstrate the performance of the WT Expression Kit, RNA from three sample types (HeLa cells, and Microarray Quality Control (MAQC) A and B samples) was prepared in triplicate using either the Affymetrix GeneChip WT cDNA Synthesis and Amplification Kit or the WT Expression Kit, and analyzed on Human Exon 1.0 ST Arrays. Total RNA (1 µg) prepared by the Affymetrix protocol underwent an rRNA-depletion step while just 50 ng total RNA (20-fold less) was prepared for microarray analysis using the WT Expression Kit. Both sets of samples were handled according to the manufacturers' recommendations. Direct correlation of log2 ratios for MAQC samples A and B was high, (r >0.94) at both the exon and transcript levels. Correlation of log2 ratios with gene expression data obtained using TaqMan Gene Expression assays for real-time PCR was also high for both kits (see Product Bulletin for data).Identify more differential expression with less RNAIn addition to its lower input RNA requirement, the WT Expression Kit provides a significant increase in sensitivity. A greater number of probe sets detected above background was obtained at the exon level with the WT Expression Kit as a result of an increased signal-to-noise ratio. A comparison of differential expression analysis results from the two methods indicated that, while differentially expressed genes and exons of MAQC A and MAQC B samples were similar between the two kits (78% and 89%, respectively), significantly more differential expression was observed on arrays hybridized with samples prepared using the WT Expression Kit. 499 more genes and 6,850 more exons were found to be differentially expressed in samples prepared using the Ambion kit, compared to samples prepared with the Affymetrix kit.Note: For manual use only. Not for robotics.
    Catalog Number:
    4411973
    Price:
    None
    Applications:
    RNAi, Epigenetics & Non-Coding RNA Research|miRNA & Non-Coding RNA Analysis
    Size:
    10 reactions
    Category:
    Kits and Assays, RNA Amplification Kits
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher wt expression kit
    The WT Expression Kit is an RNA amplification kit that is designed to generate amplified sense-strand cDNA ready for fragmentation and labeling using the Affymetrix GeneChip WT Terminal Labeling Kit.Features of the WT Expression Kit:• Optimized for use with Affymetrix GeneChip Human, Mouse, and Rat 1.0 ST Arrays• Allows RNA samples as small as 50 ng to be analyzed on Affymetrix GeneChip Arrays• Supports a streamlined workflow that does not require a separate rRNA depletion step• Is ideal for high-sensitivity expression profilingEliminates separate rRNA depletion step, preserves transcriptome coverageThe first-generation Affymetrix amplification method requires depletion of ribosomal RNA (rRNA) from RNA samples for optimal exon-level analysis. Conversely, the Ambion WT Expression Kit uses a novel reverse transcription (RT) priming method that eliminates the need for a separate rRNA depletion step. The kit includes RT primers designed using a proprietary oligonucleotide matching algorithm that eliminates primer sequences with homology to known ribosomal RNAs. The result is complete and unbiased coverage of the transcriptome, with rRNA amplification levels significantly lower than those of other methods.Consistent results from less input RNAWith the Ambion WT Expression Kit, samples as small as 50 ng of total RNA can be analyzed on Affymetrix GeneChip Human, Mouse, and Rat Exon and Gene 1.0 ST Arrays. Previous methods required 1 µg of total RNA—often difficult or impossible to obtain from limited sources such as stem cells or small tissue samples. The modest requirement for input RNA permits the analysis of rare samples and provides for more efficient and cost-effective experimentation for most sample types. To demonstrate the performance of the WT Expression Kit, RNA from three sample types (HeLa cells, and Microarray Quality Control (MAQC) A and B samples) was prepared in triplicate using either the Affymetrix GeneChip WT cDNA Synthesis and Amplification Kit or the WT Expression Kit, and analyzed on Human Exon 1.0 ST Arrays. Total RNA (1 µg) prepared by the Affymetrix protocol underwent an rRNA-depletion step while just 50 ng total RNA (20-fold less) was prepared for microarray analysis using the WT Expression Kit. Both sets of samples were handled according to the manufacturers' recommendations. Direct correlation of log2 ratios for MAQC samples A and B was high, (r >0.94) at both the exon and transcript levels. Correlation of log2 ratios with gene expression data obtained using TaqMan Gene Expression assays for real-time PCR was also high for both kits (see Product Bulletin for data).Identify more differential expression with less RNAIn addition to its lower input RNA requirement, the WT Expression Kit provides a significant increase in sensitivity. A greater number of probe sets detected above background was obtained at the exon level with the WT Expression Kit as a result of an increased signal-to-noise ratio. A comparison of differential expression analysis results from the two methods indicated that, while differentially expressed genes and exons of MAQC A and MAQC B samples were similar between the two kits (78% and 89%, respectively), significantly more differential expression was observed on arrays hybridized with samples prepared using the WT Expression Kit. 499 more genes and 6,850 more exons were found to be differentially expressed in samples prepared using the Ambion kit, compared to samples prepared with the Affymetrix kit.Note: For manual use only. Not for robotics.
    https://www.bioz.com/result/wt expression kit/product/Thermo Fisher
    Average 99 stars, based on 589 article reviews
    Price from $9.99 to $1999.99
    wt expression kit - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA. .. 1 μg of cRNA was fragmented in 1× Fragmentation Buffer (mRNA-Seq Sample Prep Kit, Illumina) at 94°C for 5 min, then placed on ice and the reaction was stopped by the addition of 20 mM EDTA.

    Amplification:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: 1 ng of purified total RNA, as determined by Agilent Bioanalyzer (Agilent Technologies), was processed with the mRNA direct micro kit (Life Technologies) to select for poly A RNA. .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA. .. The cRNA was purified following the manufacturer’s instructions and the concentration was determined with a NanoDrop instrument (ThermoFisher).

    Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
    Article Snippet: Data were normalized and expression values were modeled using DNA-Chip analyzer (dChip) software ( www.dChip.org ) . .. Mouse Gene 1.0 ST Arrays, RNA was amplified with the WT Expression Kit (Ambion) and labeled, fragmented, and hybridized with the WT Terminal Labeling and Hybridization Kit (Affymetrix). .. Data was processed using RMA quantile normalization and expression values were modeled using ArrayStar software (DNASTAR).

    Article Title: Gene-wide Association Study Reveals RNF122 Ubiquitin Ligase as a Novel Susceptibility Gene for Attention Deficit Hyperactivity Disorder
    Article Snippet: RNA was reverse transcribed using the Ambion WT Expression Kit [Life technologies, Massachusetts, USA]. .. The cRNA was subsequently fragmented, labelled and hybridized with the GeneChip WT Terminal Labeling and Hybridization Kit to the Genechip Human Gene 1.1 ST 96-Array plate [Affymetrix, Santa Clara, California, USA].

    Article Title: The Immunome in Two Inherited Forms of Pulmonary Fibrosis
    Article Snippet: RNA quality was assessed by Agilent Bioanalyzer and quantified by NanoDrop 2000 (ThermoFisher Scientific, Waltham, MA, USA). .. 300 ng of total RNA were amplified using Ambion WT expression kit (Life Sciences) according to the manufacturer’s instructions. .. Fragmented single-stranded sense cDNA were terminally labeled and hybridized to Human 1.0 ST GeneChip arrays (Affymetrix, Santa Clara, CA, USA) and stained on a GeneChip Fluidics Station 450 (Affymetrix), according to the respective manufacturers’ instructions.

    Article Title: Differentiation of human and murine induced pluripotent stem cells to microglia-like cells
    Article Snippet: RNA from human dendritic and bone marrow macrophages (AllCells) was also used. .. Isolated total RNA was amplified with the WT Expression Kit (Ambion), and labeled with the GeneChip WT Terminal Labeling and Controls Kit (Affymetrix). .. Labeled cRNA were hybridized to the Affymetrix GeneChip Human Gene 2.0 ST Array (Affymetrix, Inc) in blinded interleaved fashion.

    Synthesized:

    Article Title: mRNA 3′ uridylation and poly(A) tail length sculpt the mammalian maternal transcriptome
    Article Snippet: The fragmentation and labeling was done using the Encore Biotin Module (NuGen). .. For all other cells and tissues, biotinylated cDNA was synthesized from total RNA using the Ambion WT Expression kit. .. The fragmentation and labeling was done using the GeneChip WT Terminal Labeling and Controls kit (Affymetrix).

    Article Title: Germline Gain-of-Function Mutations in AFF4 Cause a Developmental Syndrome Functionally Linking the Super Elongation Complex and Cohesin
    Article Snippet: First-strand cDNA was synthesized from the extracted RNA, then second-strand cDNA was synthesized from the first-strand cDNA. .. Purified sense-strand cDNA was made from extracted RNA using Ambion WT Expression Kit (Ambion).

    Cytometry:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n=2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Real-time Polymerase Chain Reaction:

    Article Title: Inhibition of JAK/STAT signaling stimulates adult satellite cell function
    Article Snippet: Total RNA was extracted from each replicate using the Picopure RNA isolation kit (Applied Biosystems) and concentrated using the RNA Clean and Concentrator-5 kit (Zymo Research) according to the manufacturer’s instructions. qPCR analysis was conducted as described earlier3 with the following primer sequences 5’ to 3’: JunD ex 1 F ATCTTGGGCTGCTCAAACTC, JunD ex1 R AACTGCTCAGGTTGGCGTAG, Bcl2 ex1 F GAGCGTCAACAGGGAGATGT, Bcl2 ex2 R CTCACTTGTGGCCCAGGTAT, Bcl6 ex4 F CCTGAGGGAAGGCAATATCA, Bcl6 ex5 R CGGCTGTTCAGGAACTCTTC, Cebpd ex1 F CGCAGACAGTGGTGAGCTT, Cebpd ex1 R CTTCTGCTGCATCTCCTGGT, Fos ex1 F ATGGGCTCTCCTGTCAACAC, Fos ex2 R GACACGGTCTTCACCATTCC, Myc ex2 F TCCTGTACCTCGTCCGATTC, Myc ex3 R GGTTTGCCTCTTCTCCACAG, Egfr ex1 F ACACTGCTGGTGTTGCTGAC, Egfr ex2 R CCCAAGGACCACTTCACAGT, Ar ex4 F CGGACATGACAACAACCAAC, Ar ex5 R ATCTGGTCATCCACATGCAA, gp130 ex2 F GGAGCAGGTCACTGTCATCA, gp130 ex3 R CTTCCCCTCATTCACAATGC, Pim1 ex4 F CGACATCAAGGACGAGAACA, Pim1 ex5 R TCCGCAGACCATGTCATAGA, Socs3 ex2 F GCAAGCTGCAGGAGAGCGGATT, Socs3 ex2 R AAGAAGTGGCGCTGGTCCGA. .. Microarray target preparation was achieved using the WT Expression kit (Ambion) and the Genechip terminal labelling kit (Affymetrix).

    Microarray:

    Article Title: mRNA 3′ uridylation and poly(A) tail length sculpt the mammalian maternal transcriptome
    Article Snippet: For microarray profiling of oocytes, biotinylated cDNA was synthesized from total RNA using the Ovation Pico WTA System V2 kit (NuGen). .. For all other cells and tissues, biotinylated cDNA was synthesized from total RNA using the Ambion WT Expression kit.

    Article Title: Knockdown of SIRT1 Suppresses Bladder Cancer Cell Proliferation and Migration and Induces Cell Cycle Arrest and Antioxidant Response through FOXO3a-Mediated Pathways
    Article Snippet: Paragraph title: 2.3.2. Microarray Analysis of mRNA Isolated from Human Bladder Tissues ... Briefly, biotinylated cDNA were prepared from 250 ng total RNA using the Ambion® WT Expression Kit.

    Article Title: Sensing prokaryotic mRNA signifies microbial viability and promotes immunity
    Article Snippet: One hundred nanograms of RNA were used for whole transcript cDNA synthesis with the Ambion WT expression kit (Applied Biosystems, Nieuwekerk a/d IJssel, The Netherlands). .. Hybridization, washing and scanning of an Affymetrix GeneChip Mouse Gene 1.1 ST 24-array plate was carried out according to standard Affymetrix protocols on a GeneTitan instrument (Affymetrix, Santa Clara, CA).

    Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
    Article Snippet: Paragraph title: Expression microarray analysis ... Mouse Gene 1.0 ST Arrays, RNA was amplified with the WT Expression Kit (Ambion) and labeled, fragmented, and hybridized with the WT Terminal Labeling and Hybridization Kit (Affymetrix).

    Article Title: Repeated Exposure to Lutzomyia intermedia Sand Fly Saliva Induces Local Expression of Interferon-Inducible Genes Both at the Site of Injection in Mice and in Human Blood
    Article Snippet: Ears were harvested 2 weeks after challenge, homogenized using a tissue lyser (Qiagen, Hilden, Germany) and mRNA was extracted by the RNeasy Plus Mini kit (Qiagen). .. For microarray analysis RNA was harvested from ears 2 weeks post inoculation and for each sample condition, three independent sets of 200 ng of total RNA were isolated and used as a template for probe generation using an Ambion WT expression kit (Applied Biosystems, Foster City, CA) and the cDNA was fragmented and labeled with WT DNA terminal labeling kit (Affymetrix, Santa Clara, CA). .. Biotinylated sense strand fragments were hybridized to Affymetrix Mouse Gene 1.0 ST GeneChips using the Hybridization Control and Hybridization Wash and Stain kits at 45°C for 18 h. The stained array was scanned using an Affymetrix GeneChip Scanner 3000 7G to generate the CEL files.

    Article Title: Efficient DNA binding of NF-κB requires the chaperone-like function of NPM1
    Article Snippet: Paragraph title: Microarray hybridization and data analysis ... The sense-strand cDNA was prepared using Ambion WT Expression Kit from 200 ng total RNA.

    Article Title: Gene-wide Association Study Reveals RNF122 Ubiquitin Ligase as a Novel Susceptibility Gene for Attention Deficit Hyperactivity Disorder
    Article Snippet: RNA was reverse transcribed using the Ambion WT Expression Kit [Life technologies, Massachusetts, USA]. .. The experiment was performed in 9 different amplification rounds, introducing a batch factor that was taken into consideration in the following statistical analyses.

    Article Title: Expression level of CXCL7 in peripheral blood cells is a potential biomarker for the diagnosis of renal cell carcinoma
    Article Snippet: Paragraph title: RNA extraction from blood and microarray analysis ... Total RNA (100 ng) was subjected to cDNA synthesis using the Ambion WT expression kit (Life Technologies, Carlsbad, CA, USA). cDNA was biotinylated and then fragmented with the GeneChip WT terminal labeling kit (Affymetrix, Santa Clara, CA, USA).

    Article Title: Silencing of HJURP induces dysregulation of cell cycle and ROS metabolism in bladder cancer cells via PPARγ-SIRT1 feedback loop
    Article Snippet: Paragraph title: Microarray analysis of mRNA isolated from human bladder tissues ... Briefly, according to the standard Affymetrix protocol, 250 ng total RNA of each sample was prepared to biotinylated cDNA by Ambion® WT Expression Kit.

    Article Title: The Immunome in Two Inherited Forms of Pulmonary Fibrosis
    Article Snippet: Paragraph title: RNA Isolation and Microarray Hybridization ... 300 ng of total RNA were amplified using Ambion WT expression kit (Life Sciences) according to the manufacturer’s instructions.

    Article Title: miR-130b-3p Modulates Epithelial-Mesenchymal Crosstalk in Lung Fibrosis by Targeting IGF-1
    Article Snippet: Paragraph title: Lung tissues and microarray ... Total RNA was isolated with Trizol, Biotinylated cDNA was prepared according to the standard Affymetrix protocol 3 from 250 ng total RNA by using Ambion® WT Expression Kit.

    Article Title: Differentiation of human and murine induced pluripotent stem cells to microglia-like cells
    Article Snippet: Paragraph title: Microarray hybridization ... Isolated total RNA was amplified with the WT Expression Kit (Ambion), and labeled with the GeneChip WT Terminal Labeling and Controls Kit (Affymetrix).

    Article Title: Inhibition of JAK/STAT signaling stimulates adult satellite cell function
    Article Snippet: Sample RNA quality was assessed on the Agilent Bioanalyzer 2100 using the RNA 6000 nano chip (Agilent Technologies, Santa Clara). .. Microarray target preparation was achieved using the WT Expression kit (Ambion) and the Genechip terminal labelling kit (Affymetrix). .. The microarray data was collected using Genechip mouse gene 1.0 ST arrays (Affymetrix).

    Article Title: Adipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota
    Article Snippet: Paragraph title: Microarray analysis ... The WT expression kit (Ambion) was used for complementary RNA preparation from the total RNA.

    Random Hexamer Labeling:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA. .. The fragments were precipitated with 70 mM sodium actetate (Life Technologies), 40 μg glycogen (Life Technologies) and 70% ethanol at −80°C for 1 hour followed by centrifugation and washing with 70% ethanol.

    Significance Assay:

    Article Title: Gene-wide Association Study Reveals RNF122 Ubiquitin Ligase as a Novel Susceptibility Gene for Attention Deficit Hyperactivity Disorder
    Article Snippet: Expression levels of genes identified in the gene-wide study (follow-up P-value threshold < 1e-03) were tested in PBMCs of 45 medication-naive adults with a new clinical diagnosis of ADHD (69% male; mean age = 38 years (SD = 9.9)) and 39 healthy unrelated controls (60% males, mean age = 35 years (SD = 12.1)). .. RNA was reverse transcribed using the Ambion WT Expression Kit [Life technologies, Massachusetts, USA].

    Expressing:

    Article Title: Rare coding variants in Phospholipase D3 (PLD3) confer risk for Alzheimer's disease
    Article Snippet: Total RNA was isolated from human post-mortem brain tissues using the miRNeasy 96 well kit (Qiagen, UK). .. The quality of total RNA was evaluated by the 2100 Bioanalyzer (Agilent, UK) and RNA 6000 Nano Kit (Agilent, UK) before processing with the Ambion® WT Expression Kit and Affymetrix GeneChip Whole Transcript Sense Target Labeling Assay and hybridization to the Affymetrix Exon 1.0 ST. All arrays were pre-processed using Robust Multi-array Average using Partek Genomics Suite v6.6 (Partek Incorporated, USA). .. The resulting expression data was corrected for individual effects (within which are nested postmortem interval, brain pH, sex, age at death and cause of death) and experimental batch effects (date of hybridization).

    Article Title: mRNA 3′ uridylation and poly(A) tail length sculpt the mammalian maternal transcriptome
    Article Snippet: The fragmentation and labeling was done using the Encore Biotin Module (NuGen). .. For all other cells and tissues, biotinylated cDNA was synthesized from total RNA using the Ambion WT Expression kit. .. The fragmentation and labeling was done using the GeneChip WT Terminal Labeling and Controls kit (Affymetrix).

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: 1 ng of purified total RNA, as determined by Agilent Bioanalyzer (Agilent Technologies), was processed with the mRNA direct micro kit (Life Technologies) to select for poly A RNA. .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA. .. The cRNA was purified following the manufacturer’s instructions and the concentration was determined with a NanoDrop instrument (ThermoFisher).

    Article Title: Knockdown of SIRT1 Suppresses Bladder Cancer Cell Proliferation and Migration and Induces Cell Cycle Arrest and Antioxidant Response through FOXO3a-Mediated Pathways
    Article Snippet: As previously reported by Cao et al. [ ], Wang et al. [ ], and Qian et al. [ ] from our group, a transcriptome analysis was established by using three human BCa versus three normal bladder tissues. .. Briefly, biotinylated cDNA were prepared from 250 ng total RNA using the Ambion® WT Expression Kit. .. Then, 5.5 μ g cDNA were hybridized on GeneChip Human Transcriptome Array 2.0 (16 h at 45°C) in Hybridization Oven 645.

    Article Title: Sensing prokaryotic mRNA signifies microbial viability and promotes immunity
    Article Snippet: RNA was judged as suitable only if samples showed intact bands of 18S and 28S ribosomal RNA subunits, displayed no chromosomal peaks or RNA degradation products, and had a RNA integrity number (RIN) above 8.0. .. One hundred nanograms of RNA were used for whole transcript cDNA synthesis with the Ambion WT expression kit (Applied Biosystems, Nieuwekerk a/d IJssel, The Netherlands). .. Hybridization, washing and scanning of an Affymetrix GeneChip Mouse Gene 1.1 ST 24-array plate was carried out according to standard Affymetrix protocols on a GeneTitan instrument (Affymetrix, Santa Clara, CA).

    Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
    Article Snippet: Data were normalized and expression values were modeled using DNA-Chip analyzer (dChip) software ( www.dChip.org ) . .. Mouse Gene 1.0 ST Arrays, RNA was amplified with the WT Expression Kit (Ambion) and labeled, fragmented, and hybridized with the WT Terminal Labeling and Hybridization Kit (Affymetrix). .. Data was processed using RMA quantile normalization and expression values were modeled using ArrayStar software (DNASTAR).

    Article Title: Repeated Exposure to Lutzomyia intermedia Sand Fly Saliva Induces Local Expression of Interferon-Inducible Genes Both at the Site of Injection in Mice and in Human Blood
    Article Snippet: Ears were harvested 2 weeks after challenge, homogenized using a tissue lyser (Qiagen, Hilden, Germany) and mRNA was extracted by the RNeasy Plus Mini kit (Qiagen). .. For microarray analysis RNA was harvested from ears 2 weeks post inoculation and for each sample condition, three independent sets of 200 ng of total RNA were isolated and used as a template for probe generation using an Ambion WT expression kit (Applied Biosystems, Foster City, CA) and the cDNA was fragmented and labeled with WT DNA terminal labeling kit (Affymetrix, Santa Clara, CA). .. Biotinylated sense strand fragments were hybridized to Affymetrix Mouse Gene 1.0 ST GeneChips using the Hybridization Control and Hybridization Wash and Stain kits at 45°C for 18 h. The stained array was scanned using an Affymetrix GeneChip Scanner 3000 7G to generate the CEL files.

    Article Title: Efficient DNA binding of NF-κB requires the chaperone-like function of NPM1
    Article Snippet: HeLa cells were incubated with NPM1 or control siRNA for 72 h and treated without or with 20 ng/ml TNF-α for 2 h. Total RNA was then isolated using RNeasy Kit (Qiagen) according to the manufacturer's instructions. .. The sense-strand cDNA was prepared using Ambion WT Expression Kit from 200 ng total RNA. .. The cDNA was then fragmented and labeled using the Affymetrix GeneChip WT Terminal Labeling Kit.

    Article Title: Gene-wide Association Study Reveals RNF122 Ubiquitin Ligase as a Novel Susceptibility Gene for Attention Deficit Hyperactivity Disorder
    Article Snippet: The quality of the samples was assayed by 2100 Bioanalyzer [Agilent Technologies Inc. Santa Clara, California, USA]. .. RNA was reverse transcribed using the Ambion WT Expression Kit [Life technologies, Massachusetts, USA]. .. The cRNA was subsequently fragmented, labelled and hybridized with the GeneChip WT Terminal Labeling and Hybridization Kit to the Genechip Human Gene 1.1 ST 96-Array plate [Affymetrix, Santa Clara, California, USA].

    Article Title: Germline Gain-of-Function Mutations in AFF4 Cause a Developmental Syndrome Functionally Linking the Super Elongation Complex and Cohesin
    Article Snippet: Labelled aRNA was hybridized to Affymetrix GeneChip Human Genome U133 Plus 2.0 Arrays (Affymetrix). .. Purified sense-strand cDNA was made from extracted RNA using Ambion WT Expression Kit (Ambion). .. 100ng of RNA was used from each sample.

    Article Title: Expression level of CXCL7 in peripheral blood cells is a potential biomarker for the diagnosis of renal cell carcinoma
    Article Snippet: Total RNA was extracted from 204 blood samples according to the manufacturer's protocols. .. Total RNA (100 ng) was subjected to cDNA synthesis using the Ambion WT expression kit (Life Technologies, Carlsbad, CA, USA). cDNA was biotinylated and then fragmented with the GeneChip WT terminal labeling kit (Affymetrix, Santa Clara, CA, USA). .. After making the hybridization cocktail, biotinylated cDNAs were hybridized with GeneChip Human Transcriptome Array 2.0 (Affymetrix) for 16 h using 24 samples as the discovery cohort.

    Article Title: Silencing of HJURP induces dysregulation of cell cycle and ROS metabolism in bladder cancer cells via PPARγ-SIRT1 feedback loop
    Article Snippet: A microarray analysis was established using mRNA isolated from the three bladder cancer tissues and the three normal bladder tissues. .. Briefly, according to the standard Affymetrix protocol, 250 ng total RNA of each sample was prepared to biotinylated cDNA by Ambion® WT Expression Kit. .. On GeneChip Human Transcriptome Array 2.0, 5.5 µg of cDNA were hybridized for 16 h at 45 ºC, continuously washed and stained in the Affymetrix Fluidics Station 450, scanned by Affymetrix® GeneChip Command Console (AGCC) installed in GeneChip® Scanner 3000 (7G).

    Article Title: Independent Mechanisms Lead to Genomic Instability in Hodgkin Lymphoma: Microsatellite or Chromosomal Instability
    Article Snippet: Total RNA was extracted from frozen HL cells and controls (REMB lymphoblastoide cell line) using the AllPrep DNA/RNA/protein Mini kit (Qiagen, Hilden, Germany), quality-controlled using a 2100 BioAnalyzer (Agilent, Santa Clara, CA, USA), and quantified using a Nanodrop 2000c spectrophotometer (Thermo Scientific, Wilmington, DE, USA). .. The WT Expression Kit (Ambion Inc, Austin, TX, USA) was used to prepare cDNA from 10 μg purified cRNA, originally synthesised and purified from 0.25 μg of total RNA, following the manufacturer’s instructions. .. Micronucleus (MN) scoring was performed after telomere and centromere staining.

    Article Title: The Immunome in Two Inherited Forms of Pulmonary Fibrosis
    Article Snippet: RNA quality was assessed by Agilent Bioanalyzer and quantified by NanoDrop 2000 (ThermoFisher Scientific, Waltham, MA, USA). .. 300 ng of total RNA were amplified using Ambion WT expression kit (Life Sciences) according to the manufacturer’s instructions. .. Fragmented single-stranded sense cDNA were terminally labeled and hybridized to Human 1.0 ST GeneChip arrays (Affymetrix, Santa Clara, CA, USA) and stained on a GeneChip Fluidics Station 450 (Affymetrix), according to the respective manufacturers’ instructions.

    Article Title: Insights into TREM2 biology by network analysis of human brain gene expression data
    Article Snippet: Total RNA was isolated from human post-mortem brain tissues using the miRNeasy 96 well kit (Qiagen, Manchester, UK). .. The quality of total RNA was evaluated by the 2100 Bioanalyzer (Agilent Technologies, Wokingham, UK) and RNA 6000 Nano Kit (Agilent Technologies, Wokingham, UK) before processing with the Ambion WT Expression Kit and Affymetrix GeneChip Whole Transcript Sense Target Labeling Assay, and hybridization to the Affymetrix Exon 1.0 ST Arrays (Affymetrix UK Ltd, High Wycombe, UK) following the manufacturers' protocols. .. Hybridized arrays were scanned on an Affymetrix GeneChip Scanner 3000 7G (Affymetrix UK Ltd, High Wycombe, UK) and visually inspected for hybridization artefacts.

    Article Title: miR-130b-3p Modulates Epithelial-Mesenchymal Crosstalk in Lung Fibrosis by Targeting IGF-1
    Article Snippet: All the patients were treated in Beijing Chao-Yang Hospital, Capital Medical University. .. Total RNA was isolated with Trizol, Biotinylated cDNA was prepared according to the standard Affymetrix protocol 3 from 250 ng total RNA by using Ambion® WT Expression Kit. .. Following labeling, 5.5 μg of cDNA were hybridized for 16 hr at 45°C on GeneChip Human Transcriptome Array (Affymetrix, Santa Clara, CA) in Hybridization Oven 645.

    Article Title: Differentiation of human and murine induced pluripotent stem cells to microglia-like cells
    Article Snippet: RNA from human dendritic and bone marrow macrophages (AllCells) was also used. .. Isolated total RNA was amplified with the WT Expression Kit (Ambion), and labeled with the GeneChip WT Terminal Labeling and Controls Kit (Affymetrix). .. Labeled cRNA were hybridized to the Affymetrix GeneChip Human Gene 2.0 ST Array (Affymetrix, Inc) in blinded interleaved fashion.

    Article Title: Inhibition of JAK/STAT signaling stimulates adult satellite cell function
    Article Snippet: Sample RNA quality was assessed on the Agilent Bioanalyzer 2100 using the RNA 6000 nano chip (Agilent Technologies, Santa Clara). .. Microarray target preparation was achieved using the WT Expression kit (Ambion) and the Genechip terminal labelling kit (Affymetrix). .. The microarray data was collected using Genechip mouse gene 1.0 ST arrays (Affymetrix).

    BIA-KA:

    Article Title: Knockdown of SIRT1 Suppresses Bladder Cancer Cell Proliferation and Migration and Induces Cell Cycle Arrest and Antioxidant Response through FOXO3a-Mediated Pathways
    Article Snippet: As previously reported by Cao et al. [ ], Wang et al. [ ], and Qian et al. [ ] from our group, a transcriptome analysis was established by using three human BCa versus three normal bladder tissues. .. Briefly, biotinylated cDNA were prepared from 250 ng total RNA using the Ambion® WT Expression Kit.

    Transplantation Assay:

    Article Title: miR-130b-3p Modulates Epithelial-Mesenchymal Crosstalk in Lung Fibrosis by Targeting IGF-1
    Article Snippet: Lung tissue was obtained from 4 IPF patients with histological evidence of usual interstitial pneumonia at the time of surgical lung biopsy or lung transplantation. .. Total RNA was isolated with Trizol, Biotinylated cDNA was prepared according to the standard Affymetrix protocol 3 from 250 ng total RNA by using Ambion® WT Expression Kit.

    Transformation Assay:

    Article Title: Inhibition of JAK/STAT signaling stimulates adult satellite cell function
    Article Snippet: Microarray target preparation was achieved using the WT Expression kit (Ambion) and the Genechip terminal labelling kit (Affymetrix). .. Microarray target preparation was achieved using the WT Expression kit (Ambion) and the Genechip terminal labelling kit (Affymetrix).

    Derivative Assay:

    Article Title: Sensing prokaryotic mRNA signifies microbial viability and promotes immunity
    Article Snippet: BMM derived from wild type (wt ) or Trif−/− mice were stimulated with viable E. coli for 0, 1, 3 or 6 hours and total RNA was extracted using the RNeasy kit (QIAGEN). .. One hundred nanograms of RNA were used for whole transcript cDNA synthesis with the Ambion WT expression kit (Applied Biosystems, Nieuwekerk a/d IJssel, The Netherlands).

    Article Title: miR-130b-3p Modulates Epithelial-Mesenchymal Crosstalk in Lung Fibrosis by Targeting IGF-1
    Article Snippet: The diagnosis of IPF was derived according to the standards accepted by the American Thoracic Society/European Respiratory Society. .. Total RNA was isolated with Trizol, Biotinylated cDNA was prepared according to the standard Affymetrix protocol 3 from 250 ng total RNA by using Ambion® WT Expression Kit.

    Hybridization:

    Article Title: Rare coding variants in Phospholipase D3 (PLD3) confer risk for Alzheimer's disease
    Article Snippet: Total RNA was isolated from human post-mortem brain tissues using the miRNeasy 96 well kit (Qiagen, UK). .. The quality of total RNA was evaluated by the 2100 Bioanalyzer (Agilent, UK) and RNA 6000 Nano Kit (Agilent, UK) before processing with the Ambion® WT Expression Kit and Affymetrix GeneChip Whole Transcript Sense Target Labeling Assay and hybridization to the Affymetrix Exon 1.0 ST. All arrays were pre-processed using Robust Multi-array Average using Partek Genomics Suite v6.6 (Partek Incorporated, USA). .. The resulting expression data was corrected for individual effects (within which are nested postmortem interval, brain pH, sex, age at death and cause of death) and experimental batch effects (date of hybridization).

    Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
    Article Snippet: Data were normalized and expression values were modeled using DNA-Chip analyzer (dChip) software ( www.dChip.org ) . .. Mouse Gene 1.0 ST Arrays, RNA was amplified with the WT Expression Kit (Ambion) and labeled, fragmented, and hybridized with the WT Terminal Labeling and Hybridization Kit (Affymetrix). .. Data was processed using RMA quantile normalization and expression values were modeled using ArrayStar software (DNASTAR).

    Article Title: Efficient DNA binding of NF-κB requires the chaperone-like function of NPM1
    Article Snippet: Paragraph title: Microarray hybridization and data analysis ... The sense-strand cDNA was prepared using Ambion WT Expression Kit from 200 ng total RNA.

    Article Title: Expression level of CXCL7 in peripheral blood cells is a potential biomarker for the diagnosis of renal cell carcinoma
    Article Snippet: Total RNA (100 ng) was subjected to cDNA synthesis using the Ambion WT expression kit (Life Technologies, Carlsbad, CA, USA). cDNA was biotinylated and then fragmented with the GeneChip WT terminal labeling kit (Affymetrix, Santa Clara, CA, USA). .. After making the hybridization cocktail, biotinylated cDNAs were hybridized with GeneChip Human Transcriptome Array 2.0 (Affymetrix) for 16 h using 24 samples as the discovery cohort.

    Article Title: The Immunome in Two Inherited Forms of Pulmonary Fibrosis
    Article Snippet: Paragraph title: RNA Isolation and Microarray Hybridization ... 300 ng of total RNA were amplified using Ambion WT expression kit (Life Sciences) according to the manufacturer’s instructions.

    Article Title: Insights into TREM2 biology by network analysis of human brain gene expression data
    Article Snippet: Total RNA was isolated from human post-mortem brain tissues using the miRNeasy 96 well kit (Qiagen, Manchester, UK). .. The quality of total RNA was evaluated by the 2100 Bioanalyzer (Agilent Technologies, Wokingham, UK) and RNA 6000 Nano Kit (Agilent Technologies, Wokingham, UK) before processing with the Ambion WT Expression Kit and Affymetrix GeneChip Whole Transcript Sense Target Labeling Assay, and hybridization to the Affymetrix Exon 1.0 ST Arrays (Affymetrix UK Ltd, High Wycombe, UK) following the manufacturers' protocols. .. Hybridized arrays were scanned on an Affymetrix GeneChip Scanner 3000 7G (Affymetrix UK Ltd, High Wycombe, UK) and visually inspected for hybridization artefacts.

    Article Title: Differentiation of human and murine induced pluripotent stem cells to microglia-like cells
    Article Snippet: Paragraph title: Microarray hybridization ... Isolated total RNA was amplified with the WT Expression Kit (Ambion), and labeled with the GeneChip WT Terminal Labeling and Controls Kit (Affymetrix).

    Article Title: Adipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota
    Article Snippet: Mouse gene ST microarray chips were used for hybridization (MoGene 1.0 ST, Affymetrix). .. The WT expression kit (Ambion) was used for complementary RNA preparation from the total RNA.

    Flow Cytometry:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n=2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Gas Chromatography:

    Article Title: Insights into TREM2 biology by network analysis of human brain gene expression data
    Article Snippet: The quality of total RNA was evaluated by the 2100 Bioanalyzer (Agilent Technologies, Wokingham, UK) and RNA 6000 Nano Kit (Agilent Technologies, Wokingham, UK) before processing with the Ambion WT Expression Kit and Affymetrix GeneChip Whole Transcript Sense Target Labeling Assay, and hybridization to the Affymetrix Exon 1.0 ST Arrays (Affymetrix UK Ltd, High Wycombe, UK) following the manufacturers' protocols. .. Further details regarding tissue collection, RNA isolation, quality control, and processing have been previously reported ( ).

    Dissection:

    Article Title: Rare coding variants in Phospholipase D3 (PLD3) confer risk for Alzheimer's disease
    Article Snippet: All samples originated from individuals with no significant neurological history or neuropathological abnormality and were collected by the MRC Edinburgh Brain Bank ensuring a consistent dissection protocol and sample handling procedure. .. The quality of total RNA was evaluated by the 2100 Bioanalyzer (Agilent, UK) and RNA 6000 Nano Kit (Agilent, UK) before processing with the Ambion® WT Expression Kit and Affymetrix GeneChip Whole Transcript Sense Target Labeling Assay and hybridization to the Affymetrix Exon 1.0 ST. All arrays were pre-processed using Robust Multi-array Average using Partek Genomics Suite v6.6 (Partek Incorporated, USA).

    Generated:

    Article Title: Repeated Exposure to Lutzomyia intermedia Sand Fly Saliva Induces Local Expression of Interferon-Inducible Genes Both at the Site of Injection in Mice and in Human Blood
    Article Snippet: For microarray analysis RNA was harvested from ears 2 weeks post inoculation and for each sample condition, three independent sets of 200 ng of total RNA were isolated and used as a template for probe generation using an Ambion WT expression kit (Applied Biosystems, Foster City, CA) and the cDNA was fragmented and labeled with WT DNA terminal labeling kit (Affymetrix, Santa Clara, CA). .. For microarray analysis RNA was harvested from ears 2 weeks post inoculation and for each sample condition, three independent sets of 200 ng of total RNA were isolated and used as a template for probe generation using an Ambion WT expression kit (Applied Biosystems, Foster City, CA) and the cDNA was fragmented and labeled with WT DNA terminal labeling kit (Affymetrix, Santa Clara, CA).

    Article Title: Differentiation of human and murine induced pluripotent stem cells to microglia-like cells
    Article Snippet: Isolated total RNA was amplified with the WT Expression Kit (Ambion), and labeled with the GeneChip WT Terminal Labeling and Controls Kit (Affymetrix). .. Labeled cRNA were hybridized to the Affymetrix GeneChip Human Gene 2.0 ST Array (Affymetrix, Inc) in blinded interleaved fashion.

    Injection:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n=2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Article Title: Efficient DNA binding of NF-κB requires the chaperone-like function of NPM1
    Article Snippet: The sense-strand cDNA was prepared using Ambion WT Expression Kit from 200 ng total RNA. .. The cDNA was then fragmented and labeled using the Affymetrix GeneChip WT Terminal Labeling Kit.

    Isolation:

    Article Title: Rare coding variants in Phospholipase D3 (PLD3) confer risk for Alzheimer's disease
    Article Snippet: Total RNA was isolated from human post-mortem brain tissues using the miRNeasy 96 well kit (Qiagen, UK). .. The quality of total RNA was evaluated by the 2100 Bioanalyzer (Agilent, UK) and RNA 6000 Nano Kit (Agilent, UK) before processing with the Ambion® WT Expression Kit and Affymetrix GeneChip Whole Transcript Sense Target Labeling Assay and hybridization to the Affymetrix Exon 1.0 ST. All arrays were pre-processed using Robust Multi-array Average using Partek Genomics Suite v6.6 (Partek Incorporated, USA).

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Paragraph title: RNA isolation ... Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Article Title: Knockdown of SIRT1 Suppresses Bladder Cancer Cell Proliferation and Migration and Induces Cell Cycle Arrest and Antioxidant Response through FOXO3a-Mediated Pathways
    Article Snippet: Paragraph title: 2.3.2. Microarray Analysis of mRNA Isolated from Human Bladder Tissues ... Briefly, biotinylated cDNA were prepared from 250 ng total RNA using the Ambion® WT Expression Kit.

    Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
    Article Snippet: Total RNA was isolated from cells using the Ambion RNAqueous-Micro Kit. .. Mouse Gene 1.0 ST Arrays, RNA was amplified with the WT Expression Kit (Ambion) and labeled, fragmented, and hybridized with the WT Terminal Labeling and Hybridization Kit (Affymetrix).

    Article Title: Repeated Exposure to Lutzomyia intermedia Sand Fly Saliva Induces Local Expression of Interferon-Inducible Genes Both at the Site of Injection in Mice and in Human Blood
    Article Snippet: Ears were harvested 2 weeks after challenge, homogenized using a tissue lyser (Qiagen, Hilden, Germany) and mRNA was extracted by the RNeasy Plus Mini kit (Qiagen). .. For microarray analysis RNA was harvested from ears 2 weeks post inoculation and for each sample condition, three independent sets of 200 ng of total RNA were isolated and used as a template for probe generation using an Ambion WT expression kit (Applied Biosystems, Foster City, CA) and the cDNA was fragmented and labeled with WT DNA terminal labeling kit (Affymetrix, Santa Clara, CA). .. Biotinylated sense strand fragments were hybridized to Affymetrix Mouse Gene 1.0 ST GeneChips using the Hybridization Control and Hybridization Wash and Stain kits at 45°C for 18 h. The stained array was scanned using an Affymetrix GeneChip Scanner 3000 7G to generate the CEL files.

    Article Title: Efficient DNA binding of NF-κB requires the chaperone-like function of NPM1
    Article Snippet: HeLa cells were incubated with NPM1 or control siRNA for 72 h and treated without or with 20 ng/ml TNF-α for 2 h. Total RNA was then isolated using RNeasy Kit (Qiagen) according to the manufacturer's instructions. .. The sense-strand cDNA was prepared using Ambion WT Expression Kit from 200 ng total RNA.

    Article Title: Gene-wide Association Study Reveals RNF122 Ubiquitin Ligase as a Novel Susceptibility Gene for Attention Deficit Hyperactivity Disorder
    Article Snippet: Briefly, PBMCs were isolated using the Ficoll density gradient method, and total RNA was extracted using Qiazol Lysis reagent and the RNeasy Midi kit [Qiagen, Hilden, Germany]. .. RNA was reverse transcribed using the Ambion WT Expression Kit [Life technologies, Massachusetts, USA].

    Article Title: Silencing of HJURP induces dysregulation of cell cycle and ROS metabolism in bladder cancer cells via PPARγ-SIRT1 feedback loop
    Article Snippet: Paragraph title: Microarray analysis of mRNA isolated from human bladder tissues ... Briefly, according to the standard Affymetrix protocol, 250 ng total RNA of each sample was prepared to biotinylated cDNA by Ambion® WT Expression Kit.

    Article Title: The Immunome in Two Inherited Forms of Pulmonary Fibrosis
    Article Snippet: Paragraph title: RNA Isolation and Microarray Hybridization ... 300 ng of total RNA were amplified using Ambion WT expression kit (Life Sciences) according to the manufacturer’s instructions.

    Article Title: Insights into TREM2 biology by network analysis of human brain gene expression data
    Article Snippet: Total RNA was isolated from human post-mortem brain tissues using the miRNeasy 96 well kit (Qiagen, Manchester, UK). .. The quality of total RNA was evaluated by the 2100 Bioanalyzer (Agilent Technologies, Wokingham, UK) and RNA 6000 Nano Kit (Agilent Technologies, Wokingham, UK) before processing with the Ambion WT Expression Kit and Affymetrix GeneChip Whole Transcript Sense Target Labeling Assay, and hybridization to the Affymetrix Exon 1.0 ST Arrays (Affymetrix UK Ltd, High Wycombe, UK) following the manufacturers' protocols.

    Article Title: miR-130b-3p Modulates Epithelial-Mesenchymal Crosstalk in Lung Fibrosis by Targeting IGF-1
    Article Snippet: All the patients were treated in Beijing Chao-Yang Hospital, Capital Medical University. .. Total RNA was isolated with Trizol, Biotinylated cDNA was prepared according to the standard Affymetrix protocol 3 from 250 ng total RNA by using Ambion® WT Expression Kit. .. Following labeling, 5.5 μg of cDNA were hybridized for 16 hr at 45°C on GeneChip Human Transcriptome Array (Affymetrix, Santa Clara, CA) in Hybridization Oven 645.

    Article Title: Differentiation of human and murine induced pluripotent stem cells to microglia-like cells
    Article Snippet: RNA from human dendritic and bone marrow macrophages (AllCells) was also used. .. Isolated total RNA was amplified with the WT Expression Kit (Ambion), and labeled with the GeneChip WT Terminal Labeling and Controls Kit (Affymetrix). .. Labeled cRNA were hybridized to the Affymetrix GeneChip Human Gene 2.0 ST Array (Affymetrix, Inc) in blinded interleaved fashion.

    Article Title: Inhibition of JAK/STAT signaling stimulates adult satellite cell function
    Article Snippet: Total RNA was extracted from each replicate using the Picopure RNA isolation kit (Applied Biosystems) and concentrated using the RNA Clean and Concentrator-5 kit (Zymo Research) according to the manufacturer’s instructions. qPCR analysis was conducted as described earlier3 with the following primer sequences 5’ to 3’: JunD ex 1 F ATCTTGGGCTGCTCAAACTC, JunD ex1 R AACTGCTCAGGTTGGCGTAG, Bcl2 ex1 F GAGCGTCAACAGGGAGATGT, Bcl2 ex2 R CTCACTTGTGGCCCAGGTAT, Bcl6 ex4 F CCTGAGGGAAGGCAATATCA, Bcl6 ex5 R CGGCTGTTCAGGAACTCTTC, Cebpd ex1 F CGCAGACAGTGGTGAGCTT, Cebpd ex1 R CTTCTGCTGCATCTCCTGGT, Fos ex1 F ATGGGCTCTCCTGTCAACAC, Fos ex2 R GACACGGTCTTCACCATTCC, Myc ex2 F TCCTGTACCTCGTCCGATTC, Myc ex3 R GGTTTGCCTCTTCTCCACAG, Egfr ex1 F ACACTGCTGGTGTTGCTGAC, Egfr ex2 R CCCAAGGACCACTTCACAGT, Ar ex4 F CGGACATGACAACAACCAAC, Ar ex5 R ATCTGGTCATCCACATGCAA, gp130 ex2 F GGAGCAGGTCACTGTCATCA, gp130 ex3 R CTTCCCCTCATTCACAATGC, Pim1 ex4 F CGACATCAAGGACGAGAACA, Pim1 ex5 R TCCGCAGACCATGTCATAGA, Socs3 ex2 F GCAAGCTGCAGGAGAGCGGATT, Socs3 ex2 R AAGAAGTGGCGCTGGTCCGA. .. Microarray target preparation was achieved using the WT Expression kit (Ambion) and the Genechip terminal labelling kit (Affymetrix).

    Labeling:

    Article Title: Rare coding variants in Phospholipase D3 (PLD3) confer risk for Alzheimer's disease
    Article Snippet: Total RNA was isolated from human post-mortem brain tissues using the miRNeasy 96 well kit (Qiagen, UK). .. The quality of total RNA was evaluated by the 2100 Bioanalyzer (Agilent, UK) and RNA 6000 Nano Kit (Agilent, UK) before processing with the Ambion® WT Expression Kit and Affymetrix GeneChip Whole Transcript Sense Target Labeling Assay and hybridization to the Affymetrix Exon 1.0 ST. All arrays were pre-processed using Robust Multi-array Average using Partek Genomics Suite v6.6 (Partek Incorporated, USA). .. The resulting expression data was corrected for individual effects (within which are nested postmortem interval, brain pH, sex, age at death and cause of death) and experimental batch effects (date of hybridization).

    Article Title: mRNA 3′ uridylation and poly(A) tail length sculpt the mammalian maternal transcriptome
    Article Snippet: The fragmentation and labeling was done using the Encore Biotin Module (NuGen). .. For all other cells and tissues, biotinylated cDNA was synthesized from total RNA using the Ambion WT Expression kit.

    Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
    Article Snippet: Data were normalized and expression values were modeled using DNA-Chip analyzer (dChip) software ( www.dChip.org ) . .. Mouse Gene 1.0 ST Arrays, RNA was amplified with the WT Expression Kit (Ambion) and labeled, fragmented, and hybridized with the WT Terminal Labeling and Hybridization Kit (Affymetrix). .. Data was processed using RMA quantile normalization and expression values were modeled using ArrayStar software (DNASTAR).

    Article Title: Repeated Exposure to Lutzomyia intermedia Sand Fly Saliva Induces Local Expression of Interferon-Inducible Genes Both at the Site of Injection in Mice and in Human Blood
    Article Snippet: Ears were harvested 2 weeks after challenge, homogenized using a tissue lyser (Qiagen, Hilden, Germany) and mRNA was extracted by the RNeasy Plus Mini kit (Qiagen). .. For microarray analysis RNA was harvested from ears 2 weeks post inoculation and for each sample condition, three independent sets of 200 ng of total RNA were isolated and used as a template for probe generation using an Ambion WT expression kit (Applied Biosystems, Foster City, CA) and the cDNA was fragmented and labeled with WT DNA terminal labeling kit (Affymetrix, Santa Clara, CA). .. Biotinylated sense strand fragments were hybridized to Affymetrix Mouse Gene 1.0 ST GeneChips using the Hybridization Control and Hybridization Wash and Stain kits at 45°C for 18 h. The stained array was scanned using an Affymetrix GeneChip Scanner 3000 7G to generate the CEL files.

    Article Title: Efficient DNA binding of NF-κB requires the chaperone-like function of NPM1
    Article Snippet: The sense-strand cDNA was prepared using Ambion WT Expression Kit from 200 ng total RNA. .. The cDNA was then fragmented and labeled using the Affymetrix GeneChip WT Terminal Labeling Kit.

    Article Title: Germline Gain-of-Function Mutations in AFF4 Cause a Developmental Syndrome Functionally Linking the Super Elongation Complex and Cohesin
    Article Snippet: Purified sense-strand cDNA was made from extracted RNA using Ambion WT Expression Kit (Ambion). .. Purified sense-strand cDNA was made from extracted RNA using Ambion WT Expression Kit (Ambion).

    Article Title: Expression level of CXCL7 in peripheral blood cells is a potential biomarker for the diagnosis of renal cell carcinoma
    Article Snippet: Total RNA was extracted from 204 blood samples according to the manufacturer's protocols. .. Total RNA (100 ng) was subjected to cDNA synthesis using the Ambion WT expression kit (Life Technologies, Carlsbad, CA, USA). cDNA was biotinylated and then fragmented with the GeneChip WT terminal labeling kit (Affymetrix, Santa Clara, CA, USA). .. After making the hybridization cocktail, biotinylated cDNAs were hybridized with GeneChip Human Transcriptome Array 2.0 (Affymetrix) for 16 h using 24 samples as the discovery cohort.

    Article Title: Insights into TREM2 biology by network analysis of human brain gene expression data
    Article Snippet: Total RNA was isolated from human post-mortem brain tissues using the miRNeasy 96 well kit (Qiagen, Manchester, UK). .. The quality of total RNA was evaluated by the 2100 Bioanalyzer (Agilent Technologies, Wokingham, UK) and RNA 6000 Nano Kit (Agilent Technologies, Wokingham, UK) before processing with the Ambion WT Expression Kit and Affymetrix GeneChip Whole Transcript Sense Target Labeling Assay, and hybridization to the Affymetrix Exon 1.0 ST Arrays (Affymetrix UK Ltd, High Wycombe, UK) following the manufacturers' protocols. .. Hybridized arrays were scanned on an Affymetrix GeneChip Scanner 3000 7G (Affymetrix UK Ltd, High Wycombe, UK) and visually inspected for hybridization artefacts.

    Article Title: Differentiation of human and murine induced pluripotent stem cells to microglia-like cells
    Article Snippet: RNA from human dendritic and bone marrow macrophages (AllCells) was also used. .. Isolated total RNA was amplified with the WT Expression Kit (Ambion), and labeled with the GeneChip WT Terminal Labeling and Controls Kit (Affymetrix). .. Labeled cRNA were hybridized to the Affymetrix GeneChip Human Gene 2.0 ST Array (Affymetrix, Inc) in blinded interleaved fashion.

    Purification:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: 1 ng of purified total RNA, as determined by Agilent Bioanalyzer (Agilent Technologies), was processed with the mRNA direct micro kit (Life Technologies) to select for poly A RNA. .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Article Title: Germline Gain-of-Function Mutations in AFF4 Cause a Developmental Syndrome Functionally Linking the Super Elongation Complex and Cohesin
    Article Snippet: Labelled aRNA was hybridized to Affymetrix GeneChip Human Genome U133 Plus 2.0 Arrays (Affymetrix). .. Purified sense-strand cDNA was made from extracted RNA using Ambion WT Expression Kit (Ambion). .. 100ng of RNA was used from each sample.

    Article Title: Independent Mechanisms Lead to Genomic Instability in Hodgkin Lymphoma: Microsatellite or Chromosomal Instability
    Article Snippet: Total RNA was extracted from frozen HL cells and controls (REMB lymphoblastoide cell line) using the AllPrep DNA/RNA/protein Mini kit (Qiagen, Hilden, Germany), quality-controlled using a 2100 BioAnalyzer (Agilent, Santa Clara, CA, USA), and quantified using a Nanodrop 2000c spectrophotometer (Thermo Scientific, Wilmington, DE, USA). .. The WT Expression Kit (Ambion Inc, Austin, TX, USA) was used to prepare cDNA from 10 μg purified cRNA, originally synthesised and purified from 0.25 μg of total RNA, following the manufacturer’s instructions. .. Micronucleus (MN) scoring was performed after telomere and centromere staining.

    Article Title: Inhibition of JAK/STAT signaling stimulates adult satellite cell function
    Article Snippet: FACS Purified ZsGreen-expressing cells were obtained from pooled populations of adolescent (n=6), young adult (n=8) and older adult (n=8) muscles. .. Microarray target preparation was achieved using the WT Expression kit (Ambion) and the Genechip terminal labelling kit (Affymetrix).

    Staining:

    Article Title: mRNA 3′ uridylation and poly(A) tail length sculpt the mammalian maternal transcriptome
    Article Snippet: For all other cells and tissues, biotinylated cDNA was synthesized from total RNA using the Ambion WT Expression kit. .. For all other cells and tissues, biotinylated cDNA was synthesized from total RNA using the Ambion WT Expression kit.

    Article Title: Knockdown of SIRT1 Suppresses Bladder Cancer Cell Proliferation and Migration and Induces Cell Cycle Arrest and Antioxidant Response through FOXO3a-Mediated Pathways
    Article Snippet: Briefly, biotinylated cDNA were prepared from 250 ng total RNA using the Ambion® WT Expression Kit. .. Then, 5.5 μ g cDNA were hybridized on GeneChip Human Transcriptome Array 2.0 (16 h at 45°C) in Hybridization Oven 645.

    Article Title: Efficient DNA binding of NF-κB requires the chaperone-like function of NPM1
    Article Snippet: The sense-strand cDNA was prepared using Ambion WT Expression Kit from 200 ng total RNA. .. The cDNA was then fragmented and labeled using the Affymetrix GeneChip WT Terminal Labeling Kit.

    Article Title: Germline Gain-of-Function Mutations in AFF4 Cause a Developmental Syndrome Functionally Linking the Super Elongation Complex and Cohesin
    Article Snippet: Purified sense-strand cDNA was made from extracted RNA using Ambion WT Expression Kit (Ambion). .. Labeled cDNA was hybridized to Affymetrix GeneChip® Human Gene 2.0 ST Arrays (Affymetrix) for transcriptome analysis.

    Article Title: Expression level of CXCL7 in peripheral blood cells is a potential biomarker for the diagnosis of renal cell carcinoma
    Article Snippet: Total RNA (100 ng) was subjected to cDNA synthesis using the Ambion WT expression kit (Life Technologies, Carlsbad, CA, USA). cDNA was biotinylated and then fragmented with the GeneChip WT terminal labeling kit (Affymetrix, Santa Clara, CA, USA). .. After making the hybridization cocktail, biotinylated cDNAs were hybridized with GeneChip Human Transcriptome Array 2.0 (Affymetrix) for 16 h using 24 samples as the discovery cohort.

    Article Title: miR-130b-3p Modulates Epithelial-Mesenchymal Crosstalk in Lung Fibrosis by Targeting IGF-1
    Article Snippet: Total RNA was isolated with Trizol, Biotinylated cDNA was prepared according to the standard Affymetrix protocol 3 from 250 ng total RNA by using Ambion® WT Expression Kit. .. Following labeling, 5.5 μg of cDNA were hybridized for 16 hr at 45°C on GeneChip Human Transcriptome Array (Affymetrix, Santa Clara, CA) in Hybridization Oven 645.

    Mouse Assay:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n=2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Article Title: Sensing prokaryotic mRNA signifies microbial viability and promotes immunity
    Article Snippet: BMM derived from wild type (wt ) or Trif−/− mice were stimulated with viable E. coli for 0, 1, 3 or 6 hours and total RNA was extracted using the RNeasy kit (QIAGEN). .. One hundred nanograms of RNA were used for whole transcript cDNA synthesis with the Ambion WT expression kit (Applied Biosystems, Nieuwekerk a/d IJssel, The Netherlands).

    Article Title: Adipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota
    Article Snippet: Equal amounts of RNA from five mice per group were pooled within each group. .. The WT expression kit (Ambion) was used for complementary RNA preparation from the total RNA.

    Chromatin Immunoprecipitation:

    Article Title: Repeated Exposure to Lutzomyia intermedia Sand Fly Saliva Induces Local Expression of Interferon-Inducible Genes Both at the Site of Injection in Mice and in Human Blood
    Article Snippet: For microarray analysis RNA was harvested from ears 2 weeks post inoculation and for each sample condition, three independent sets of 200 ng of total RNA were isolated and used as a template for probe generation using an Ambion WT expression kit (Applied Biosystems, Foster City, CA) and the cDNA was fragmented and labeled with WT DNA terminal labeling kit (Affymetrix, Santa Clara, CA). .. Biotinylated sense strand fragments were hybridized to Affymetrix Mouse Gene 1.0 ST GeneChips using the Hybridization Control and Hybridization Wash and Stain kits at 45°C for 18 h. The stained array was scanned using an Affymetrix GeneChip Scanner 3000 7G to generate the CEL files.

    Article Title: Differentiation of human and murine induced pluripotent stem cells to microglia-like cells
    Article Snippet: Isolated total RNA was amplified with the WT Expression Kit (Ambion), and labeled with the GeneChip WT Terminal Labeling and Controls Kit (Affymetrix). .. Labeled cRNA were hybridized to the Affymetrix GeneChip Human Gene 2.0 ST Array (Affymetrix, Inc) in blinded interleaved fashion.

    Article Title: Inhibition of JAK/STAT signaling stimulates adult satellite cell function
    Article Snippet: Sample RNA quality was assessed on the Agilent Bioanalyzer 2100 using the RNA 6000 nano chip (Agilent Technologies, Santa Clara). .. Microarray target preparation was achieved using the WT Expression kit (Ambion) and the Genechip terminal labelling kit (Affymetrix).

    Software:

    Article Title: Knockdown of SIRT1 Suppresses Bladder Cancer Cell Proliferation and Migration and Induces Cell Cycle Arrest and Antioxidant Response through FOXO3a-Mediated Pathways
    Article Snippet: Briefly, biotinylated cDNA were prepared from 250 ng total RNA using the Ambion® WT Expression Kit. .. Briefly, biotinylated cDNA were prepared from 250 ng total RNA using the Ambion® WT Expression Kit.

    Article Title: Compensatory dendritic cell development mediated by BATF-IRF interactions
    Article Snippet: Data were normalized and expression values were modeled using DNA-Chip analyzer (dChip) software ( www.dChip.org ) . .. Mouse Gene 1.0 ST Arrays, RNA was amplified with the WT Expression Kit (Ambion) and labeled, fragmented, and hybridized with the WT Terminal Labeling and Hybridization Kit (Affymetrix).

    Article Title: Expression level of CXCL7 in peripheral blood cells is a potential biomarker for the diagnosis of renal cell carcinoma
    Article Snippet: Total RNA (100 ng) was subjected to cDNA synthesis using the Ambion WT expression kit (Life Technologies, Carlsbad, CA, USA). cDNA was biotinylated and then fragmented with the GeneChip WT terminal labeling kit (Affymetrix, Santa Clara, CA, USA). .. Total RNA (100 ng) was subjected to cDNA synthesis using the Ambion WT expression kit (Life Technologies, Carlsbad, CA, USA). cDNA was biotinylated and then fragmented with the GeneChip WT terminal labeling kit (Affymetrix, Santa Clara, CA, USA).

    Article Title: Differentiation of human and murine induced pluripotent stem cells to microglia-like cells
    Article Snippet: Isolated total RNA was amplified with the WT Expression Kit (Ambion), and labeled with the GeneChip WT Terminal Labeling and Controls Kit (Affymetrix). .. Labeled cRNA were hybridized to the Affymetrix GeneChip Human Gene 2.0 ST Array (Affymetrix, Inc) in blinded interleaved fashion.

    Article Title: Adipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota
    Article Snippet: The WT expression kit (Ambion) was used for complementary RNA preparation from the total RNA. .. The hybridization, wash and scan were done according to the Affymetrix kits and procedures specific to the mouse gene ST chips.

    RNA Extraction:

    Article Title: Expression level of CXCL7 in peripheral blood cells is a potential biomarker for the diagnosis of renal cell carcinoma
    Article Snippet: Paragraph title: RNA extraction from blood and microarray analysis ... Total RNA (100 ng) was subjected to cDNA synthesis using the Ambion WT expression kit (Life Technologies, Carlsbad, CA, USA). cDNA was biotinylated and then fragmented with the GeneChip WT terminal labeling kit (Affymetrix, Santa Clara, CA, USA).

    Article Title: Independent Mechanisms Lead to Genomic Instability in Hodgkin Lymphoma: Microsatellite or Chromosomal Instability
    Article Snippet: Paragraph title: 7.12. RNA Extraction and Transcriptome Analysis ... The WT Expression Kit (Ambion Inc, Austin, TX, USA) was used to prepare cDNA from 10 μg purified cRNA, originally synthesised and purified from 0.25 μg of total RNA, following the manufacturer’s instructions.

    Sample Prep:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA. .. The cRNA was purified following the manufacturer’s instructions and the concentration was determined with a NanoDrop instrument (ThermoFisher).

    In Vitro:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: 1 ng of purified total RNA, as determined by Agilent Bioanalyzer (Agilent Technologies), was processed with the mRNA direct micro kit (Life Technologies) to select for poly A RNA. .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA. .. The cRNA was purified following the manufacturer’s instructions and the concentration was determined with a NanoDrop instrument (ThermoFisher).

    Article Title: Germline Gain-of-Function Mutations in AFF4 Cause a Developmental Syndrome Functionally Linking the Super Elongation Complex and Cohesin
    Article Snippet: Purified sense-strand cDNA was made from extracted RNA using Ambion WT Expression Kit (Ambion). .. Purified sense-strand cDNA was made from extracted RNA using Ambion WT Expression Kit (Ambion).

    Incubation:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA. .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Article Title: Efficient DNA binding of NF-κB requires the chaperone-like function of NPM1
    Article Snippet: HeLa cells were incubated with NPM1 or control siRNA for 72 h and treated without or with 20 ng/ml TNF-α for 2 h. Total RNA was then isolated using RNeasy Kit (Qiagen) according to the manufacturer's instructions. .. The sense-strand cDNA was prepared using Ambion WT Expression Kit from 200 ng total RNA.

    Spectrophotometry:

    Article Title: Independent Mechanisms Lead to Genomic Instability in Hodgkin Lymphoma: Microsatellite or Chromosomal Instability
    Article Snippet: Total RNA was extracted from frozen HL cells and controls (REMB lymphoblastoide cell line) using the AllPrep DNA/RNA/protein Mini kit (Qiagen, Hilden, Germany), quality-controlled using a 2100 BioAnalyzer (Agilent, Santa Clara, CA, USA), and quantified using a Nanodrop 2000c spectrophotometer (Thermo Scientific, Wilmington, DE, USA). .. The WT Expression Kit (Ambion Inc, Austin, TX, USA) was used to prepare cDNA from 10 μg purified cRNA, originally synthesised and purified from 0.25 μg of total RNA, following the manufacturer’s instructions.

    Lysis:

    Article Title: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem cell self-renewal
    Article Snippet: Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n=2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. .. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA.

    Article Title: Gene-wide Association Study Reveals RNF122 Ubiquitin Ligase as a Novel Susceptibility Gene for Attention Deficit Hyperactivity Disorder
    Article Snippet: Briefly, PBMCs were isolated using the Ficoll density gradient method, and total RNA was extracted using Qiazol Lysis reagent and the RNeasy Midi kit [Qiagen, Hilden, Germany]. .. RNA was reverse transcribed using the Ambion WT Expression Kit [Life technologies, Massachusetts, USA].

    FACS:

    Article Title: Inhibition of JAK/STAT signaling stimulates adult satellite cell function
    Article Snippet: FACS Purified ZsGreen-expressing cells were obtained from pooled populations of adolescent (n=6), young adult (n=8) and older adult (n=8) muscles. .. Microarray target preparation was achieved using the WT Expression kit (Ambion) and the Genechip terminal labelling kit (Affymetrix).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher wt expression kit
    Wt Expression Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 589 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wt expression kit/product/Thermo Fisher
    Average 99 stars, based on 589 article reviews
    Price from $9.99 to $1999.99
    wt expression kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results