wizard plus sv minipreps dna purification system  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Promega wizard plus sv minipreps dna purification system
    Wizard Plus Sv Minipreps Dna Purification System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 305 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard plus sv minipreps dna purification system/product/Promega
    Average 99 stars, based on 305 article reviews
    Price from $9.99 to $1999.99
    wizard plus sv minipreps dna purification system - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿ †
    Article Snippet: .. Cosmid DNA was isolated from positive clones by using the Wizard Plus SV Minipreps DNA purification system (Promega) and end sequenced using primers designed for the cosmid regions flanking the insert site (SuperCos_forw [5′ GGC CGC AAT TAA CCC TCA C 3′] and SuperCos_rev [5′ GGC CGC ATA ATA CGA CTC AC 3′]). .. A BigDye Terminator version 1.1 cycle sequencing kit (Applied Biosystems) was applied for the end sequencing.

    Article Title: Construction of recombinant eukaryotic expression plasmid containing murine CD40 ligand gene and its expression in H22 cells
    Article Snippet: The cloned cDNA fragment was ligated into the pUCm-T vector to form pUCm-T-CD40L. .. The recombinant expression vector pcDNA3.1+ -mCD40L was amplified in E.coli JM109 and then extracted by Wizard® Plus SV Minipreps DNA Purification System (Promega, USA) according to the manufacturer’s instructions.

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Amplification:

    Article Title: ATP-Sensitive K+ Channels Regulate the Concentrative Adenosine Transporter CNT2 following Activation by A1 Adenosine Receptors
    Article Snippet: The expression of KATP channels in FAO and parenchymal liver cells was assessed by using specific oligonucleotides suitable for the amplification of Kir6.1, Kir6.2, SUR1, and SUR2. cDNA from the pancreas was used in all assays as a positive control for reverse transcription (RT)-PCR amplification, since this organ is known to express these four genes. .. Briefly, mRNA was isolated by using a Wizard Plus SV Minipreps DNA purification system (Promega, Madison, Wis.) and retrotranscribed into cDNA by oligo-dT priming.

    Article Title: Construction of recombinant eukaryotic expression plasmid containing murine CD40 ligand gene and its expression in H22 cells
    Article Snippet: .. The recombinant expression vector pcDNA3.1+ -mCD40L was amplified in E.coli JM109 and then extracted by Wizard® Plus SV Minipreps DNA Purification System (Promega, USA) according to the manufacturer’s instructions. ..

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: We PCR amplified the endogenous yeast gene encoding the P450 reductase ( CPR1 ) from W303 genomic DNA, the A. thaliana ATR1 gene from WAT11 genomic DNA and the Homo sapiens CPR1 gene from pH2E1red (ref. ). .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions.

    Positive Control:

    Article Title: ATP-Sensitive K+ Channels Regulate the Concentrative Adenosine Transporter CNT2 following Activation by A1 Adenosine Receptors
    Article Snippet: The expression of KATP channels in FAO and parenchymal liver cells was assessed by using specific oligonucleotides suitable for the amplification of Kir6.1, Kir6.2, SUR1, and SUR2. cDNA from the pancreas was used in all assays as a positive control for reverse transcription (RT)-PCR amplification, since this organ is known to express these four genes. .. Briefly, mRNA was isolated by using a Wizard Plus SV Minipreps DNA purification system (Promega, Madison, Wis.) and retrotranscribed into cDNA by oligo-dT priming.

    Synthesized:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: Single‐stranded cDNA (cDNAss) was synthesized by reverse transcription with the SuperScript II Reverse Transcriptase from 1 μg of total RNA using an ADAPTER‐oligo(dT17), where ADAPTER means a sequence 5′‐AAGCAGTGGTATCAACGCAGAGTAC‐3′ added to the 5′‐end of the oligo(dT17), following the manufacturers’ directions (Invitrogen, Waltham, MA, USA). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: The human CYP2D6 cDNA was provided by F. Peter Guengerich (Vanderbilt University) as pCW/DB6 (ref. ), and the yeast codon-optimized version of this gene was synthesized by DNA 2.0. .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions.

    Quantitative RT-PCR:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: Paragraph title: 3′‐RACE and qRT‐PCR experiments ... Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    SYBR Green Assay:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega). .. The reactions were carried out with the Rotor‐Gene SYBR Green PCR kit (Qiagen GmbH, Hilden, Germany) in a Rotor‐Gene 3000 real‐time cycler (Corbett Research, Sydney, Australia).

    Expressing:

    Article Title: ATP-Sensitive K+ Channels Regulate the Concentrative Adenosine Transporter CNT2 following Activation by A1 Adenosine Receptors
    Article Snippet: PC12 cells are known to lack Kir6.1 expression and were used as a negative control for this gene ( ). .. Briefly, mRNA was isolated by using a Wizard Plus SV Minipreps DNA purification system (Promega, Madison, Wis.) and retrotranscribed into cDNA by oligo-dT priming.

    Article Title: Construction of recombinant eukaryotic expression plasmid containing murine CD40 ligand gene and its expression in H22 cells
    Article Snippet: .. The recombinant expression vector pcDNA3.1+ -mCD40L was amplified in E.coli JM109 and then extracted by Wizard® Plus SV Minipreps DNA Purification System (Promega, USA) according to the manufacturer’s instructions. ..

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: Coding sequences for the enzymes of interest, with the exception of human CYP2D6 , were donated as cDNAs from P. Facchini (University of Calgary) in plasmids typically suited for expression in E. coli . .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions.

    Transformation Assay:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: We transformed ligation reactions into an electrocompetent E. coli strain, DH10B (Invitrogen; F- mcr A Δ( mrr-hsd RMS- mcr BC) ϕ80d lac ZΔM15 Δ lac X74 deo R rec A1 end A1 ara D139 Δ ( ara, leu )7697 gal U gal K λ- rps L nup G), using a Gene Pulser Xcell system (BioRAD) according to the manufacturer's instructions. .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions.

    Countercurrent Chromatography:

    Article Title: Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿ †
    Article Snippet: .. Cosmid DNA was isolated from positive clones by using the Wizard Plus SV Minipreps DNA purification system (Promega) and end sequenced using primers designed for the cosmid regions flanking the insert site (SuperCos_forw [5′ GGC CGC AAT TAA CCC TCA C 3′] and SuperCos_rev [5′ GGC CGC ATA ATA CGA CTC AC 3′]). .. A BigDye Terminator version 1.1 cycle sequencing kit (Applied Biosystems) was applied for the end sequencing.

    Ligation:

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: We transformed ligation reactions into an electrocompetent E. coli strain, DH10B (Invitrogen; F- mcr A Δ( mrr-hsd RMS- mcr BC) ϕ80d lac ZΔM15 Δ lac X74 deo R rec A1 end A1 ara D139 Δ ( ara, leu )7697 gal U gal K λ- rps L nup G), using a Gene Pulser Xcell system (BioRAD) according to the manufacturer's instructions. .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions.

    Cell Culture:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega). .. Insert‐bearing plasmids for each 3′‐RACE fragment were DNA sequenced on both strands on an ABI prism multicolor fluorescence‐based DNA analysis system (Applied Biosystems, Foster City, CA, USA), using the Taq Dye‐Deoxy Terminator Cycle Sequencing kit from the same manufacturer.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: ATP-Sensitive K+ Channels Regulate the Concentrative Adenosine Transporter CNT2 following Activation by A1 Adenosine Receptors
    Article Snippet: Paragraph title: RT-PCR analysis. ... Briefly, mRNA was isolated by using a Wizard Plus SV Minipreps DNA purification system (Promega, Madison, Wis.) and retrotranscribed into cDNA by oligo-dT priming.

    Article Title: Construction of recombinant eukaryotic expression plasmid containing murine CD40 ligand gene and its expression in H22 cells
    Article Snippet: A cDNA fragment coding for the full open reading frame of mouse CD40L gene was cloned by reverse transcription polymerase chain reaction (RT-PCR) from Con A stimulated mouse spleen cells using Taq polymerase. .. The recombinant expression vector pcDNA3.1+ -mCD40L was amplified in E.coli JM109 and then extracted by Wizard® Plus SV Minipreps DNA Purification System (Promega, USA) according to the manufacturer’s instructions.

    Generated:

    Article Title: Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿ †
    Article Snippet: Digoxigenin (DIG)-labeled probes were generated using a PCR DIG probe synthesis kit or a High Prime DNA labeling kit (both from Roche Applied Science). .. Cosmid DNA was isolated from positive clones by using the Wizard Plus SV Minipreps DNA purification system (Promega) and end sequenced using primers designed for the cosmid regions flanking the insert site (SuperCos_forw [5′ GGC CGC AAT TAA CCC TCA C 3′] and SuperCos_rev [5′ GGC CGC ATA ATA CGA CTC AC 3′]).

    DNA Labeling:

    Article Title: Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿ †
    Article Snippet: Digoxigenin (DIG)-labeled probes were generated using a PCR DIG probe synthesis kit or a High Prime DNA labeling kit (both from Roche Applied Science). .. Cosmid DNA was isolated from positive clones by using the Wizard Plus SV Minipreps DNA purification system (Promega) and end sequenced using primers designed for the cosmid regions flanking the insert site (SuperCos_forw [5′ GGC CGC AAT TAA CCC TCA C 3′] and SuperCos_rev [5′ GGC CGC ATA ATA CGA CTC AC 3′]).

    Polymerase Chain Reaction:

    Article Title: Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿ †
    Article Snippet: Digoxigenin (DIG)-labeled probes were generated using a PCR DIG probe synthesis kit or a High Prime DNA labeling kit (both from Roche Applied Science). .. Cosmid DNA was isolated from positive clones by using the Wizard Plus SV Minipreps DNA purification system (Promega) and end sequenced using primers designed for the cosmid regions flanking the insert site (SuperCos_forw [5′ GGC CGC AAT TAA CCC TCA C 3′] and SuperCos_rev [5′ GGC CGC ATA ATA CGA CTC AC 3′]).

    Article Title: Construction of recombinant eukaryotic expression plasmid containing murine CD40 ligand gene and its expression in H22 cells
    Article Snippet: PCR conditions included 1 cycle at 94 °C for 5 min for pre-denaturation; 35 amplification cycles each consisting of denaturation at 94 °C for 60 s, annealing at 60 °C for 50 s, and extension at 72 °C for 90 s; followed by a further extension at 72 °C for 10 min. .. The recombinant expression vector pcDNA3.1+ -mCD40L was amplified in E.coli JM109 and then extracted by Wizard® Plus SV Minipreps DNA Purification System (Promega, USA) according to the manufacturer’s instructions.

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: We PCR amplified the endogenous yeast gene encoding the P450 reductase ( CPR1 ) from W303 genomic DNA, the A. thaliana ATR1 gene from WAT11 genomic DNA and the Homo sapiens CPR1 gene from pH2E1red (ref. ). .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions.

    Recombinant:

    Article Title: ATP-Sensitive K+ Channels Regulate the Concentrative Adenosine Transporter CNT2 following Activation by A1 Adenosine Receptors
    Article Snippet: Briefly, mRNA was isolated by using a Wizard Plus SV Minipreps DNA purification system (Promega, Madison, Wis.) and retrotranscribed into cDNA by oligo-dT priming. .. Oligonucleotides used for recombinant glyceraldehyde 3-phosphate dehydrogenase (rGAPDH) amplification (control) were as follows: the forward primer was CTACCCACGGCAAGTTCAAT (bases from 176 to 195) and the reverse primer was CCACAGTCTTCTGAGTGGCA (bases from 589 to 570).

    Article Title: Construction of recombinant eukaryotic expression plasmid containing murine CD40 ligand gene and its expression in H22 cells
    Article Snippet: .. The recombinant expression vector pcDNA3.1+ -mCD40L was amplified in E.coli JM109 and then extracted by Wizard® Plus SV Minipreps DNA Purification System (Promega, USA) according to the manufacturer’s instructions. ..

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega). .. Insert‐bearing plasmids for each 3′‐RACE fragment were DNA sequenced on both strands on an ABI prism multicolor fluorescence‐based DNA analysis system (Applied Biosystems, Foster City, CA, USA), using the Taq Dye‐Deoxy Terminator Cycle Sequencing kit from the same manufacturer.

    Cosmid DNA:

    Article Title: Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿ †
    Article Snippet: .. Cosmid DNA was isolated from positive clones by using the Wizard Plus SV Minipreps DNA purification system (Promega) and end sequenced using primers designed for the cosmid regions flanking the insert site (SuperCos_forw [5′ GGC CGC AAT TAA CCC TCA C 3′] and SuperCos_rev [5′ GGC CGC ATA ATA CGA CTC AC 3′]). .. A BigDye Terminator version 1.1 cycle sequencing kit (Applied Biosystems) was applied for the end sequencing.

    DNA Extraction:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega). .. Insert‐bearing plasmids for each 3′‐RACE fragment were DNA sequenced on both strands on an ABI prism multicolor fluorescence‐based DNA analysis system (Applied Biosystems, Foster City, CA, USA), using the Taq Dye‐Deoxy Terminator Cycle Sequencing kit from the same manufacturer.

    Fluorescence:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega). .. Insert‐bearing plasmids for each 3′‐RACE fragment were DNA sequenced on both strands on an ABI prism multicolor fluorescence‐based DNA analysis system (Applied Biosystems, Foster City, CA, USA), using the Taq Dye‐Deoxy Terminator Cycle Sequencing kit from the same manufacturer.

    Isolation:

    Article Title: ATP-Sensitive K+ Channels Regulate the Concentrative Adenosine Transporter CNT2 following Activation by A1 Adenosine Receptors
    Article Snippet: .. Briefly, mRNA was isolated by using a Wizard Plus SV Minipreps DNA purification system (Promega, Madison, Wis.) and retrotranscribed into cDNA by oligo-dT priming. .. Oligonucleotides used for KATP channel isoform amplification were as follows: for Kir6.1, the forward primer was GAGTGAACTGTCGCACCAGA (bases from 1292 to 1311) and the reverse primer was CGATCACCAGAACTCAGCAAAC (bases from 1539 to 1518); for Kir6.2, the forward primer was TCCAACAGCCCGCTCTAC (bases from 787 to 804) and the reverse primer was GATGGGGACAAAACGCTG (bases from 954 to 937); for SUR1, the forward primer was CCCAGAGAAGAAATGCTCAGACAGC (bases from 4579 to 4603) and the reverse primer was GAGAAGCTTTTCCGGCTTGTC (bases from 4957 to 4937); and for SUR2, the forward primer was ACCTGCTCCAGCACAAGAAT (bases from 4853 to 4872) and the reverse primer was TCTCTTCATCACAATGACCAGG (bases from 4997 to 4976).

    Article Title: Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿ †
    Article Snippet: .. Cosmid DNA was isolated from positive clones by using the Wizard Plus SV Minipreps DNA purification system (Promega) and end sequenced using primers designed for the cosmid regions flanking the insert site (SuperCos_forw [5′ GGC CGC AAT TAA CCC TCA C 3′] and SuperCos_rev [5′ GGC CGC ATA ATA CGA CTC AC 3′]). .. A BigDye Terminator version 1.1 cycle sequencing kit (Applied Biosystems) was applied for the end sequencing.

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions. .. Subcloning was confirmed by restriction analysis and sequence verification (Laragen, Inc.).

    Subcloning:

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: We constructed shuttle vectors for subcloning of 1 or 2 cDNA sequences in this fashion ( online). .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions.

    Negative Control:

    Article Title: ATP-Sensitive K+ Channels Regulate the Concentrative Adenosine Transporter CNT2 following Activation by A1 Adenosine Receptors
    Article Snippet: PC12 cells are known to lack Kir6.1 expression and were used as a negative control for this gene ( ). .. Briefly, mRNA was isolated by using a Wizard Plus SV Minipreps DNA purification system (Promega, Madison, Wis.) and retrotranscribed into cDNA by oligo-dT priming.

    Purification:

    Article Title: Lost in plasmids: next generation sequencing and the complex genome of the tick-borne pathogen Borrelia burgdorferi
    Article Snippet: For an initial assessment of suitability of plasmid purification kits for separation of the Borrelia main chromosome from plasmids, three different plasmid purification kits were run in duplicate, two from Qiagen and one from Promega (QIAGEN® Plasmid Mini kit (QIAGEN®, cat.nr. .. : 27104); Wizard® Plus SV Minipreps DNA Purification System (Promega, cat.nr.

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Acetylene Reduction Assay:

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: We transformed ligation reactions into an electrocompetent E. coli strain, DH10B (Invitrogen; F- mcr A Δ( mrr-hsd RMS- mcr BC) ϕ80d lac ZΔM15 Δ lac X74 deo R rec A1 end A1 ara D139 Δ ( ara, leu )7697 gal U gal K λ- rps L nup G), using a Gene Pulser Xcell system (BioRAD) according to the manufacturer's instructions. .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions.

    Sequencing:

    Article Title: Lost in plasmids: next generation sequencing and the complex genome of the tick-borne pathogen Borrelia burgdorferi
    Article Snippet: To investigate whether sequence assembly would improve for plasmids if the main linear chromosome was removed prior to library construction, we used plasmid purification kits. .. : 27104); Wizard® Plus SV Minipreps DNA Purification System (Promega, cat.nr.

    Article Title: Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿ †
    Article Snippet: Paragraph title: Construction of the genomic library and sequencing of the ML-449 biosynthetic gene cluster. ... Cosmid DNA was isolated from positive clones by using the Wizard Plus SV Minipreps DNA purification system (Promega) and end sequenced using primers designed for the cosmid regions flanking the insert site (SuperCos_forw [5′ GGC CGC AAT TAA CCC TCA C 3′] and SuperCos_rev [5′ GGC CGC ATA ATA CGA CTC AC 3′]).

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: A primer oligonucleotide complementary to the ADAPTER–primer sequence was used for PCR in combination with the 26‐bp oligonucleotide corresponding to each of the 10 SuperSAGE tag sequences. .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions. .. Subcloning was confirmed by restriction analysis and sequence verification (Laragen, Inc.).

    Construct:

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: We constructed shuttle vectors for subcloning of 1 or 2 cDNA sequences in this fashion ( online). .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Lost in plasmids: next generation sequencing and the complex genome of the tick-borne pathogen Borrelia burgdorferi
    Article Snippet: .. : 27104); Wizard® Plus SV Minipreps DNA Purification System (Promega, cat.nr. ..

    Rapid Amplification of cDNA Ends:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: First, longer cDNA fragments were recovered by 3′‐RACE (Rapid Amplification of cDNA Ends) method and sequences compared against those in H. virescens contigs database (Perera et al ., ) using the BLASTN algorithm. .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Plasmid Preparation:

    Article Title: Lost in plasmids: next generation sequencing and the complex genome of the tick-borne pathogen Borrelia burgdorferi
    Article Snippet: Paragraph title: DNA purification, plasmid enrichment and library construction ... : 27104); Wizard® Plus SV Minipreps DNA Purification System (Promega, cat.nr.

    Article Title: Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿ †
    Article Snippet: Cosmid DNA was isolated from positive clones by using the Wizard Plus SV Minipreps DNA purification system (Promega) and end sequenced using primers designed for the cosmid regions flanking the insert site (SuperCos_forw [5′ GGC CGC AAT TAA CCC TCA C 3′] and SuperCos_rev [5′ GGC CGC ATA ATA CGA CTC AC 3′]). .. For complete sequencing of the cosmids, cosmid DNA was isolated using a Genopure Plasmid maxikit (Roche).

    Article Title: Construction of recombinant eukaryotic expression plasmid containing murine CD40 ligand gene and its expression in H22 cells
    Article Snippet: .. The recombinant expression vector pcDNA3.1+ -mCD40L was amplified in E.coli JM109 and then extracted by Wizard® Plus SV Minipreps DNA Purification System (Promega, USA) according to the manufacturer’s instructions. ..

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega). .. Insert‐bearing plasmids for each 3′‐RACE fragment were DNA sequenced on both strands on an ABI prism multicolor fluorescence‐based DNA analysis system (Applied Biosystems, Foster City, CA, USA), using the Taq Dye‐Deoxy Terminator Cycle Sequencing kit from the same manufacturer.

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions. .. Subcloning was confirmed by restriction analysis and sequence verification (Laragen, Inc.).

    RNA Extraction:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: For 3′‐RACE, total RNA extraction and preparation of RNA pools were carried out as described above on new dissected guts. .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    DNA Purification:

    Article Title: Lost in plasmids: next generation sequencing and the complex genome of the tick-borne pathogen Borrelia burgdorferi
    Article Snippet: .. : 27104); Wizard® Plus SV Minipreps DNA Purification System (Promega, cat.nr. ..

    Article Title: ATP-Sensitive K+ Channels Regulate the Concentrative Adenosine Transporter CNT2 following Activation by A1 Adenosine Receptors
    Article Snippet: .. Briefly, mRNA was isolated by using a Wizard Plus SV Minipreps DNA purification system (Promega, Madison, Wis.) and retrotranscribed into cDNA by oligo-dT priming. .. Oligonucleotides used for KATP channel isoform amplification were as follows: for Kir6.1, the forward primer was GAGTGAACTGTCGCACCAGA (bases from 1292 to 1311) and the reverse primer was CGATCACCAGAACTCAGCAAAC (bases from 1539 to 1518); for Kir6.2, the forward primer was TCCAACAGCCCGCTCTAC (bases from 787 to 804) and the reverse primer was GATGGGGACAAAACGCTG (bases from 954 to 937); for SUR1, the forward primer was CCCAGAGAAGAAATGCTCAGACAGC (bases from 4579 to 4603) and the reverse primer was GAGAAGCTTTTCCGGCTTGTC (bases from 4957 to 4937); and for SUR2, the forward primer was ACCTGCTCCAGCACAAGAAT (bases from 4853 to 4872) and the reverse primer was TCTCTTCATCACAATGACCAGG (bases from 4997 to 4976).

    Article Title: Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿Insights into the Evolution of Macrolactam Biosynthesis through Cloning and Comparative Analysis of the Biosynthetic Gene Cluster for a Novel Macrocyclic Lactam, ML-449 ▿ †
    Article Snippet: .. Cosmid DNA was isolated from positive clones by using the Wizard Plus SV Minipreps DNA purification system (Promega) and end sequenced using primers designed for the cosmid regions flanking the insert site (SuperCos_forw [5′ GGC CGC AAT TAA CCC TCA C 3′] and SuperCos_rev [5′ GGC CGC ATA ATA CGA CTC AC 3′]). .. A BigDye Terminator version 1.1 cycle sequencing kit (Applied Biosystems) was applied for the end sequencing.

    Article Title: Construction of recombinant eukaryotic expression plasmid containing murine CD40 ligand gene and its expression in H22 cells
    Article Snippet: .. The recombinant expression vector pcDNA3.1+ -mCD40L was amplified in E.coli JM109 and then extracted by Wizard® Plus SV Minipreps DNA Purification System (Promega, USA) according to the manufacturer’s instructions. ..

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega). .. Insert‐bearing plasmids for each 3′‐RACE fragment were DNA sequenced on both strands on an ABI prism multicolor fluorescence‐based DNA analysis system (Applied Biosystems, Foster City, CA, USA), using the Taq Dye‐Deoxy Terminator Cycle Sequencing kit from the same manufacturer.

    Article Title: Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae
    Article Snippet: .. We conducted plasmid isolation using the Wizard Plus SV Minipreps DNA purification system (Promega) according to the manufacturer's instructions. .. Subcloning was confirmed by restriction analysis and sequence verification (Laragen, Inc.).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 83
    Promega wizard plus sv minipreps dna purification promega
    Wizard Plus Sv Minipreps Dna Purification Promega, supplied by Promega, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard plus sv minipreps dna purification promega/product/Promega
    Average 83 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    wizard plus sv minipreps dna purification promega - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    99
    Promega wizard plus sv minipreps dna purification system
    Wizard Plus Sv Minipreps Dna Purification System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 305 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard plus sv minipreps dna purification system/product/Promega
    Average 99 stars, based on 305 article reviews
    Price from $9.99 to $1999.99
    wizard plus sv minipreps dna purification system - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results