vegfr3  (R&D Systems)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
    Name:
    Recombinant Human VEGF R3 Flt 4 Fc Chimera Protein CF
    Description:
    The Recombinant Human VEGF R3 Flt 4 Fc Chimera Protein from R D Systems is derived from NS0 The Recombinant Human VEGF R3 Flt 4 Fc Chimera Protein has been validated for the following applications Binding Activity
    Catalog Number:
    349-F4-050
    Price:
    359
    Category:
    Proteins and Enzymes
    Source:
    NS0-derived Recombinant Human VEGF R3/Flt-4 Fc Chimera Protein
    Applications:
    Binding Activity
    Purity:
    >95%, by SDS-PAGE under reducing conditions and visualized by silver stain
    Conjugate:
    Unconjugated
    Size:
    50 ug
    		Buy from Supplier

    Structured Review

    R&D Systems vegfr3
    <t>VEGFR3</t> and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    The Recombinant Human VEGF R3 Flt 4 Fc Chimera Protein from R D Systems is derived from NS0 The Recombinant Human VEGF R3 Flt 4 Fc Chimera Protein has been validated for the following applications Binding Activity
    https://www.bioz.com/result/vegfr3/product/R&D Systems
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vegfr3 - by Bioz Stars, 2021-04
    93/100 stars

    Images

    1) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    2) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    3) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    4) Product Images from "Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges"

    Article Title: Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges

    Journal: Acta Neuropathologica

    doi: 10.1007/s00401-019-02091-z

    Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm
    Figure Legend Snippet: Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm

    Techniques Used: Expressing

    Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm
    Figure Legend Snippet: Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm

    Techniques Used: Immunohistochemistry

    Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted
    Figure Legend Snippet: Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted

    Techniques Used: Imaging, Transgenic Assay, Immunohistochemistry, Mouse Assay, Expressing

    5) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    6) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    7) Product Images from "Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges"

    Article Title: Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges

    Journal: Acta Neuropathologica

    doi: 10.1007/s00401-019-02091-z

    Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm
    Figure Legend Snippet: Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm

    Techniques Used: Expressing

    Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm
    Figure Legend Snippet: Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm

    Techniques Used: Immunohistochemistry

    Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted
    Figure Legend Snippet: Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted

    Techniques Used: Imaging, Transgenic Assay, Immunohistochemistry, Mouse Assay, Expressing

    8) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    9) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    10) Product Images from "Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges"

    Article Title: Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges

    Journal: Acta Neuropathologica

    doi: 10.1007/s00401-019-02091-z

    Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm
    Figure Legend Snippet: Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm

    Techniques Used: Expressing

    Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm
    Figure Legend Snippet: Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm

    Techniques Used: Immunohistochemistry

    Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted
    Figure Legend Snippet: Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted

    Techniques Used: Imaging, Transgenic Assay, Immunohistochemistry, Mouse Assay, Expressing

    11) Product Images from "Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges"

    Article Title: Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges

    Journal: Acta Neuropathologica

    doi: 10.1007/s00401-019-02091-z

    Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm
    Figure Legend Snippet: Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm

    Techniques Used: Expressing

    Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm
    Figure Legend Snippet: Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm

    Techniques Used: Immunohistochemistry

    Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted
    Figure Legend Snippet: Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted

    Techniques Used: Imaging, Transgenic Assay, Immunohistochemistry, Mouse Assay, Expressing

    12) Product Images from "Unexpected contribution of lymphatic vessels to promotion of distant metastatic tumor spread"

    Article Title: Unexpected contribution of lymphatic vessels to promotion of distant metastatic tumor spread

    Journal: Science Advances

    doi: 10.1126/sciadv.aat4758

    Characterization of CCSP-rtTA × tet-O–VEGF-C mice after doxycycline treatment for 2 weeks. ( A ) VEGF-C mRNA expression in the lung (normalized to RPLP0). The average expression level in WT × tet-O–VEGF-C mice was set to 1 ( n = 6). ( B ) VEGF-C protein levels in the lung detected by enzyme-linked immunosorbent assay (ELISA) ( n = 6). ( C ) Quantification of the VEGFR3 + LV area ( n = 4). ( D ) Representative images of VEGFR3 staining in the lung. Scale bars, 1 mm. ( E ) Representative high-magnification images of different regions in the lung stained for VEGFR3. Scale bars, 200 μm. PA, pulmonary artery; PV, pulmonary vein. ( F ) Representative images of MECA-32 staining in the lung. Scale bars, 50 μm. ( G ) Quantification of MECA-32 + blood vessel area in the lung ( n = 5).
    Figure Legend Snippet: Characterization of CCSP-rtTA × tet-O–VEGF-C mice after doxycycline treatment for 2 weeks. ( A ) VEGF-C mRNA expression in the lung (normalized to RPLP0). The average expression level in WT × tet-O–VEGF-C mice was set to 1 ( n = 6). ( B ) VEGF-C protein levels in the lung detected by enzyme-linked immunosorbent assay (ELISA) ( n = 6). ( C ) Quantification of the VEGFR3 + LV area ( n = 4). ( D ) Representative images of VEGFR3 staining in the lung. Scale bars, 1 mm. ( E ) Representative high-magnification images of different regions in the lung stained for VEGFR3. Scale bars, 200 μm. PA, pulmonary artery; PV, pulmonary vein. ( F ) Representative images of MECA-32 staining in the lung. Scale bars, 50 μm. ( G ) Quantification of MECA-32 + blood vessel area in the lung ( n = 5).

    Techniques Used: Mouse Assay, Expressing, Enzyme-linked Immunosorbent Assay, Staining

    13) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    14) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    15) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    16) Product Images from "Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges"

    Article Title: Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges

    Journal: Acta Neuropathologica

    doi: 10.1007/s00401-019-02091-z

    Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm
    Figure Legend Snippet: Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm

    Techniques Used: Expressing

    Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm
    Figure Legend Snippet: Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm

    Techniques Used: Immunohistochemistry

    Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted
    Figure Legend Snippet: Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted

    Techniques Used: Imaging, Transgenic Assay, Immunohistochemistry, Mouse Assay, Expressing

    17) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    18) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    19) Product Images from "Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges"

    Article Title: Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges

    Journal: Acta Neuropathologica

    doi: 10.1007/s00401-019-02091-z

    Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm
    Figure Legend Snippet: Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm

    Techniques Used: Expressing

    Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm
    Figure Legend Snippet: Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm

    Techniques Used: Immunohistochemistry

    Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted
    Figure Legend Snippet: Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted

    Techniques Used: Imaging, Transgenic Assay, Immunohistochemistry, Mouse Assay, Expressing

    20) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    21) Product Images from "Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges"

    Article Title: Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges

    Journal: Acta Neuropathologica

    doi: 10.1007/s00401-019-02091-z

    Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm
    Figure Legend Snippet: Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm

    Techniques Used: Expressing

    Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm
    Figure Legend Snippet: Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm

    Techniques Used: Immunohistochemistry

    Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted
    Figure Legend Snippet: Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted

    Techniques Used: Imaging, Transgenic Assay, Immunohistochemistry, Mouse Assay, Expressing

    22) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    23) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    24) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    25) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    26) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    27) Product Images from "Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges"

    Article Title: Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges

    Journal: Acta Neuropathologica

    doi: 10.1007/s00401-019-02091-z

    Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm
    Figure Legend Snippet: Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm

    Techniques Used: Expressing

    Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm
    Figure Legend Snippet: Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm

    Techniques Used: Immunohistochemistry

    Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted
    Figure Legend Snippet: Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted

    Techniques Used: Imaging, Transgenic Assay, Immunohistochemistry, Mouse Assay, Expressing

    28) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    29) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    30) Product Images from "Mechanoinduction of lymph vessel expansion"

    Article Title: Mechanoinduction of lymph vessel expansion

    Journal: The EMBO Journal

    doi: 10.1038/emboj.2011.456

    ‘Gain-of-fluid' experiments: Increasing the interstitial fluid volume elongates LECs, and enhances VEGFR3 tyrosine phosphorylation and LEC proliferation. ( A , B ) Representative bright field images of wild-type E11.5 mouse embryos in which ( A ) 4.2
    Figure Legend Snippet: ‘Gain-of-fluid' experiments: Increasing the interstitial fluid volume elongates LECs, and enhances VEGFR3 tyrosine phosphorylation and LEC proliferation. ( A , B ) Representative bright field images of wild-type E11.5 mouse embryos in which ( A ) 4.2

    Techniques Used:

    ‘Gain-of-fluid' experiments: β1 integrin is required for VEGFR3 tyrosine phosphorylation and LEC proliferation in response to an increased interstitial fluid volume. ( A , B , D , E ) Representative LSM images of proximity ligation assays (PLA)
    Figure Legend Snippet: ‘Gain-of-fluid' experiments: β1 integrin is required for VEGFR3 tyrosine phosphorylation and LEC proliferation in response to an increased interstitial fluid volume. ( A , B , D , E ) Representative LSM images of proximity ligation assays (PLA)

    Techniques Used: Ligation, Proximity Ligation Assay

    ‘Gain-of-fluid' experiments: Increasing the interstitial fluid volume enhances LEC proliferation in sprouting lymph vessels in a β1 integrin-dependent manner, and enhances VEGFR3 tyrosine phosphorylation and LEC proliferation in adult
    Figure Legend Snippet: ‘Gain-of-fluid' experiments: Increasing the interstitial fluid volume enhances LEC proliferation in sprouting lymph vessels in a β1 integrin-dependent manner, and enhances VEGFR3 tyrosine phosphorylation and LEC proliferation in adult

    Techniques Used:

    ‘Loss-of-fluid' experiments: Lowering the interstitial fluid volume reduces LEC elongation, and decreases VEGFR3 tyrosine phosphorylation and LEC proliferation. ( A , B ) Representative bright field images of wild-type E11.5 mouse embryos, in which
    Figure Legend Snippet: ‘Loss-of-fluid' experiments: Lowering the interstitial fluid volume reduces LEC elongation, and decreases VEGFR3 tyrosine phosphorylation and LEC proliferation. ( A , B ) Representative bright field images of wild-type E11.5 mouse embryos, in which

    Techniques Used:

    ‘Gain-of-fluid' experiments: VEGFR3-Fc reduces VEGFR3 tyrosine phosphorylation and LEC proliferation in response to an increased interstitial fluid volume. ( A , B , D , E ) Representative LSM images of proximity ligation assays (PLA) on cross-sections
    Figure Legend Snippet: ‘Gain-of-fluid' experiments: VEGFR3-Fc reduces VEGFR3 tyrosine phosphorylation and LEC proliferation in response to an increased interstitial fluid volume. ( A , B , D , E ) Representative LSM images of proximity ligation assays (PLA) on cross-sections

    Techniques Used: Ligation, Proximity Ligation Assay

    31) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    32) Product Images from "Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point"

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    Journal: eLife

    doi: 10.7554/eLife.04645

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Figure Legend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Techniques Used: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p
    Figure Legend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Techniques Used: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009
    Figure Legend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Techniques Used: Expressing, Flow Cytometry, FACS, Infection

    33) Product Images from "Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges"

    Article Title: Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges

    Journal: Acta Neuropathologica

    doi: 10.1007/s00401-019-02091-z

    Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm
    Figure Legend Snippet: Mouse LLECs take up Aβ 1-40. a Schematic showing the site of dye and Aβ1-40 perfusion into the CSF via the cisterna magna (arrow) of a 2-month old mouse. The dotted line indicates the plane of section. A anterior, P posterior, D dorsal, V ventral. b Coronal brain section indicating the areas imaged. SF4 refers to area captured in Figure S4. c The percentage of each labelled cell type that internalized perfused Aβ. Cells co-expressing VEGFR3 and LYVE1 take up Aβ at a higher rate than MRC1, LYVE1 double-positive cells as well as MRC1-positive, LYVE1-negative cells ( p ≤ 0.05, bootstrap). VEGFR3, LYVE1 counts, n = 2 brains (3 sections/brain). MRC1, LYVE1 counts, n = 3 brains (3 sections/brain). d–d′′′ Cells of the adult mouse meninges that co-express VEGFR3 ( d , green) and LYVE1 ( d′ , white) internalize Aβ1-40 ( d′′ , cyan). Scale = 20 µm. e-e′′′ ) Cells of the adult mouse meninges that co-express VEGFR3 ( e , green) and MRC1 ( e′ , white) internalize Aβ1-40 ( e′′ , cyan). Scale = 40 µm. f – f′′′ ) Cells of the adult mouse meninges that co-express MRC1 ( f , magenta) and LYVE1 ( f′ , white) internalize Aβ1-40 ( f′′ , cyan). The walls of a blood vessel (white arrowhead, f′′ ) also accumulate Aβ1-40. Scale = 60 µm

    Techniques Used: Expressing

    Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm
    Figure Legend Snippet: Cells of human meninges co-express LLEC markers. a – c DAB-IHC with single antibodies detects VEGFR3 ( a ), LYVE1 ( b ), and MRC1 ( c ) in the meninges of human post mortem brain showing no signs of neuropathology. These images are taken from a 38 year old male (sample P17/07, Table 1 ), and confirmed in n = 2 additional samples. P parenchyma. Scale = 150 µm ( a ); 40 µm ( b ); and 20 µm ( c ). d – f DAB-IHC with single antibodies detects VEGFR3 ( b ), LYVE1 ( c ), and MRC1 ( d ) in elderly human meninges (age: 89–92) with evidence of neuropathology and confirmed in n = 3 brains (Table 1 ). P, parenchyma. Scale = 20 µm. g–p IHC with fluorescent antibodies detects human meningeal cells that co-express MRC1 ( h , m , yellow), LYVE1 ( i , n , white), and VEGFR3 ( j , o , green). Nuclei/RNA are labelled with DAPI ( g , l , blue) and images are merged in ( k , p ). Scale = 10 µm

    Techniques Used: Immunohistochemistry

    Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted
    Figure Legend Snippet: Cells with BLEC molecular markers are present within the mouse leptomeninges. a Coronal brain section of adult zebrafish brain indicating the imaging area in the dorsal optic tectum (TeO). b A 14 month old Tg(kdr - l:mCherry); Tg(flt4:mCitrine) double transgenic zebrafish has cells in the meninges (white bracket) that express flt4 / vegfr3 (α-GFP, green) near kdr - l positive (α-RFP, red) blood vessels. DAPI (blue) labels the nuclei. Scale = 50 µm. c Coronal mouse brain section showing the imaging areas of the meninges. d As revealed by IHC, 17-week-old mouse brains express VEGFR3 (green) in the meninges (white bracket). Tie2-GFP;NG2-DsRed double reporter mice were used to distinguish arteries and veins. NG2 (red) labels pericytes and smooth muscle cells, Tie2 (magenta) labels vascular endothelial cells, and Hoechst (blue) stains nuclei. The image is rotated with the parenchyma at the bottom for ease of comparison with panel b. Scale = 50 µm. e-e′′′ As revealed by IHC, cells of the meninges co-express MRC1 ( e , yellow), LYVE1 ( e′ , white), and VEGFR3 ( e′′ , green). Red arrows highlight cells expressing these three markers. The images are rotated with the parenchyma at the bottom. scale = 30 µm. f , g Quantification of the relative numbers of single and double-labelled cells in 2-month old mouse meninges. VEGFR3 and LYVE1 cell counts were from n = 2 brains, 3 coronal sections (10 area images)/brain. MRC1 and LYVE1 cell counts were from n = 3 brains, 3 coronal sections (4 area images)/brain. The mean values for each set are depicted

    Techniques Used: Imaging, Transgenic Assay, Immunohistochemistry, Mouse Assay, Expressing

    Related Articles

    Binding Assay:

    Article Title: Podoplanin-Fc reduces lymphatic vessel formation in vitro and in vivo and causes disseminated intravascular coagulation when transgenically expressed in the skin
    Article Snippet: AxioVision 4.7.1 software was used for image acquisition. .. Detection of podoplanin-Fc binding to platelets and platelet activation by flow cytometry was performed essentially as described, using recombinant human podoplanin-Fc or VEGFR-3-Fc as negative control (both from R & D Systems). .. Platelet-rich plasma (PRP) from wild-type FVB mice was used in these experiments, obtained by dilution (1:3) of heparinized blood in Tyrodes buffer (137mM NaCl, 2.7mM KCl, 0.2mM Na2 HPO4 , 12mM NaHCO3 , 5.5mM d -glucose, 1mM MgCl2 , 1mM CaCl2 ), centrifugation at 100 × g for 15 minutes, and collection of the upper phase as PRP.

    Activation Assay:

    Article Title: Podoplanin-Fc reduces lymphatic vessel formation in vitro and in vivo and causes disseminated intravascular coagulation when transgenically expressed in the skin
    Article Snippet: AxioVision 4.7.1 software was used for image acquisition. .. Detection of podoplanin-Fc binding to platelets and platelet activation by flow cytometry was performed essentially as described, using recombinant human podoplanin-Fc or VEGFR-3-Fc as negative control (both from R & D Systems). .. Platelet-rich plasma (PRP) from wild-type FVB mice was used in these experiments, obtained by dilution (1:3) of heparinized blood in Tyrodes buffer (137mM NaCl, 2.7mM KCl, 0.2mM Na2 HPO4 , 12mM NaHCO3 , 5.5mM d -glucose, 1mM MgCl2 , 1mM CaCl2 ), centrifugation at 100 × g for 15 minutes, and collection of the upper phase as PRP.

    Flow Cytometry:

    Article Title: Podoplanin-Fc reduces lymphatic vessel formation in vitro and in vivo and causes disseminated intravascular coagulation when transgenically expressed in the skin
    Article Snippet: AxioVision 4.7.1 software was used for image acquisition. .. Detection of podoplanin-Fc binding to platelets and platelet activation by flow cytometry was performed essentially as described, using recombinant human podoplanin-Fc or VEGFR-3-Fc as negative control (both from R & D Systems). .. Platelet-rich plasma (PRP) from wild-type FVB mice was used in these experiments, obtained by dilution (1:3) of heparinized blood in Tyrodes buffer (137mM NaCl, 2.7mM KCl, 0.2mM Na2 HPO4 , 12mM NaHCO3 , 5.5mM d -glucose, 1mM MgCl2 , 1mM CaCl2 ), centrifugation at 100 × g for 15 minutes, and collection of the upper phase as PRP.

    Article Title: Discovery of High-Affinity PDGF-VEGFR Interactions: Redefining RTK Dynamics
    Article Snippet: Running buffer : 1x HBS-EP pH 7.4 (10 mM HEPES, 3 mM EDTA, 150 mM NaCl, 0.005% TWEEN-20, cat. # BR100188, GE Life Sciences). .. Optimizing immobilization conditions Human recombinant VEGFR1 (Cat. #321-FL-050/CF, R & D Systems), VEGFR2 (Cat. #357-KD-050/CF, R & D Systems), VEGFR3 (Cat. #349-F4–050, R & D Systems), PDGFRα (Cat #322-PR-050/CF, R & D Systems) and PDGFRβ (Cat. #385-PR-100/CF, R & D Systems) were immobilized on flow cells by first performing pre-concentration studies to determine optimal receptor-immobilization pH (Supplementary Table ), as follows: 20 µg/mL receptor + 10 mM acetate buffers ranging from pH 3.5 to 0.5–1.0 below the protein isoelectric point (Supplementary Table ) were prepared. .. Known receptor-ligand was introduced at 5 µL/min (association), followed by 5-µL injection of ethanolamine-HCL (GE Healthcare AB, Uppsala, Sweden) to clear the surface.

    Cytometry:

    Article Title: Podoplanin-Fc reduces lymphatic vessel formation in vitro and in vivo and causes disseminated intravascular coagulation when transgenically expressed in the skin
    Article Snippet: AxioVision 4.7.1 software was used for image acquisition. .. Detection of podoplanin-Fc binding to platelets and platelet activation by flow cytometry was performed essentially as described, using recombinant human podoplanin-Fc or VEGFR-3-Fc as negative control (both from R & D Systems). .. Platelet-rich plasma (PRP) from wild-type FVB mice was used in these experiments, obtained by dilution (1:3) of heparinized blood in Tyrodes buffer (137mM NaCl, 2.7mM KCl, 0.2mM Na2 HPO4 , 12mM NaHCO3 , 5.5mM d -glucose, 1mM MgCl2 , 1mM CaCl2 ), centrifugation at 100 × g for 15 minutes, and collection of the upper phase as PRP.

    Recombinant:

    Article Title: Podoplanin-Fc reduces lymphatic vessel formation in vitro and in vivo and causes disseminated intravascular coagulation when transgenically expressed in the skin
    Article Snippet: AxioVision 4.7.1 software was used for image acquisition. .. Detection of podoplanin-Fc binding to platelets and platelet activation by flow cytometry was performed essentially as described, using recombinant human podoplanin-Fc or VEGFR-3-Fc as negative control (both from R & D Systems). .. Platelet-rich plasma (PRP) from wild-type FVB mice was used in these experiments, obtained by dilution (1:3) of heparinized blood in Tyrodes buffer (137mM NaCl, 2.7mM KCl, 0.2mM Na2 HPO4 , 12mM NaHCO3 , 5.5mM d -glucose, 1mM MgCl2 , 1mM CaCl2 ), centrifugation at 100 × g for 15 minutes, and collection of the upper phase as PRP.

    Article Title: uPARAP/Endo180 receptor is a gatekeeper of VEGFR-2/VEGFR-3 heterodimerisation during pathological lymphangiogenesis
    Article Snippet: LEC transfections with siRNAs targeting uPARAP (siU1, 5′ CCCAACGUCUUCCUCAUCU 3′; and siU2, 5′ GGGCUGUACCUACGUAGAU 3′, Eurogentec), and VEGFR-2 (5′ ACAAUGACUAUAAGACAUGCUAUGG 3′, IDT-DNA) or with control siRNAs (Ctr, 5′ UGACUGAGUGCGAUCAUGA 3′; Eurogentec, and 5′ CUUCCUCUCUUUCUCUCCCUUGUGA 3′, IDT-DNA) were performed using Interferin according to manufacturer’s recommendations (409-50, Polyplus). .. LECs were stimulated with recombinant human VEGF-A (10 ng/ml, 293-VE), human VEGF-C (400 ng/ml, 2179-VC), or human VEGF-CCys156Ser (500 ng/ml, 752-VC), which binds exclusively to VEGFR-3 (all from R & D Systems), in serum-free EBM-2 medium (CC-3156, Lonza). .. In Fig. , serum-starved LECs were treated with (+ZM) or without (−ZM) 10 µM ZM323881 (2475, Tocris).

    Article Title: New Model of Macrophage Acquisition of the Lymphatic Endothelial Phenotype
    Article Snippet: .. In some experiments, RAW264.7 macrophages were pre-treated for 2 hours with soluble VEGFR-3-Fc recombinant protein (3 µg/ml; R & D Systems, Minneapolis, MN), followed by stimulation with 1 ng/ml of LPS for 24 hours. .. Following treatment, cells were washed twice with ice-cold DPBS, lysed in ice-cold lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton-X100, 0.1% SDS, 200 mM PMSF, protease inhibitors and phosphatase inhibitor cocktails), and spun down for 10 minutes at 13,000 RCF to remove insoluble material.

    Article Title: Discovery of High-Affinity PDGF-VEGFR Interactions: Redefining RTK Dynamics
    Article Snippet: Running buffer : 1x HBS-EP pH 7.4 (10 mM HEPES, 3 mM EDTA, 150 mM NaCl, 0.005% TWEEN-20, cat. # BR100188, GE Life Sciences). .. Optimizing immobilization conditions Human recombinant VEGFR1 (Cat. #321-FL-050/CF, R & D Systems), VEGFR2 (Cat. #357-KD-050/CF, R & D Systems), VEGFR3 (Cat. #349-F4–050, R & D Systems), PDGFRα (Cat #322-PR-050/CF, R & D Systems) and PDGFRβ (Cat. #385-PR-100/CF, R & D Systems) were immobilized on flow cells by first performing pre-concentration studies to determine optimal receptor-immobilization pH (Supplementary Table ), as follows: 20 µg/mL receptor + 10 mM acetate buffers ranging from pH 3.5 to 0.5–1.0 below the protein isoelectric point (Supplementary Table ) were prepared. .. Known receptor-ligand was introduced at 5 µL/min (association), followed by 5-µL injection of ethanolamine-HCL (GE Healthcare AB, Uppsala, Sweden) to clear the surface.

    Article Title: VEGF-A expression by HSV-1-infected cells drives corneal lymphangiogenesis
    Article Snippet: .. To competitively inhibit the prolymphangiogenic VEGF family members VEGF-A, C, or D, mice were injected subconjunctivally with 10 µl of recombinant human IgG1, VEGFR2-Fc, or VEGFR3-Fc (R & D Systems), all at a concentration of 100 µg/ml in sterile 0.1% BSA in PBS. .. The injections were performed at time points of days 0, 2, and 4 relative to the time of infection with HSV-1.

    Article Title: VEGF-C/Flt-4 axis in tumor cells contributes to the progression of oral squamous cell carcinoma via upregulating VEGF-C itself and contactin-1 in an autocrine manner
    Article Snippet: Stimulation reagents were recombinant human VEGF-C (rVEGF-C) and VEGF-C (Cys156Ser) protein, which is a selective agonist of Flt-4 and does not bind VEGFR-2 (R & D Systems, Minneapolis, MN, USA). .. Inhibition reagents were a recombinant Flt-4/Fc chimera that specifically neutralizes VEGF-C (R & D Systems) and MAZ51, a Flt-4-specific tyrosine kinase inhibitor (Calbiochem, Darmstadt, Germany). .. SAS or HO1U1 cells were seeded in six-well plates at a density of 2×105 cells per well and incubated overnight in serum-deprived medium (2% FBS medium).

    Article Title: Blocking Fibroblast Growth Factor Receptor Signaling Inhibits Tumor Growth, Lymphangiogenesis, and Metastasis
    Article Snippet: Human dermal lymphatic microvascular endothelial cells (HMVEC-dLys) were obtained from Lonza and cultured according to manufacturer’s instructions. .. FGF-2, VEGF-A, VEGF-C, VEGFR-2/Fc and VEGFR-3/Fc recombinant proteins are from R & D Systems and COX-2 (NS-398), FGFR (PD-173074), HIF-1α (400083) inhibitors are respectively from Cayman Chemical, Calbiochem and EMD Biosciences. .. Cobalt chloride (Sigma Aldrich, c8661) was a gift from Dr Sandra Sena, and was dissolved directly in treatment media and sterile-filtered before use.

    Negative Control:

    Article Title: Podoplanin-Fc reduces lymphatic vessel formation in vitro and in vivo and causes disseminated intravascular coagulation when transgenically expressed in the skin
    Article Snippet: AxioVision 4.7.1 software was used for image acquisition. .. Detection of podoplanin-Fc binding to platelets and platelet activation by flow cytometry was performed essentially as described, using recombinant human podoplanin-Fc or VEGFR-3-Fc as negative control (both from R & D Systems). .. Platelet-rich plasma (PRP) from wild-type FVB mice was used in these experiments, obtained by dilution (1:3) of heparinized blood in Tyrodes buffer (137mM NaCl, 2.7mM KCl, 0.2mM Na2 HPO4 , 12mM NaHCO3 , 5.5mM d -glucose, 1mM MgCl2 , 1mM CaCl2 ), centrifugation at 100 × g for 15 minutes, and collection of the upper phase as PRP.

    Mouse Assay:

    Article Title: VEGF-A expression by HSV-1-infected cells drives corneal lymphangiogenesis
    Article Snippet: .. To competitively inhibit the prolymphangiogenic VEGF family members VEGF-A, C, or D, mice were injected subconjunctivally with 10 µl of recombinant human IgG1, VEGFR2-Fc, or VEGFR3-Fc (R & D Systems), all at a concentration of 100 µg/ml in sterile 0.1% BSA in PBS. .. The injections were performed at time points of days 0, 2, and 4 relative to the time of infection with HSV-1.

    Injection:

    Article Title: VEGF-A expression by HSV-1-infected cells drives corneal lymphangiogenesis
    Article Snippet: .. To competitively inhibit the prolymphangiogenic VEGF family members VEGF-A, C, or D, mice were injected subconjunctivally with 10 µl of recombinant human IgG1, VEGFR2-Fc, or VEGFR3-Fc (R & D Systems), all at a concentration of 100 µg/ml in sterile 0.1% BSA in PBS. .. The injections were performed at time points of days 0, 2, and 4 relative to the time of infection with HSV-1.

    Concentration Assay:

    Article Title: VEGF-A expression by HSV-1-infected cells drives corneal lymphangiogenesis
    Article Snippet: .. To competitively inhibit the prolymphangiogenic VEGF family members VEGF-A, C, or D, mice were injected subconjunctivally with 10 µl of recombinant human IgG1, VEGFR2-Fc, or VEGFR3-Fc (R & D Systems), all at a concentration of 100 µg/ml in sterile 0.1% BSA in PBS. .. The injections were performed at time points of days 0, 2, and 4 relative to the time of infection with HSV-1.

    Inhibition:

    Article Title: VEGF-C/Flt-4 axis in tumor cells contributes to the progression of oral squamous cell carcinoma via upregulating VEGF-C itself and contactin-1 in an autocrine manner
    Article Snippet: Stimulation reagents were recombinant human VEGF-C (rVEGF-C) and VEGF-C (Cys156Ser) protein, which is a selective agonist of Flt-4 and does not bind VEGFR-2 (R & D Systems, Minneapolis, MN, USA). .. Inhibition reagents were a recombinant Flt-4/Fc chimera that specifically neutralizes VEGF-C (R & D Systems) and MAZ51, a Flt-4-specific tyrosine kinase inhibitor (Calbiochem, Darmstadt, Germany). .. SAS or HO1U1 cells were seeded in six-well plates at a density of 2×105 cells per well and incubated overnight in serum-deprived medium (2% FBS medium).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • vegfr 3  (R&D Systems)
    93
    R&D Systems vegfr 3
    Structural deficits of vessels in mammary tumors in NG2 null mice . Py8119 fat pad tumors (2-3 mm diameter) in wild type (WT) and NG2 null (NG2 KO) recipients were used to evaluate several types of structural deficits in tumor vessels due to ablation of NG2. A-C . Pericyte coverage of endothelial cells was evaluated in wild type (A) and NG2 null (B) tissue sections immunostained for desmin (red) and CD31 (green). Since desmin and CD31 are on distinct cell types, they cannot overlap in a single optical section. However, because of the intimate interaction between pericytes and endothelial cells, the two labels appear to overlap when viewed in three-dimensional space. Analysis of confocal z-stacks therefore allows quantification of the extent to which desmin appears to overlap with CD31 labeling. Arrowheads in A indicate areas of overlap between desmin and CD31. Arrows in B show vessel segments without pericyte coverage. The extent to which CD31 pixels are overlapped by desmin pixels provides a measure of pericyte ensheathment of endothelial cells (C). Data were collected from eight tumors per genotype, evaluating four sections per tumor. D . Vascular densities are not significantly different in Py8119 tumors in wild type and NG2 null mice, as quantified by counting CD31-positive vessels in a 10,000 μm 2 area. Data were collected from eight tumors per genotype, evaluating four sections per tumor. E-G . Pericyte maturation was evaluated via double immunostaining for desmin (green, all pericytes) and αSMA (red, mature pericytes). Mature pericytes express both desmin and αSMA (arrows), while immature pericytes express only desmin (arrowheads). Pericyte maturation is calculated as the % of desmin-positive pericytes that are αSMA-positive (G). Data were collected from four tumors per genotype, evaluating three sections per tumor. H . Endothelial ensheathment by mature pericytes was quantified by double immunostaining for CD31 and αSMA. Because the number of mature pericytes is reduced in tumor vessels in NG2 null hosts, only vessels with αSMA-positive pericytes are included in this analysis. Endothelial investment by mature pericytes is quantified as % overlap of CD31 pixels by αSMA pixels. For each genotype, five selected vessels each were examined in three different sections from each of three tumors. I-K . Basal lamina assembly was evaluated by immunostaining for CD31 (green) and collagen IV (red) in wild type (I) and NG2 null (J) tumor sections. Arrowheads in I indicate areas of collagen IV/CD31 overlap. Arrows in J show vessel segments with poor basal lamina deposition. Confocal Z-stacks were used to determine the percentage of CD31-positive pixels covered by collagen IV pixels (K). Data were collected from six tumors per genotype, evaluating four sections per tumor. L-M . Endothelial cell sprouting was evaluated by double immunostaining for CD31 (green) and <t>VEGFR-3</t> (red) in wild type (L) and NG2 null (M) tissue sections. Arrowheads in M indicate VEGFR-3 high/CD31-low structures that characterize sprouting endothelial cells. Confocal z-stacks were used to determine the number of sprouting tip cells per 100 mm 2 of CD31-positive vessel area ( N ). Data were collected from four tumors per genotype, evaluating three sections per tumor. Scale bars = 20 μm (A, B), 90 μm (E, F), 30 μm (I, J), and 12 μm (L, M). * P = 0.02; ** P = 0.006. NG2, nerve-glial antigen 2; αSMA, α-smooth muscle actin; VEGFR-3, vascular endothelial growth factor receptor-3.
    Vegfr 3, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vegfr 3/product/R&D Systems
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vegfr 3 - by Bioz Stars, 2021-04
    93/100 stars
    		  Buy from Supplier
    vegfr3  (R&D Systems)
    86
    R&D Systems vegfr3
    <t>VEGFR3</t> and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015
    Vegfr3, supplied by R&D Systems, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vegfr3/product/R&D Systems
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vegfr3 - by Bioz Stars, 2021-04
    86/100 stars
    		  Buy from Supplier
    Human VEGF R3 Flt 4 Antibody  (R&D Systems)
    N/A
    The Human VEGF R3 Flt 4 Antibody from R D Systems is a mouse monoclonal antibody to VEGF R3 Flt 4 This antibody reacts with human The Human VEGF R3
    		   Buy from Supplier
    Mouse VEGF R3 Flt 4 Antibody  (R&D Systems)
    N/A
    The Mouse VEGF R3 Flt 4 Antibody from R D Systems is a rat monoclonal antibody to VEGF R3 Flt 4 This antibody reacts with mouse The Mouse VEGF R3
    		   Buy from Supplier

    Image Search Results


    Structural deficits of vessels in mammary tumors in NG2 null mice . Py8119 fat pad tumors (2-3 mm diameter) in wild type (WT) and NG2 null (NG2 KO) recipients were used to evaluate several types of structural deficits in tumor vessels due to ablation of NG2. A-C . Pericyte coverage of endothelial cells was evaluated in wild type (A) and NG2 null (B) tissue sections immunostained for desmin (red) and CD31 (green). Since desmin and CD31 are on distinct cell types, they cannot overlap in a single optical section. However, because of the intimate interaction between pericytes and endothelial cells, the two labels appear to overlap when viewed in three-dimensional space. Analysis of confocal z-stacks therefore allows quantification of the extent to which desmin appears to overlap with CD31 labeling. Arrowheads in A indicate areas of overlap between desmin and CD31. Arrows in B show vessel segments without pericyte coverage. The extent to which CD31 pixels are overlapped by desmin pixels provides a measure of pericyte ensheathment of endothelial cells (C). Data were collected from eight tumors per genotype, evaluating four sections per tumor. D . Vascular densities are not significantly different in Py8119 tumors in wild type and NG2 null mice, as quantified by counting CD31-positive vessels in a 10,000 μm 2 area. Data were collected from eight tumors per genotype, evaluating four sections per tumor. E-G . Pericyte maturation was evaluated via double immunostaining for desmin (green, all pericytes) and αSMA (red, mature pericytes). Mature pericytes express both desmin and αSMA (arrows), while immature pericytes express only desmin (arrowheads). Pericyte maturation is calculated as the % of desmin-positive pericytes that are αSMA-positive (G). Data were collected from four tumors per genotype, evaluating three sections per tumor. H . Endothelial ensheathment by mature pericytes was quantified by double immunostaining for CD31 and αSMA. Because the number of mature pericytes is reduced in tumor vessels in NG2 null hosts, only vessels with αSMA-positive pericytes are included in this analysis. Endothelial investment by mature pericytes is quantified as % overlap of CD31 pixels by αSMA pixels. For each genotype, five selected vessels each were examined in three different sections from each of three tumors. I-K . Basal lamina assembly was evaluated by immunostaining for CD31 (green) and collagen IV (red) in wild type (I) and NG2 null (J) tumor sections. Arrowheads in I indicate areas of collagen IV/CD31 overlap. Arrows in J show vessel segments with poor basal lamina deposition. Confocal Z-stacks were used to determine the percentage of CD31-positive pixels covered by collagen IV pixels (K). Data were collected from six tumors per genotype, evaluating four sections per tumor. L-M . Endothelial cell sprouting was evaluated by double immunostaining for CD31 (green) and VEGFR-3 (red) in wild type (L) and NG2 null (M) tissue sections. Arrowheads in M indicate VEGFR-3 high/CD31-low structures that characterize sprouting endothelial cells. Confocal z-stacks were used to determine the number of sprouting tip cells per 100 mm 2 of CD31-positive vessel area ( N ). Data were collected from four tumors per genotype, evaluating three sections per tumor. Scale bars = 20 μm (A, B), 90 μm (E, F), 30 μm (I, J), and 12 μm (L, M). * P = 0.02; ** P = 0.006. NG2, nerve-glial antigen 2; αSMA, α-smooth muscle actin; VEGFR-3, vascular endothelial growth factor receptor-3.

    Journal: Breast Cancer Research : BCR

    Article Title: Early vascular deficits are correlated with delayed mammary tumorigenesis in the MMTV-PyMT transgenic mouse following genetic ablation of the NG2 proteoglycan

    doi: 10.1186/bcr3174

    Figure Lengend Snippet: Structural deficits of vessels in mammary tumors in NG2 null mice . Py8119 fat pad tumors (2-3 mm diameter) in wild type (WT) and NG2 null (NG2 KO) recipients were used to evaluate several types of structural deficits in tumor vessels due to ablation of NG2. A-C . Pericyte coverage of endothelial cells was evaluated in wild type (A) and NG2 null (B) tissue sections immunostained for desmin (red) and CD31 (green). Since desmin and CD31 are on distinct cell types, they cannot overlap in a single optical section. However, because of the intimate interaction between pericytes and endothelial cells, the two labels appear to overlap when viewed in three-dimensional space. Analysis of confocal z-stacks therefore allows quantification of the extent to which desmin appears to overlap with CD31 labeling. Arrowheads in A indicate areas of overlap between desmin and CD31. Arrows in B show vessel segments without pericyte coverage. The extent to which CD31 pixels are overlapped by desmin pixels provides a measure of pericyte ensheathment of endothelial cells (C). Data were collected from eight tumors per genotype, evaluating four sections per tumor. D . Vascular densities are not significantly different in Py8119 tumors in wild type and NG2 null mice, as quantified by counting CD31-positive vessels in a 10,000 μm 2 area. Data were collected from eight tumors per genotype, evaluating four sections per tumor. E-G . Pericyte maturation was evaluated via double immunostaining for desmin (green, all pericytes) and αSMA (red, mature pericytes). Mature pericytes express both desmin and αSMA (arrows), while immature pericytes express only desmin (arrowheads). Pericyte maturation is calculated as the % of desmin-positive pericytes that are αSMA-positive (G). Data were collected from four tumors per genotype, evaluating three sections per tumor. H . Endothelial ensheathment by mature pericytes was quantified by double immunostaining for CD31 and αSMA. Because the number of mature pericytes is reduced in tumor vessels in NG2 null hosts, only vessels with αSMA-positive pericytes are included in this analysis. Endothelial investment by mature pericytes is quantified as % overlap of CD31 pixels by αSMA pixels. For each genotype, five selected vessels each were examined in three different sections from each of three tumors. I-K . Basal lamina assembly was evaluated by immunostaining for CD31 (green) and collagen IV (red) in wild type (I) and NG2 null (J) tumor sections. Arrowheads in I indicate areas of collagen IV/CD31 overlap. Arrows in J show vessel segments with poor basal lamina deposition. Confocal Z-stacks were used to determine the percentage of CD31-positive pixels covered by collagen IV pixels (K). Data were collected from six tumors per genotype, evaluating four sections per tumor. L-M . Endothelial cell sprouting was evaluated by double immunostaining for CD31 (green) and VEGFR-3 (red) in wild type (L) and NG2 null (M) tissue sections. Arrowheads in M indicate VEGFR-3 high/CD31-low structures that characterize sprouting endothelial cells. Confocal z-stacks were used to determine the number of sprouting tip cells per 100 mm 2 of CD31-positive vessel area ( N ). Data were collected from four tumors per genotype, evaluating three sections per tumor. Scale bars = 20 μm (A, B), 90 μm (E, F), 30 μm (I, J), and 12 μm (L, M). * P = 0.02; ** P = 0.006. NG2, nerve-glial antigen 2; αSMA, α-smooth muscle actin; VEGFR-3, vascular endothelial growth factor receptor-3.

    Article Snippet: Double immunostaining for VEGFR-3 and CD31 demonstrates abundant VEGFR-3 expression in vessels of Py8119 mammary tumors growing in wild type mice, but significantly less VEGFR-3 expression in vessels of tumors in NG2 null mice (Figure ).

    Techniques: Mouse Assay, Labeling, Double Immunostaining, Immunostaining

    Schematic representation of FGFs-mediated tumor growth, metastasis and lymphangiogenesis. Tumor-secreted FGFs (red) play a central role in the induction of tumor metastasis, both directly by stimulating cancer cell proliferation and indirectly by upregulating VEGF-C expression in tumor cells (black). Tumor secreted FGFs might also induce directly lymphatic tube formation as previously demonstrated in vitro (dashed black line). Thus, tumor VEGF-C activates its VEGFR-2 and VEGFR-3 receptors on lymphatic endothelial cells, leading to lymphatic vessel formation. Tumor FGFs promote also pro-lymphatic gene expression (such as VEGFR-2, VEGFR-3, netrin-1, prox1 and integrin α9) in lymphatic endothelial cells (blue). Both tumor growth and lymphangiogenesis lead to tumor metastasis.

    Journal: PLoS ONE

    Article Title: Blocking Fibroblast Growth Factor Receptor Signaling Inhibits Tumor Growth, Lymphangiogenesis, and Metastasis

    doi: 10.1371/journal.pone.0039540

    Figure Lengend Snippet: Schematic representation of FGFs-mediated tumor growth, metastasis and lymphangiogenesis. Tumor-secreted FGFs (red) play a central role in the induction of tumor metastasis, both directly by stimulating cancer cell proliferation and indirectly by upregulating VEGF-C expression in tumor cells (black). Tumor secreted FGFs might also induce directly lymphatic tube formation as previously demonstrated in vitro (dashed black line). Thus, tumor VEGF-C activates its VEGFR-2 and VEGFR-3 receptors on lymphatic endothelial cells, leading to lymphatic vessel formation. Tumor FGFs promote also pro-lymphatic gene expression (such as VEGFR-2, VEGFR-3, netrin-1, prox1 and integrin α9) in lymphatic endothelial cells (blue). Both tumor growth and lymphangiogenesis lead to tumor metastasis.

    Article Snippet: FGF-2, VEGF-A, VEGF-C, VEGFR-2/Fc and VEGFR-3/Fc recombinant proteins are from R & D Systems and COX-2 (NS-398), FGFR (PD-173074), HIF-1α (400083) inhibitors are respectively from Cayman Chemical, Calbiochem and EMD Biosciences.

    Techniques: Expressing, In Vitro

    FGFR signaling stimulates expression of lymphangiogenic genes in lymphatic endothelial cells. (A) VEGFR-2 and VEGFR-3 mRNA expression is increased in FGF-2-treated (white) human dermal microvascular lymphatic endothelial cells (HMVEC-dLys) as compared to control (untreated cells, black). (B) Netrin-1 (left panel), Prox1 (middle panel) and integrin α9 (right panel) mRNA expression is stimulated by FGF-2 (white) in HMVEC-dLys as compared to control (untreated cells, black). (*p

    Journal: PLoS ONE

    Article Title: Blocking Fibroblast Growth Factor Receptor Signaling Inhibits Tumor Growth, Lymphangiogenesis, and Metastasis

    doi: 10.1371/journal.pone.0039540

    Figure Lengend Snippet: FGFR signaling stimulates expression of lymphangiogenic genes in lymphatic endothelial cells. (A) VEGFR-2 and VEGFR-3 mRNA expression is increased in FGF-2-treated (white) human dermal microvascular lymphatic endothelial cells (HMVEC-dLys) as compared to control (untreated cells, black). (B) Netrin-1 (left panel), Prox1 (middle panel) and integrin α9 (right panel) mRNA expression is stimulated by FGF-2 (white) in HMVEC-dLys as compared to control (untreated cells, black). (*p

    Article Snippet: FGF-2, VEGF-A, VEGF-C, VEGFR-2/Fc and VEGFR-3/Fc recombinant proteins are from R & D Systems and COX-2 (NS-398), FGFR (PD-173074), HIF-1α (400083) inhibitors are respectively from Cayman Chemical, Calbiochem and EMD Biosciences.

    Techniques: Expressing

    Inhibition of FGFR signaling suppresses tumor lymphangiogenesis and VEGF-C expression. (A) Left Panel, 66c14 tumor cells are observed into the lumens of VEGFR-3-positive lymphatic vessels (green) in 66c14 control tumors (white arrows in both left image and right zoomed-inset). Right panel, cytokeratin-stained 66c14 tumor cells (green) are detectable in axillary lymph nodes of 66c14 control cells-bearing mice (white arrows in both left image and right zoomed-inset), confirming the invasion mechanism via the lymphatic system of the 66c14 cells. (B) Left panel, representative images of VEGFR-3 (green) and DAPI (blue) staining of parental, empty plasmid (Control) and FGFR-2DN-expressing 66c14 tumors sections. White arrows indicate lumenized lymphatic vessels or isolated lymphatic endothelial cells in controls (Control and Parental) and FGFR-2DN tumors, respectively. Right panel, quantification of VEGFR-3-positive lymphatic vessel density (VD) demonstrates a density decrease in FGFR2-DN (R-2DN) expressing 66c14 tumor as compared to parental (Par.) or control (Ctrl) tumors. (C) Upper panel, FGFR-2DN-expressing 66c14 (66c14 FGFR-2DN) tumors exhibit a decrease in podoplanin-positive lymphatic vessel (green) density compared to control groups (66c14 Control and Parental). White arrows confirm the presence of lumenized lymphatic vessels or isolated lymphatic endothelial cells in controls and FGFR-2DN tumors, respectively. Bottom panel, quantification of podoplanin-positive lymphatic vessel density (VD) confirms a density decrease in FGFR2-DN (R-2DN) expressing 66c14 tumor as compared to parental (Par.) or control (Ctrl) tumors. (D) VEGF-C and PDGF-B (black and white bars, respectively) mRNA quantification of 66c14 tumor by qRT-PCR shows uniquely a VEGF-C expression decrease in 66c14 FGFR-2DN-expressing (R-2DN) versus control tumors (Ctrl; 66c14 control and Par; parental). (Scale Bars, 200 µm in A–C, *p

    Journal: PLoS ONE

    Article Title: Blocking Fibroblast Growth Factor Receptor Signaling Inhibits Tumor Growth, Lymphangiogenesis, and Metastasis

    doi: 10.1371/journal.pone.0039540

    Figure Lengend Snippet: Inhibition of FGFR signaling suppresses tumor lymphangiogenesis and VEGF-C expression. (A) Left Panel, 66c14 tumor cells are observed into the lumens of VEGFR-3-positive lymphatic vessels (green) in 66c14 control tumors (white arrows in both left image and right zoomed-inset). Right panel, cytokeratin-stained 66c14 tumor cells (green) are detectable in axillary lymph nodes of 66c14 control cells-bearing mice (white arrows in both left image and right zoomed-inset), confirming the invasion mechanism via the lymphatic system of the 66c14 cells. (B) Left panel, representative images of VEGFR-3 (green) and DAPI (blue) staining of parental, empty plasmid (Control) and FGFR-2DN-expressing 66c14 tumors sections. White arrows indicate lumenized lymphatic vessels or isolated lymphatic endothelial cells in controls (Control and Parental) and FGFR-2DN tumors, respectively. Right panel, quantification of VEGFR-3-positive lymphatic vessel density (VD) demonstrates a density decrease in FGFR2-DN (R-2DN) expressing 66c14 tumor as compared to parental (Par.) or control (Ctrl) tumors. (C) Upper panel, FGFR-2DN-expressing 66c14 (66c14 FGFR-2DN) tumors exhibit a decrease in podoplanin-positive lymphatic vessel (green) density compared to control groups (66c14 Control and Parental). White arrows confirm the presence of lumenized lymphatic vessels or isolated lymphatic endothelial cells in controls and FGFR-2DN tumors, respectively. Bottom panel, quantification of podoplanin-positive lymphatic vessel density (VD) confirms a density decrease in FGFR2-DN (R-2DN) expressing 66c14 tumor as compared to parental (Par.) or control (Ctrl) tumors. (D) VEGF-C and PDGF-B (black and white bars, respectively) mRNA quantification of 66c14 tumor by qRT-PCR shows uniquely a VEGF-C expression decrease in 66c14 FGFR-2DN-expressing (R-2DN) versus control tumors (Ctrl; 66c14 control and Par; parental). (Scale Bars, 200 µm in A–C, *p

    Article Snippet: FGF-2, VEGF-A, VEGF-C, VEGFR-2/Fc and VEGFR-3/Fc recombinant proteins are from R & D Systems and COX-2 (NS-398), FGFR (PD-173074), HIF-1α (400083) inhibitors are respectively from Cayman Chemical, Calbiochem and EMD Biosciences.

    Techniques: Inhibition, Expressing, Staining, Mouse Assay, Plasmid Preparation, Isolation, Quantitative RT-PCR

    Baseline mRNA expression of Flt-4, VEGF-C, and CNTN-1 in HNSCC cells. The mRNA expression levels of each gene in the HNSCC cell lines were assessed by quantitative real-time PCR. The relative expression levels of the genes were compared after normalization using those of GAPDH. A: Flt-4. B: VEGF-C and CNTN-1, in which the relative expression levels were calibrated by dividing each value by that of HSC-2 for the sake of convenience. C: The selective expression of Flt-4 in SAS and HO1U1 cells was further confirmed by standard PCR. D: Immunofluorescent staining of SAS and HO1U1 cells, as well as HMVEC cells, revealed the cytoplasmic localization of Flt-4, indicating the receptor internalization that reflects its activation. Nuclei were stained with Hoechst 33258. Scale bar: 10 μm.

    Journal: American Journal of Cancer Research

    Article Title: VEGF-C/Flt-4 axis in tumor cells contributes to the progression of oral squamous cell carcinoma via upregulating VEGF-C itself and contactin-1 in an autocrine manner

    doi:

    Figure Lengend Snippet: Baseline mRNA expression of Flt-4, VEGF-C, and CNTN-1 in HNSCC cells. The mRNA expression levels of each gene in the HNSCC cell lines were assessed by quantitative real-time PCR. The relative expression levels of the genes were compared after normalization using those of GAPDH. A: Flt-4. B: VEGF-C and CNTN-1, in which the relative expression levels were calibrated by dividing each value by that of HSC-2 for the sake of convenience. C: The selective expression of Flt-4 in SAS and HO1U1 cells was further confirmed by standard PCR. D: Immunofluorescent staining of SAS and HO1U1 cells, as well as HMVEC cells, revealed the cytoplasmic localization of Flt-4, indicating the receptor internalization that reflects its activation. Nuclei were stained with Hoechst 33258. Scale bar: 10 μm.

    Article Snippet: Inhibition reagents were a recombinant Flt-4/Fc chimera that specifically neutralizes VEGF-C (R & D Systems) and MAZ51, a Flt-4-specific tyrosine kinase inhibitor (Calbiochem, Darmstadt, Germany).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Staining, Activation Assay

    A schematic diagram demonstrating the VEGF-C/Flt-4 autocrine system in OSCC cells. Tumor cell-derived VEGF-C binds to Flt-4 expressed on the tumor cells, and its activation upregulates the expression levels of VEGF-C itself and CNTN-1 in an autocrine manner, thereby enhancing tumor cell proliferation and migration. This autocrine mechanism of the VEGF-C/Flt-4 axis in tumor cells likely contributes to cancer progression, including the development of lymphatic metastasis, along with the primary well-known paracrine mechanism involving lymphatic endothelial cells that leads to lymphangiogenesis.

    Journal: American Journal of Cancer Research

    Article Title: VEGF-C/Flt-4 axis in tumor cells contributes to the progression of oral squamous cell carcinoma via upregulating VEGF-C itself and contactin-1 in an autocrine manner

    doi:

    Figure Lengend Snippet: A schematic diagram demonstrating the VEGF-C/Flt-4 autocrine system in OSCC cells. Tumor cell-derived VEGF-C binds to Flt-4 expressed on the tumor cells, and its activation upregulates the expression levels of VEGF-C itself and CNTN-1 in an autocrine manner, thereby enhancing tumor cell proliferation and migration. This autocrine mechanism of the VEGF-C/Flt-4 axis in tumor cells likely contributes to cancer progression, including the development of lymphatic metastasis, along with the primary well-known paracrine mechanism involving lymphatic endothelial cells that leads to lymphangiogenesis.

    Article Snippet: Inhibition reagents were a recombinant Flt-4/Fc chimera that specifically neutralizes VEGF-C (R & D Systems) and MAZ51, a Flt-4-specific tyrosine kinase inhibitor (Calbiochem, Darmstadt, Germany).

    Techniques: Derivative Assay, Activation Assay, Expressing, Migration

    Alterations in the proliferation and migration activity of SAS cells following Flt-4 stimulation and inhibition. The effects of Flt-4 stimulation and inhibition on proliferation and migration activity were examined using recombinant VEGF-C or VEGF-C (Cys156Ser) (selective Flt-4 agonist) as stimulation reagents and recombinant human Flt-4/Fc chimera (specific VEGF-C neutralizer) or MAZ51 (specific Flt-4 inhibitor) as inhibition reagents. (A and B) An in vitro cell proliferation assay was conducted using SAS cells. The data are presented as the fold increase in the OD values of the absorbance measured at 450 nm compared with the respective controls. Flt-4 stimulation promoted proliferation activity in a dose-dependent manner (A), whereas Flt-4 inhibition suppressed proliferation activity in a dose-dependent manner (B). (C and D) An in vitro migration assay was performed using SAS cells. The results are presented as the fold increase in the number of migrated cells compared with the respective controls. To eliminate the possible influence of differences in proliferation activity, each value was normalized according to the corresponding ratio of the proliferation rate found in the same condition. Flt-4 stimulation enhanced migration activity in a dose-dependent manner (C), whereas Flt-4 inhibition attenuated migration activity in a dose-dependent manner (D). The values represent the mean ± standard deviation. Difference between each condition and control was statistically analyzed using a two-tailed t-test: *, P

    Journal: American Journal of Cancer Research

    Article Title: VEGF-C/Flt-4 axis in tumor cells contributes to the progression of oral squamous cell carcinoma via upregulating VEGF-C itself and contactin-1 in an autocrine manner

    doi:

    Figure Lengend Snippet: Alterations in the proliferation and migration activity of SAS cells following Flt-4 stimulation and inhibition. The effects of Flt-4 stimulation and inhibition on proliferation and migration activity were examined using recombinant VEGF-C or VEGF-C (Cys156Ser) (selective Flt-4 agonist) as stimulation reagents and recombinant human Flt-4/Fc chimera (specific VEGF-C neutralizer) or MAZ51 (specific Flt-4 inhibitor) as inhibition reagents. (A and B) An in vitro cell proliferation assay was conducted using SAS cells. The data are presented as the fold increase in the OD values of the absorbance measured at 450 nm compared with the respective controls. Flt-4 stimulation promoted proliferation activity in a dose-dependent manner (A), whereas Flt-4 inhibition suppressed proliferation activity in a dose-dependent manner (B). (C and D) An in vitro migration assay was performed using SAS cells. The results are presented as the fold increase in the number of migrated cells compared with the respective controls. To eliminate the possible influence of differences in proliferation activity, each value was normalized according to the corresponding ratio of the proliferation rate found in the same condition. Flt-4 stimulation enhanced migration activity in a dose-dependent manner (C), whereas Flt-4 inhibition attenuated migration activity in a dose-dependent manner (D). The values represent the mean ± standard deviation. Difference between each condition and control was statistically analyzed using a two-tailed t-test: *, P

    Article Snippet: Inhibition reagents were a recombinant Flt-4/Fc chimera that specifically neutralizes VEGF-C (R & D Systems) and MAZ51, a Flt-4-specific tyrosine kinase inhibitor (Calbiochem, Darmstadt, Germany).

    Techniques: Migration, Activity Assay, Inhibition, Recombinant, In Vitro, Proliferation Assay, Standard Deviation, Two Tailed Test

    Effects of Flt-4 stimulation and inhibition on the mRNA expression levels of CNTN-1 and VEGF-C in OSCC cells. Alterations in the mRNA expression of CNTN-1 and VEGF-C in OSCC cells were examined by quantitative real-time PCR using recombinant VEGF-C or VEGF-C (Cys156Ser) (selective Flt-4 agonist) as stimulation reagents and recombinant human Flt-4/Fc chimera (specific VEGF-C neutralizer) or MAZ51 (specific Flt-4 inhibitor) as inhibition reagents. In SAS cells, Flt-4 stimulation upregulated both CNTN-1 and VEGF-C expression compared to the control (A), whereas in contrast, Flt-4 inhibition downregulated both CNTN-1 and VEGF-C expression compared to the control (B). In HO1U1 cells, Flt-4 stimulation resulted in relatively less upregulation of CNTN-1 expression and no change in VEGF-C expression (C), whereas Flt-4 inhibition led to downregulation of CNTN-1 expression but no change in VEGF-C expression (D). The values represent the mean ± standard deviation. Difference between each condition and control was statistically analyzed using a two-tailed t-test: *, P

    Journal: American Journal of Cancer Research

    Article Title: VEGF-C/Flt-4 axis in tumor cells contributes to the progression of oral squamous cell carcinoma via upregulating VEGF-C itself and contactin-1 in an autocrine manner

    doi:

    Figure Lengend Snippet: Effects of Flt-4 stimulation and inhibition on the mRNA expression levels of CNTN-1 and VEGF-C in OSCC cells. Alterations in the mRNA expression of CNTN-1 and VEGF-C in OSCC cells were examined by quantitative real-time PCR using recombinant VEGF-C or VEGF-C (Cys156Ser) (selective Flt-4 agonist) as stimulation reagents and recombinant human Flt-4/Fc chimera (specific VEGF-C neutralizer) or MAZ51 (specific Flt-4 inhibitor) as inhibition reagents. In SAS cells, Flt-4 stimulation upregulated both CNTN-1 and VEGF-C expression compared to the control (A), whereas in contrast, Flt-4 inhibition downregulated both CNTN-1 and VEGF-C expression compared to the control (B). In HO1U1 cells, Flt-4 stimulation resulted in relatively less upregulation of CNTN-1 expression and no change in VEGF-C expression (C), whereas Flt-4 inhibition led to downregulation of CNTN-1 expression but no change in VEGF-C expression (D). The values represent the mean ± standard deviation. Difference between each condition and control was statistically analyzed using a two-tailed t-test: *, P

    Article Snippet: Inhibition reagents were a recombinant Flt-4/Fc chimera that specifically neutralizes VEGF-C (R & D Systems) and MAZ51, a Flt-4-specific tyrosine kinase inhibitor (Calbiochem, Darmstadt, Germany).

    Techniques: Inhibition, Expressing, Real-time Polymerase Chain Reaction, Recombinant, Standard Deviation, Two Tailed Test

    VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Journal: eLife

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    doi: 10.7554/eLife.04645

    Figure Lengend Snippet: VEGFR3 and DAPI staining of a longitudinal section different portions of the aorta. Scale bar: 50 µm. DOI: http://dx.doi.org/10.7554/eLife.04645.015

    Article Snippet: Does the YFP expression reflect reliably the expression of VEGFR3 in the adult aorta?

    Techniques: Staining

    VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Journal: eLife

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    doi: 10.7554/eLife.04645

    Figure Lengend Snippet: VEGFR3 activation by shear stress. HDLECs (left) and HUVECs (right) were stimulated for 15 min with shear stress at the indicated levels. VEGFR3 transactivation was assayed by phosphorylation on Y1230, detected by Western blotting with pY1230 antibody (n = 5 independent experiments; *: p

    Article Snippet: Does the YFP expression reflect reliably the expression of VEGFR3 in the adult aorta?

    Techniques: Activation Assay, Western Blot

    ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Journal: eLife

    Article Title: Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point

    doi: 10.7554/eLife.04645

    Figure Lengend Snippet: ( A ) Representative pictures of HUVEC cells expressing hVEGFR3-GFP (GFP signal displayed) after 16 hr of stimulation at 5 and 20 dynes.cm −2 . Flow direction is from left to right. ( B ) FACS analysis of the GFP signal from HUVEC (grey) and HUVEC infected with VEGFR3-GFP (GFP+). DOI: http://dx.doi.org/10.7554/eLife.04645.009

    Article Snippet: Does the YFP expression reflect reliably the expression of VEGFR3 in the adult aorta?

    Techniques: Expressing, Flow Cytometry, FACS, Infection