Structured Review

Roche uracil dna glycosylase
Uracil Dna Glycosylase, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/uracil dna glycosylase/product/Roche
Average 90 stars, based on 2 article reviews
Price from $9.99 to $1999.99
uracil dna glycosylase - by Bioz Stars, 2019-10
90/100 stars

Images

Related Articles

Diagnostic Assay:

Article Title: A deep vein thrombosis caused by 20209C > T mutation in homozygosis of the prothrombin gene in a Caucasian patient
Article Snippet: The blood sample was analyzed with The Xpert® HemosIL® Factor II & Factor V Assay (Cepheid/Instrumentation Laboratory), which is a qualitative in vitro diagnostic genotyping test for the detection of Factor II (20210G > A mutation) and Factor V (1691G > A mutation) alleles from sodium citrate or EDTA anticoagulated whole blood. .. Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations.

Article Title: Mycobacterium avium subsp. Paratuberculosis and the expression of selected virulence and pathogenesis genes in response to 6?C, 65?c and ph 2.0
Article Snippet: Reverse transcription was performed at 42°C for 60 min. After RT, cDNA was purified using the MinElute qPCR Purification Kit (Qiagen, Germany) with final elution into 100 μl of TE buffer (Amresco, Solon, OH, USA). .. Real time qPCR mixes were made up to a final volume of 10 μl and contained 1 × of DyNAmo Probe qPCR Master Mix (Finnzyme, Finland), 0.1 U of Uracil DNA Glycosylase (Roche Molecular Diagnostic, Germany), 5 pmol of each forward and reverse primer, 0.5 pmol of each probe labelled with FAM and 1μl of appropriate cDNA. .. Primers and probes were designed using Primer3 software ( ) on a MAP K10 strain genomic sequence (GenBank AE016958) and synthesised by VBC Genomics, Austria ( ).

Clone Assay:

Article Title: Molecular Genealogy of a Mongol Queen’s Family and Her Possible Kinship with Genghis Khan
Article Snippet: A 10-μL aliquot of each aDNA extract was treated with 1 U of uracil-DNA glycosylase (UDG; Roche Diagnostics Co., Indianapolis, IN, USA) before PCR amplification, while another aliquot was treated with 1 U of UDG that was first heat-inactivated at 95°C for 10 min. .. The aDNA treated with active or inactive UDG was cloned into the TA cloning vector provided in the pGEM-T Easy Vector System I TA cloning kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions.

Article Title: Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River
Article Snippet: Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination. .. Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination.

Amplification:

Article Title: Molecular Genealogy of a Mongol Queen’s Family and Her Possible Kinship with Genghis Khan
Article Snippet: Mock extractions without samples and PCR blanks were used to carefully monitor contaminations of aDNA from researchers and other organisms throughout the experiment. .. A 10-μL aliquot of each aDNA extract was treated with 1 U of uracil-DNA glycosylase (UDG; Roche Diagnostics Co., Indianapolis, IN, USA) before PCR amplification, while another aliquot was treated with 1 U of UDG that was first heat-inactivated at 95°C for 10 min. .. The aDNA treated with active or inactive UDG was cloned into the TA cloning vector provided in the pGEM-T Easy Vector System I TA cloning kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions.

Article Title: A deep vein thrombosis caused by 20209C > T mutation in homozygosis of the prothrombin gene in a Caucasian patient
Article Snippet: The GeneXpert Dx System automates and integrates sample purification, nucleic acid amplification, and detection of the target sequence in whole blood using real-time PCR assays. .. Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations.

Article Title: Real-Time PCR Assay for Detection and Differentiation of Shiga Toxin-Producing Escherichia coli from Clinical Samples
Article Snippet: Real-time PCR was performed with a final reaction volume of 40 μl containing iQ SYBR Green Supermix (2×), primers at a final concentration of 500 nM, uracil DNA glycosylase (Roche, Indianapolis, IN), and 4 μl of extracted DNA. .. The real-time PCR assay was performed using a Bio-Rad MyiQ iCycler system (Bio-Rad, Hercules, CA).

Article Title: Peripheral Blood Mononuclear Cell Traffic Plays a Crucial Role in Mother-to-Infant Transmission of Hepatitis B Virus
Article Snippet: For PCR, 4 mM MgCl2 , 4 pmol of each hybridization probe, 20 pmol of the two PCR primers, 2 μL of LightCycler Fast Start DNA Master Hybridization probe mix (Roche Diagnostics) and 10 μL of HBV DNA samples were used. .. The PCR cycling program consisted of an initial denaturing step at 95°C for 10 min, followed by 45 amplification cycles at 92°C for 10 s, 50°C for 10 s, and 72°C for 10 s. To prevent carry-over contamination, 1 U of uracil N glycosylase (Roche Diagnostics, Shanghai, China) was added to the master mix. .. Plasma containing 4.4 ×109 HBV DNA copies/mL (HBV DNA Quantiplex assay, Chiron) was serially diluted to generate a standard curve.

Article Title: Monitoring of Cytomegalovirus Viral Loads by Two Molecular Assays in Whole-Blood and Plasma Samples from Hematopoietic Stem Cell Transplant Recipients
Article Snippet: The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences). .. The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences).

Article Title: Evaluation of a novel real-time PCR test based on the ssrA gene for the identification of group B streptococci in vaginal swabs
Article Snippet: Each reaction contained reagents to final concentrations of: 5 mM MgCl2 , 0.5 μM each primer (Table ), 0.2 μM each hybridization probe (Table ), 0.5 U uracil-DNA glycosylase (Roche). .. Template was added in 2 μl volumes and IAC was added as 100 recombinant plasmid copies per reaction.

Article Title: Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River
Article Snippet: Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination. .. Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination.

Article Title: Four-Color Alternating-Laser Excitation Single-Molecule Fluorescence Spectroscopy for Next-Generation Biodetection Assays
Article Snippet: A universal amplification primer (5′-GCGTACTAGCGTACCACGTGTCGACT-3′) and 5′-tailed target-specific primers were used to eliminate primer-dimer formation during the PCR ( ). .. Uracil-DNA glycosylase and dUTP (Roche Applied Science) were used to eliminate the potential for PCR carryover contamination.

Article Title: Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay
Article Snippet: DNA amplification of CMV, adenovirus and enterovirus was carried out in 0.2 ml tubes containing 45 μl reaction mix and 5 μl DNA extract. .. The reaction mix consisted of 10 × Taq buffer (including 50 mM Mg), 400 nM of each deoxynucleoside triphosphate, 500 nM of target primers, 200 nM of the target probe, 300 nM of IC primers, 100 nM of the IC probe, 0.01 U of Uracil-DNA Glycosylase (UNG, Roche Diagnostics, Mannheim, Germany) and 5 U of Taq DNA polymerase (5 PRIME, Hamburg, Germany).

DNA Synthesis:

Article Title: G6PC2 Modulates the Effects of Dexamethasone on Fasting Blood Glucose and Glucose Tolerance
Article Snippet: Gene expression was quantitated using real-time PCR. .. Tissue culture cell, pancreatic, and liver gene expression were quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the deoxyuridine triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-Glycosylase (Roche). .. Islet gene expression was quantitated using the primer-probe TaqMan approach from Life Technologies as described ( ).

Article Title: G6PC2 Modulates Fasting Blood Glucose In Male Mice in Response to Stress
Article Snippet: Gene expression was quantitated using real-time PCR. .. Pancreatic gene expression was quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the 2′-deoxyuridine 5′-triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-glycosylase (Roche). .. Islet gene expression was quantitated using the primer-probe TaqMan approach from Life Technologies as described ( ).

Article Title: Development of real-time PCR for detection of Mycoplasma hominis
Article Snippet: The DNA template from M. hominis PG21 was added by use of filter pipette tips. .. Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions. .. Reaction mixes contained dUTPs instead of dTTPs, and therefore it was possible to avoid contamination of samples by adding an enzyme that hydrolyzes uracil-glycosidic bonds at U-DNA in single and double-strained DNA [ ].

Positive Control:

Article Title: Real-Time PCR Assay for Detection and Differentiation of Shiga Toxin-Producing Escherichia coli from Clinical Samples
Article Snippet: O157 positive-control broth (positive for all targets) at high and low concentrations (500 and 50 copies/reaction, respectively) and a negative-control broth extraction sample were extracted in each batch run along with MAC enrichment broth containing patient samples. .. Real-time PCR was performed with a final reaction volume of 40 μl containing iQ SYBR Green Supermix (2×), primers at a final concentration of 500 nM, uracil DNA glycosylase (Roche, Indianapolis, IN), and 4 μl of extracted DNA.

Article Title: Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River
Article Snippet: All qPCR runs included a negative control reaction (PCR-grade H2 O without template) and a positive control reaction. .. Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination.

Synthesized:

Article Title: Osteopontin inhibits HIF-2α mRNA expression in osteoarthritic chondrocytes
Article Snippet: The PCR thermal conditions were as follows: 50°C uracil-DNA glycosylase (UDG; Roche Diagnostics, Basel, Switzerland) pretreatment for 2 min, 1 cycle at 95°C for 10 min for initial denaturation, 40 repeats of a 15 sec 95°C denaturation step, a 30 sec 30°C annealing step and a 30 sec extension step at 72°C. .. The PCR thermal conditions were as follows: 50°C uracil-DNA glycosylase (UDG; Roche Diagnostics, Basel, Switzerland) pretreatment for 2 min, 1 cycle at 95°C for 10 min for initial denaturation, 40 repeats of a 15 sec 95°C denaturation step, a 30 sec 30°C annealing step and a 30 sec extension step at 72°C.

Article Title: Four-Color Alternating-Laser Excitation Single-Molecule Fluorescence Spectroscopy for Next-Generation Biodetection Assays
Article Snippet: PCR primers were synthesized by Integrated DNA Technologies. .. Uracil-DNA glycosylase and dUTP (Roche Applied Science) were used to eliminate the potential for PCR carryover contamination.

Quantitative RT-PCR:

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices
Article Snippet: Paragraph title: RT-qPCR for Detection and Quantification of MS2 PLP ... 1 U of Uracil DNA Glycosylase (Roche) was used in each qPCR reaction to avoid possible carry-over contamination. qPCR was performed using the Roche LightCycler 480 under the following reaction conditions: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 60°C for 30 s and 72°C for 10 s. The subsequent analysis of results (quantification) was carried out using the “Fit point analysis” option of the LightCycler 480 Software release 1.5.0 (version 1.5.0.39).

Article Title: Hepatitis E Virus in Pork Production Chain in Czech Republic, Italy, and Spain, 2010
Article Snippet: All tests included virus- and IAC-negative controls. .. A duplex RT-qPCR was used as described , including IACs and a carryover contamination prevention system using uracil-N-glycosylase (Roche Molecular Diagnostics, Manheim, Germany). .. Reactions contained 1× TaqMan Universal PCR Master-Mix (Life Technologies, Branchburg, NJ, USA), 0.9 µM primers, 0.225 µM PAdV TaqMan probe (FAM-labeled), 50 nM IAC probe (VIC-labeled), and 100 copies of PAdV IAC.

Real-time Polymerase Chain Reaction:

Article Title: G6PC2 Modulates the Effects of Dexamethasone on Fasting Blood Glucose and Glucose Tolerance
Article Snippet: Tissue culture cell, pancreatic, and liver gene expression were quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the deoxyuridine triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-Glycosylase (Roche). .. Tissue culture cell, pancreatic, and liver gene expression were quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the deoxyuridine triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-Glycosylase (Roche).

Article Title: G6PC2 Modulates Fasting Blood Glucose In Male Mice in Response to Stress
Article Snippet: Pancreatic gene expression was quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the 2′-deoxyuridine 5′-triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-glycosylase (Roche). .. Pancreatic gene expression was quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the 2′-deoxyuridine 5′-triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-glycosylase (Roche).

Article Title: A deep vein thrombosis caused by 20209C > T mutation in homozygosis of the prothrombin gene in a Caucasian patient
Article Snippet: Real time-PCR, Quantitative PCR, was performed with the LightCycler System 2.0 (Roche Diagnostics, Manheim, Germany) using the capillaries of 20 μL. .. Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations.

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices
Article Snippet: The reaction mix contained 10 μl of LightCycler 480 Probes Master (Roche), 5 pmol of the NP F and NP R primers, 10 pmol of the TM F and TM R primers, 4 pmol of the IAC probe and 1 pmol of the NP P probe, and 5 μl template cDNA. .. 1 U of Uracil DNA Glycosylase (Roche) was used in each qPCR reaction to avoid possible carry-over contamination. qPCR was performed using the Roche LightCycler 480 under the following reaction conditions: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 60°C for 30 s and 72°C for 10 s. The subsequent analysis of results (quantification) was carried out using the “Fit point analysis” option of the LightCycler 480 Software release 1.5.0 (version 1.5.0.39). .. Quantification standards were prepared from a 10-fold dilution of in vitro -prepared RNA transcripts of the fragment encoding the specific control sequence derived from thylacine and the moa bird in the range of 5 × 109 genome copies/5 μl to 5 × 101 genome copies/5 μl.

Article Title: Osteopontin inhibits HIF-2α mRNA expression in osteoarthritic chondrocytes
Article Snippet: Paragraph title: qPCR assays ... The PCR thermal conditions were as follows: 50°C uracil-DNA glycosylase (UDG; Roche Diagnostics, Basel, Switzerland) pretreatment for 2 min, 1 cycle at 95°C for 10 min for initial denaturation, 40 repeats of a 15 sec 95°C denaturation step, a 30 sec 30°C annealing step and a 30 sec extension step at 72°C.

Article Title: Real-Time PCR Assay for Detection and Differentiation of Shiga Toxin-Producing Escherichia coli from Clinical Samples
Article Snippet: The specificity of each primer was screened by BLAST analysis and validated using 30 clinical specimens with diagnoses, confirmed by culture, of Shiga toxin-producing E. coli or non- E. coli pathogens, as described above. .. Real-time PCR was performed with a final reaction volume of 40 μl containing iQ SYBR Green Supermix (2×), primers at a final concentration of 500 nM, uracil DNA glycosylase (Roche, Indianapolis, IN), and 4 μl of extracted DNA. .. The real-time PCR assay was performed using a Bio-Rad MyiQ iCycler system (Bio-Rad, Hercules, CA).

Article Title: Peripheral Blood Mononuclear Cell Traffic Plays a Crucial Role in Mother-to-Infant Transmission of Hepatitis B Virus
Article Snippet: Paragraph title: Quantitation of Serum HBV DNA by Real-time PCR ... The PCR cycling program consisted of an initial denaturing step at 95°C for 10 min, followed by 45 amplification cycles at 92°C for 10 s, 50°C for 10 s, and 72°C for 10 s. To prevent carry-over contamination, 1 U of uracil N glycosylase (Roche Diagnostics, Shanghai, China) was added to the master mix.

Article Title: Monitoring of Cytomegalovirus Viral Loads by Two Molecular Assays in Whole-Blood and Plasma Samples from Hematopoietic Stem Cell Transplant Recipients
Article Snippet: Paragraph title: LightCycler CMV real-time PCR assay. ... The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences).

Article Title: Evaluation of a novel real-time PCR test based on the ssrA gene for the identification of group B streptococci in vaginal swabs
Article Snippet: Paragraph title: RiboSEQ GBS real-time PCR test ... Each reaction contained reagents to final concentrations of: 5 mM MgCl2 , 0.5 μM each primer (Table ), 0.2 μM each hybridization probe (Table ), 0.5 U uracil-DNA glycosylase (Roche).

Article Title: Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River
Article Snippet: All qPCR runs included a negative control reaction (PCR-grade H2 O without template) and a positive control reaction. .. Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination.

Article Title: Mycobacterium avium subsp. Paratuberculosis and the expression of selected virulence and pathogenesis genes in response to 6?C, 65?c and ph 2.0
Article Snippet: Reverse transcription was performed at 42°C for 60 min. After RT, cDNA was purified using the MinElute qPCR Purification Kit (Qiagen, Germany) with final elution into 100 μl of TE buffer (Amresco, Solon, OH, USA). .. Real time qPCR mixes were made up to a final volume of 10 μl and contained 1 × of DyNAmo Probe qPCR Master Mix (Finnzyme, Finland), 0.1 U of Uracil DNA Glycosylase (Roche Molecular Diagnostic, Germany), 5 pmol of each forward and reverse primer, 0.5 pmol of each probe labelled with FAM and 1μl of appropriate cDNA. .. Primers and probes were designed using Primer3 software ( ) on a MAP K10 strain genomic sequence (GenBank AE016958) and synthesised by VBC Genomics, Austria ( ).

Article Title: Development of real-time PCR for detection of Mycoplasma hominis
Article Snippet: Paragraph title: Real-time PCR assay with hybridization probes ... Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions.

Article Title: Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay
Article Snippet: Paragraph title: Monoplex real-time PCR ... The reaction mix consisted of 10 × Taq buffer (including 50 mM Mg), 400 nM of each deoxynucleoside triphosphate, 500 nM of target primers, 200 nM of the target probe, 300 nM of IC primers, 100 nM of the IC probe, 0.01 U of Uracil-DNA Glycosylase (UNG, Roche Diagnostics, Mannheim, Germany) and 5 U of Taq DNA polymerase (5 PRIME, Hamburg, Germany).

Plasmid Purification:

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices
Article Snippet: Paragraph title: RT-qPCR for Detection and Quantification of MS2 PLP ... 1 U of Uracil DNA Glycosylase (Roche) was used in each qPCR reaction to avoid possible carry-over contamination. qPCR was performed using the Roche LightCycler 480 under the following reaction conditions: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 60°C for 30 s and 72°C for 10 s. The subsequent analysis of results (quantification) was carried out using the “Fit point analysis” option of the LightCycler 480 Software release 1.5.0 (version 1.5.0.39).

Incubation:

Article Title: Real-Time PCR Assay for Detection and Differentiation of Shiga Toxin-Producing Escherichia coli from Clinical Samples
Article Snippet: According to the EasyMAG manufacturer's instructions, 200 μl of incubated MAC broth was extracted, and DNA was eluted into 100 μl of elution buffer. .. Real-time PCR was performed with a final reaction volume of 40 μl containing iQ SYBR Green Supermix (2×), primers at a final concentration of 500 nM, uracil DNA glycosylase (Roche, Indianapolis, IN), and 4 μl of extracted DNA.

Article Title: Evaluation of a novel procedure for rapid detection of carbapenemase-producing Enterobacteriaceae (CPE) using the LightMix® modular carbapenemase kits
Article Snippet: After an overnight incubation at 37°C, DNA was extracted, by boiling for 30 min at 96°C. .. For each reaction, 15 μL reaction mixture consisted of 1 μL of PCR-grade water (Roche Probes Master Kit), 1 μL of Uracil-DNA Glycosylase (Roche Diagnostics), 0.5 μL of each reagent containing primers and probes (VIM, NDM, OXA-48, KPC and IMP), 0.5 μL of control reaction and 10 μL of Master (LC480 Probes Master, Roche Diagnostics).

Article Title: Exosomes Packaging APOBEC3G Confer Human Immunodeficiency Virus Resistance to Recipient Cells
Article Snippet: Fifty microliters of culture medium was collected daily for RT assay and replaced with fresh culture medium. .. Exosomes (20 μg protein) were suspended in 25 μl of deaminase buffer (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 2% glycerol, 0.1% Triton X-100) with a 5′-biotin-labeled oligonucleotide substrate (50 ng) and incubated at 37°C for 5 h. The reactions were terminated by heating the reaction mixtures to 90°C for 5 min followed by adding 25 μl of 60 mM Tris, pH 8.0, with 1 mM dithiothreitol and then incubating them with uracil DNA glycosylase (0.5 U; Roche Applied Science) for 30 min at 37°C. .. Subsequently, the samples were treated with 0.15 M NaOH (by adding 0.75 μl of 10 M NaOH) at 37°C for 30 min. Products were neutralized with 0.15 M HCl (by adding 0.7 μl concentrated HCl) and mixed with 2× gel loading buffer, and 40 μl of the mixture was separated on a 15% Tris-buffered EDTA-urea polyacrylamide gel, transferred to a zeta-probe membrane (Bio-Rad), and detected by chemiluminescence with streptavidin-horseradish peroxidase (1:50,000 dilution; Sigma).

Activity Assay:

Article Title: The Drosophila orthologue of progeroid human WRN exonuclease, DmWRNexo, cleaves replication substrates but is inhibited by uracil or abasic sites
Article Snippet: Figure S1 Generation of DNA substrates. a Integrity of oligonucleotides for DNA substrates was verified by running 60 pmol of each substrate post-annealing on 10% native PAGE (1× TBE, 10% 19:1 acrylamide/bis-acrylamide) and visualised using a Fuji FLA-3000 analyser. b To make abasic (AP) sites, oligonucleotides containing a single uracil residue (Table 1) were treated with uracil DNA glycosylase (Escherichia coli UDG, Roche) at 10 U/nmol DNA for 16 h at 37°C. .. AP-containing duplex substrates were then prepared by annealing to the FLO strand and analysed as above. c The existence of AP sites was confirmed by conversion of the AP sites to breaks by incubating with 50 mM KOH at 60°C for 30 min, with separation on 12% native PAGE with ethidium bromide.

Article Title: Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay
Article Snippet: The reaction mix consisted of 10 × Taq buffer (including 50 mM Mg), 400 nM of each deoxynucleoside triphosphate, 500 nM of target primers, 200 nM of the target probe, 300 nM of IC primers, 100 nM of the IC probe, 0.01 U of Uracil-DNA Glycosylase (UNG, Roche Diagnostics, Mannheim, Germany) and 5 U of Taq DNA polymerase (5 PRIME, Hamburg, Germany). .. The reaction mix consisted of 10 × Taq buffer (including 50 mM Mg), 400 nM of each deoxynucleoside triphosphate, 500 nM of target primers, 200 nM of the target probe, 300 nM of IC primers, 100 nM of the IC probe, 0.01 U of Uracil-DNA Glycosylase (UNG, Roche Diagnostics, Mannheim, Germany) and 5 U of Taq DNA polymerase (5 PRIME, Hamburg, Germany).

Article Title: Exosomes Packaging APOBEC3G Confer Human Immunodeficiency Virus Resistance to Recipient Cells
Article Snippet: Paragraph title: Exosome deaminase activity assay. ... Exosomes (20 μg protein) were suspended in 25 μl of deaminase buffer (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 2% glycerol, 0.1% Triton X-100) with a 5′-biotin-labeled oligonucleotide substrate (50 ng) and incubated at 37°C for 5 h. The reactions were terminated by heating the reaction mixtures to 90°C for 5 min followed by adding 25 μl of 60 mM Tris, pH 8.0, with 1 mM dithiothreitol and then incubating them with uracil DNA glycosylase (0.5 U; Roche Applied Science) for 30 min at 37°C.

In Silico:

Article Title: Evaluation of a novel real-time PCR test based on the ssrA gene for the identification of group B streptococci in vaginal swabs
Article Snippet: BLAST (Basic Local Alignment Search Tool) analysis of the hybridization probe sequences was performed to confirm in silico specificity of the probes for the detection of GBS. .. Each reaction contained reagents to final concentrations of: 5 mM MgCl2 , 0.5 μM each primer (Table ), 0.2 μM each hybridization probe (Table ), 0.5 U uracil-DNA glycosylase (Roche).

Expressing:

Article Title: G6PC2 Modulates the Effects of Dexamethasone on Fasting Blood Glucose and Glucose Tolerance
Article Snippet: Gene expression was quantitated using real-time PCR. .. Tissue culture cell, pancreatic, and liver gene expression were quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the deoxyuridine triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-Glycosylase (Roche). .. Islet gene expression was quantitated using the primer-probe TaqMan approach from Life Technologies as described ( ).

Article Title: G6PC2 Modulates Fasting Blood Glucose In Male Mice in Response to Stress
Article Snippet: Gene expression was quantitated using real-time PCR. .. Pancreatic gene expression was quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the 2′-deoxyuridine 5′-triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-glycosylase (Roche). .. Islet gene expression was quantitated using the primer-probe TaqMan approach from Life Technologies as described ( ).

Article Title: Osteopontin inhibits HIF-2α mRNA expression in osteoarthritic chondrocytes
Article Snippet: The PCR thermal conditions were as follows: 50°C uracil-DNA glycosylase (UDG; Roche Diagnostics, Basel, Switzerland) pretreatment for 2 min, 1 cycle at 95°C for 10 min for initial denaturation, 40 repeats of a 15 sec 95°C denaturation step, a 30 sec 30°C annealing step and a 30 sec extension step at 72°C. .. The PCR thermal conditions were as follows: 50°C uracil-DNA glycosylase (UDG; Roche Diagnostics, Basel, Switzerland) pretreatment for 2 min, 1 cycle at 95°C for 10 min for initial denaturation, 40 repeats of a 15 sec 95°C denaturation step, a 30 sec 30°C annealing step and a 30 sec extension step at 72°C.

Hybridization:

Article Title: Peripheral Blood Mononuclear Cell Traffic Plays a Crucial Role in Mother-to-Infant Transmission of Hepatitis B Virus
Article Snippet: For PCR, 4 mM MgCl2 , 4 pmol of each hybridization probe, 20 pmol of the two PCR primers, 2 μL of LightCycler Fast Start DNA Master Hybridization probe mix (Roche Diagnostics) and 10 μL of HBV DNA samples were used. .. The PCR cycling program consisted of an initial denaturing step at 95°C for 10 min, followed by 45 amplification cycles at 92°C for 10 s, 50°C for 10 s, and 72°C for 10 s. To prevent carry-over contamination, 1 U of uracil N glycosylase (Roche Diagnostics, Shanghai, China) was added to the master mix.

Article Title: Monitoring of Cytomegalovirus Viral Loads by Two Molecular Assays in Whole-Blood and Plasma Samples from Hematopoietic Stem Cell Transplant Recipients
Article Snippet: The primers and fluorescence resonance energy transfer (FRET) hybridization probes were analyte-specific reagents (ASR) from Roche Molecular Diagnostics targeting the UL54 gene. .. The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences). .. The total volume per reaction mixture was 20 μl (15 μl of master mix plus 5 μl of extracted nucleic acid).

Article Title: Evaluation of a novel real-time PCR test based on the ssrA gene for the identification of group B streptococci in vaginal swabs
Article Snippet: Real-time PCR was performed in a 20 μl reaction volume on the LightCycler® instrument using the "LightCycler® FastStart DNA Master HybProbe" kit (Roche Diagnostics, Mannheim, Germany). .. Each reaction contained reagents to final concentrations of: 5 mM MgCl2 , 0.5 μM each primer (Table ), 0.2 μM each hybridization probe (Table ), 0.5 U uracil-DNA glycosylase (Roche). .. Template was added in 2 μl volumes and IAC was added as 100 recombinant plasmid copies per reaction.

Article Title: Development of real-time PCR for detection of Mycoplasma hominis
Article Snippet: Paragraph title: Real-time PCR assay with hybridization probes ... Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions.

Article Title: Four-Color Alternating-Laser Excitation Single-Molecule Fluorescence Spectroscopy for Next-Generation Biodetection Assays
Article Snippet: Oligo 7 software (Molecular Biology Insights) was used to design both PCR primers and hybridization FRET probe pairs (see ). .. Uracil-DNA glycosylase and dUTP (Roche Applied Science) were used to eliminate the potential for PCR carryover contamination.

Article Title: Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay
Article Snippet: The reaction mix consisted of 10 × Taq buffer (including 50 mM Mg), 400 nM of each deoxynucleoside triphosphate, 500 nM of target primers, 200 nM of the target probe, 300 nM of IC primers, 100 nM of the IC probe, 0.01 U of Uracil-DNA Glycosylase (UNG, Roche Diagnostics, Mannheim, Germany) and 5 U of Taq DNA polymerase (5 PRIME, Hamburg, Germany). .. The Legionella pneumophila PCR was carried out in glass capillaries containing 15 μl reaction mix and 5 μl DNA extract.

Countercurrent Chromatography:

Article Title: Exosomes Packaging APOBEC3G Confer Human Immunodeficiency Virus Resistance to Recipient Cells
Article Snippet: Exosomes (20 μg protein) were suspended in 25 μl of deaminase buffer (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 2% glycerol, 0.1% Triton X-100) with a 5′-biotin-labeled oligonucleotide substrate (50 ng) and incubated at 37°C for 5 h. The reactions were terminated by heating the reaction mixtures to 90°C for 5 min followed by adding 25 μl of 60 mM Tris, pH 8.0, with 1 mM dithiothreitol and then incubating them with uracil DNA glycosylase (0.5 U; Roche Applied Science) for 30 min at 37°C. .. Exosomes (20 μg protein) were suspended in 25 μl of deaminase buffer (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 2% glycerol, 0.1% Triton X-100) with a 5′-biotin-labeled oligonucleotide substrate (50 ng) and incubated at 37°C for 5 h. The reactions were terminated by heating the reaction mixtures to 90°C for 5 min followed by adding 25 μl of 60 mM Tris, pH 8.0, with 1 mM dithiothreitol and then incubating them with uracil DNA glycosylase (0.5 U; Roche Applied Science) for 30 min at 37°C.

Serial Dilution:

Article Title: Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River
Article Snippet: Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination. .. Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination.

Transferring:

Article Title: Development of real-time PCR for detection of Mycoplasma hominis
Article Snippet: The DNA template from M. hominis PG21 was added by use of filter pipette tips. .. Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions.

Förster Resonance Energy Transfer:

Article Title: Monitoring of Cytomegalovirus Viral Loads by Two Molecular Assays in Whole-Blood and Plasma Samples from Hematopoietic Stem Cell Transplant Recipients
Article Snippet: The primers and fluorescence resonance energy transfer (FRET) hybridization probes were analyte-specific reagents (ASR) from Roche Molecular Diagnostics targeting the UL54 gene. .. The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences).

Generated:

Article Title: A deep vein thrombosis caused by 20209C > T mutation in homozygosis of the prothrombin gene in a Caucasian patient
Article Snippet: Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations. .. Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations.

Article Title: Monitoring of Cytomegalovirus Viral Loads by Two Molecular Assays in Whole-Blood and Plasma Samples from Hematopoietic Stem Cell Transplant Recipients
Article Snippet: The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences). .. PCR amplification with real-time detection was performed using the following cycling parameters: 1 template-denaturing cycle at 95°C for 10 min, followed by 45 amplification cycles at 95°C for 10 s, 55°C for 15 s, and 72°C for 15 s. Following amplification, a melting curve analysis was performed by measuring the fluorescent signal during the following cycling parameters: 95°C for 0 s, 40°C for 60 s, and 85°C for 0 s, with a transition of 0.1°C/s.

Article Title: Evaluation of a novel real-time PCR test based on the ssrA gene for the identification of group B streptococci in vaginal swabs
Article Snippet: The ssrA genes of 10 GBS strains which represent 7 serotypes including the 5 most commonly occurring serotypes (Ia, Ib, II, III, V) were sequenced (Sequiserve, Vaterstetten, Germany) and aligned with other related streptococci (Table ) ssrA sequences generated in this study or available on the tmRNA website [ ]. .. Each reaction contained reagents to final concentrations of: 5 mM MgCl2 , 0.5 μM each primer (Table ), 0.2 μM each hybridization probe (Table ), 0.5 U uracil-DNA glycosylase (Roche).

other:

Article Title: Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA
Article Snippet: Germany), 5 mM MgCl2 , 0.5 μM primer hbv305 (sense) 5'-GCCAAAATTCGCAGTCCC-3', 0.5 μM primer hbv460 (antisense) 5'-GATAGTCCAGAAGAACCAACAAGAAG-3', 0.4 μM molecular beacon 5'-CGCGCGATGAGGCATAGCAGCAGGATGAAGAACGCGCG-3' labelled with FAM and Dabcyl at the 5' and 3' ends, respectively, Taq DNA polymerase, dNTP mix (with dUTP instead of dTTP), and 1 U of uracil-DNA glycosylase (Roche Applied Science.

Negative Control:

Article Title: Real-Time PCR Assay for Detection and Differentiation of Shiga Toxin-Producing Escherichia coli from Clinical Samples
Article Snippet: O157 positive-control broth (positive for all targets) at high and low concentrations (500 and 50 copies/reaction, respectively) and a negative-control broth extraction sample were extracted in each batch run along with MAC enrichment broth containing patient samples. .. Real-time PCR was performed with a final reaction volume of 40 μl containing iQ SYBR Green Supermix (2×), primers at a final concentration of 500 nM, uracil DNA glycosylase (Roche, Indianapolis, IN), and 4 μl of extracted DNA.

Article Title: Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River
Article Snippet: All qPCR runs included a negative control reaction (PCR-grade H2 O without template) and a positive control reaction. .. Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination.

Article Title: Development of real-time PCR for detection of Mycoplasma hominis
Article Snippet: Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions. .. Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions.

Article Title: Evaluation of a novel procedure for rapid detection of carbapenemase-producing Enterobacteriaceae (CPE) using the LightMix® modular carbapenemase kits
Article Snippet: For each reaction, 15 μL reaction mixture consisted of 1 μL of PCR-grade water (Roche Probes Master Kit), 1 μL of Uracil-DNA Glycosylase (Roche Diagnostics), 0.5 μL of each reagent containing primers and probes (VIM, NDM, OXA-48, KPC and IMP), 0.5 μL of control reaction and 10 μL of Master (LC480 Probes Master, Roche Diagnostics). .. For each reaction, 15 μL reaction mixture consisted of 1 μL of PCR-grade water (Roche Probes Master Kit), 1 μL of Uracil-DNA Glycosylase (Roche Diagnostics), 0.5 μL of each reagent containing primers and probes (VIM, NDM, OXA-48, KPC and IMP), 0.5 μL of control reaction and 10 μL of Master (LC480 Probes Master, Roche Diagnostics).

Article Title: Exosomes Packaging APOBEC3G Confer Human Immunodeficiency Virus Resistance to Recipient Cells
Article Snippet: Exosomes (20 μg protein) were suspended in 25 μl of deaminase buffer (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 2% glycerol, 0.1% Triton X-100) with a 5′-biotin-labeled oligonucleotide substrate (50 ng) and incubated at 37°C for 5 h. The reactions were terminated by heating the reaction mixtures to 90°C for 5 min followed by adding 25 μl of 60 mM Tris, pH 8.0, with 1 mM dithiothreitol and then incubating them with uracil DNA glycosylase (0.5 U; Roche Applied Science) for 30 min at 37°C. .. Exosomes (20 μg protein) were suspended in 25 μl of deaminase buffer (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 2% glycerol, 0.1% Triton X-100) with a 5′-biotin-labeled oligonucleotide substrate (50 ng) and incubated at 37°C for 5 h. The reactions were terminated by heating the reaction mixtures to 90°C for 5 min followed by adding 25 μl of 60 mM Tris, pH 8.0, with 1 mM dithiothreitol and then incubating them with uracil DNA glycosylase (0.5 U; Roche Applied Science) for 30 min at 37°C.

Protein Concentration:

Article Title: The Drosophila orthologue of progeroid human WRN exonuclease, DmWRNexo, cleaves replication substrates but is inhibited by uracil or abasic sites
Article Snippet: Figure S1 Generation of DNA substrates. a Integrity of oligonucleotides for DNA substrates was verified by running 60 pmol of each substrate post-annealing on 10% native PAGE (1× TBE, 10% 19:1 acrylamide/bis-acrylamide) and visualised using a Fuji FLA-3000 analyser. b To make abasic (AP) sites, oligonucleotides containing a single uracil residue (Table 1) were treated with uracil DNA glycosylase (Escherichia coli UDG, Roche) at 10 U/nmol DNA for 16 h at 37°C. .. AP-containing duplex substrates were then prepared by annealing to the FLO strand and analysed as above. c The existence of AP sites was confirmed by conversion of the AP sites to breaks by incubating with 50 mM KOH at 60°C for 30 min, with separation on 12% native PAGE with ethidium bromide.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay
Article Snippet: The reaction mix consisted of 2 × Invitrogen rnx-reaction mix (including 50 mM MgSO4 ), 400 nM of target primers, 100 nM of the target probe, 200 nM of IC primers, 100 nM of the IC probe and 5 U of Invitrogen SuperScript Platinum Taq -enzym mix (SuperScript III One-Step RT-PCR with Platinum-Taq, Invitrogen, Darmstadt, Germany). .. The reaction mix consisted of 10 × Taq buffer (including 50 mM Mg), 400 nM of each deoxynucleoside triphosphate, 500 nM of target primers, 200 nM of the target probe, 300 nM of IC primers, 100 nM of the IC probe, 0.01 U of Uracil-DNA Glycosylase (UNG, Roche Diagnostics, Mannheim, Germany) and 5 U of Taq DNA polymerase (5 PRIME, Hamburg, Germany).

Cellular Antioxidant Activity Assay:

Article Title: Osteopontin inhibits HIF-2α mRNA expression in osteoarthritic chondrocytes
Article Snippet: The sequences of the primers are as follows: OPN forward: 5′-GTGGGA AGG ACA GTT ATG AA-3′ and reverse: 5′-CTG ACT TTG GAA AGT TCC TG-3′; HIF-2α forward: 5′-GTG ACA TGA TCT TTC TGT CGG AA-3′ and reverse: 5′-CGC AAG GAT GAG TGA AGT CAAA-3′; GAPDH forward: 5′-TGA CTT CAA CAG CGA CAC CCA-3′ and reverse: 5′-CAC CCT GTT GCT GTA GCC AAA-3′. .. The PCR thermal conditions were as follows: 50°C uracil-DNA glycosylase (UDG; Roche Diagnostics, Basel, Switzerland) pretreatment for 2 min, 1 cycle at 95°C for 10 min for initial denaturation, 40 repeats of a 15 sec 95°C denaturation step, a 30 sec 30°C annealing step and a 30 sec extension step at 72°C.

DNA Extraction:

Article Title: Four-Color Alternating-Laser Excitation Single-Molecule Fluorescence Spectroscopy for Next-Generation Biodetection Assays
Article Snippet: Human genomic DNA, which was added as background to PCRs at 2.5 μ g per reaction to mimic clinical samples after DNA extraction from blood, was purchased from Roche Applied Science. .. Uracil-DNA glycosylase and dUTP (Roche Applied Science) were used to eliminate the potential for PCR carryover contamination.

Nucleic Acid Electrophoresis:

Article Title: Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River
Article Snippet: Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination. .. Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination.

Fluorescence:

Article Title: A deep vein thrombosis caused by 20209C > T mutation in homozygosis of the prothrombin gene in a Caucasian patient
Article Snippet: Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations. .. Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations.

Article Title: Monitoring of Cytomegalovirus Viral Loads by Two Molecular Assays in Whole-Blood and Plasma Samples from Hematopoietic Stem Cell Transplant Recipients
Article Snippet: The primers and fluorescence resonance energy transfer (FRET) hybridization probes were analyte-specific reagents (ASR) from Roche Molecular Diagnostics targeting the UL54 gene. .. The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences).

Article Title: Mycobacterium avium subsp. Paratuberculosis and the expression of selected virulence and pathogenesis genes in response to 6?C, 65?c and ph 2.0
Article Snippet: Real time qPCR mixes were made up to a final volume of 10 μl and contained 1 × of DyNAmo Probe qPCR Master Mix (Finnzyme, Finland), 0.1 U of Uracil DNA Glycosylase (Roche Molecular Diagnostic, Germany), 5 pmol of each forward and reverse primer, 0.5 pmol of each probe labelled with FAM and 1μl of appropriate cDNA. .. Primers and probes were designed using Primer3 software ( ) on a MAP K10 strain genomic sequence (GenBank AE016958) and synthesised by VBC Genomics, Austria ( ).

Article Title: Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay
Article Snippet: PCR was performed on the RotorGene Q system (Qiagen, Hilden, Germany) with a reverse transcription at 50°C for 15 min, preliminary denaturation at 95°C for 10 min, followed by 45 cycles of denaturation of 95°C for 15 s, annealing and extension at 60°C for 45 s, with a single fluorescence acquisition step at the end of the annealing step. .. The reaction mix consisted of 10 × Taq buffer (including 50 mM Mg), 400 nM of each deoxynucleoside triphosphate, 500 nM of target primers, 200 nM of the target probe, 300 nM of IC primers, 100 nM of the IC probe, 0.01 U of Uracil-DNA Glycosylase (UNG, Roche Diagnostics, Mannheim, Germany) and 5 U of Taq DNA polymerase (5 PRIME, Hamburg, Germany).

Mutagenesis:

Article Title: A deep vein thrombosis caused by 20209C > T mutation in homozygosis of the prothrombin gene in a Caucasian patient
Article Snippet: The blood sample was analyzed with The Xpert® HemosIL® Factor II & Factor V Assay (Cepheid/Instrumentation Laboratory), which is a qualitative in vitro diagnostic genotyping test for the detection of Factor II (20210G > A mutation) and Factor V (1691G > A mutation) alleles from sodium citrate or EDTA anticoagulated whole blood. .. Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations.

Isolation:

Article Title: G6PC2 Modulates the Effects of Dexamethasone on Fasting Blood Glucose and Glucose Tolerance
Article Snippet: Gene expression was quantitated using real-time PCR. .. Tissue culture cell, pancreatic, and liver gene expression were quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the deoxyuridine triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-Glycosylase (Roche). .. Islet gene expression was quantitated using the primer-probe TaqMan approach from Life Technologies as described ( ).

Article Title: G6PC2 Modulates Fasting Blood Glucose In Male Mice in Response to Stress
Article Snippet: Gene expression was quantitated using real-time PCR. .. Pancreatic gene expression was quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the 2′-deoxyuridine 5′-triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-glycosylase (Roche). .. Islet gene expression was quantitated using the primer-probe TaqMan approach from Life Technologies as described ( ).

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices
Article Snippet: The RT mixture (20 μl) contained 0.5 nmol of dNTP mix (Serva, Heidelberg, Germany), 20,000 molecules of IAC RNA, 2 pmol of both reverse primers (TM R and NP R; Table ), 4 μl of PrimeScript reaction buffer, 5 U of reverse transcriptase, 1 U of RNase inhibitor (NEB) and 5 μl of isolated RNA. .. 1 U of Uracil DNA Glycosylase (Roche) was used in each qPCR reaction to avoid possible carry-over contamination. qPCR was performed using the Roche LightCycler 480 under the following reaction conditions: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 60°C for 30 s and 72°C for 10 s. The subsequent analysis of results (quantification) was carried out using the “Fit point analysis” option of the LightCycler 480 Software release 1.5.0 (version 1.5.0.39).

Article Title: Monitoring of Cytomegalovirus Viral Loads by Two Molecular Assays in Whole-Blood and Plasma Samples from Hematopoietic Stem Cell Transplant Recipients
Article Snippet: Two hundred microliters of whole-blood specimens collected in EDTA tubes was extracted on the MagNA Pure instrument (Roche Diagnostics, Indianapolis, IN) using the total nucleic acid isolation kit (Roche), the total NA_Serum_Plasma program, and a final elution volume of 100 μl. .. The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences).

Polymerase Chain Reaction:

Article Title: G6PC2 Modulates the Effects of Dexamethasone on Fasting Blood Glucose and Glucose Tolerance
Article Snippet: Gene expression was quantitated using real-time PCR. .. Tissue culture cell, pancreatic, and liver gene expression were quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the deoxyuridine triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-Glycosylase (Roche). .. Islet gene expression was quantitated using the primer-probe TaqMan approach from Life Technologies as described ( ).

Article Title: Molecular Genealogy of a Mongol Queen’s Family and Her Possible Kinship with Genghis Khan
Article Snippet: Mock extractions without samples and PCR blanks were used to carefully monitor contaminations of aDNA from researchers and other organisms throughout the experiment. .. A 10-μL aliquot of each aDNA extract was treated with 1 U of uracil-DNA glycosylase (UDG; Roche Diagnostics Co., Indianapolis, IN, USA) before PCR amplification, while another aliquot was treated with 1 U of UDG that was first heat-inactivated at 95°C for 10 min. .. The aDNA treated with active or inactive UDG was cloned into the TA cloning vector provided in the pGEM-T Easy Vector System I TA cloning kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions.

Article Title: G6PC2 Modulates Fasting Blood Glucose In Male Mice in Response to Stress
Article Snippet: Gene expression was quantitated using real-time PCR. .. Pancreatic gene expression was quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the 2′-deoxyuridine 5′-triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-glycosylase (Roche). .. Islet gene expression was quantitated using the primer-probe TaqMan approach from Life Technologies as described ( ).

Article Title: A deep vein thrombosis caused by 20209C > T mutation in homozygosis of the prothrombin gene in a Caucasian patient
Article Snippet: The hot start effect of FastStart Taq DNA polymerase minimizes the formation of non-specific products and improves sensitivity for the desired target. .. Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations. .. Fluorescence protocols PCR was performed with 0.2 Mm primers in a standard PCR reaction, supplemented.

Article Title: Osteopontin inhibits HIF-2α mRNA expression in osteoarthritic chondrocytes
Article Snippet: The TP800 Thermal Cycler Dice Real Time system (Takara Bio, Inc., Otsu, Japan) was used for all qPCR. .. The PCR thermal conditions were as follows: 50°C uracil-DNA glycosylase (UDG; Roche Diagnostics, Basel, Switzerland) pretreatment for 2 min, 1 cycle at 95°C for 10 min for initial denaturation, 40 repeats of a 15 sec 95°C denaturation step, a 30 sec 30°C annealing step and a 30 sec extension step at 72°C. .. A melting curve was constructed following the final amplification period via a temperature gradient from 95°C for 15 sec, 55°C for 30 sec and 95°C for 15 sec.

Article Title: Real-Time PCR Assay for Detection and Differentiation of Shiga Toxin-Producing Escherichia coli from Clinical Samples
Article Snippet: The PCR primers and probes used for the multitarget detection of STEC are listed in Table S1 in the supplemental material. .. Real-time PCR was performed with a final reaction volume of 40 μl containing iQ SYBR Green Supermix (2×), primers at a final concentration of 500 nM, uracil DNA glycosylase (Roche, Indianapolis, IN), and 4 μl of extracted DNA.

Article Title: Peripheral Blood Mononuclear Cell Traffic Plays a Crucial Role in Mother-to-Infant Transmission of Hepatitis B Virus
Article Snippet: For PCR, 4 mM MgCl2 , 4 pmol of each hybridization probe, 20 pmol of the two PCR primers, 2 μL of LightCycler Fast Start DNA Master Hybridization probe mix (Roche Diagnostics) and 10 μL of HBV DNA samples were used. .. The PCR cycling program consisted of an initial denaturing step at 95°C for 10 min, followed by 45 amplification cycles at 92°C for 10 s, 50°C for 10 s, and 72°C for 10 s. To prevent carry-over contamination, 1 U of uracil N glycosylase (Roche Diagnostics, Shanghai, China) was added to the master mix. .. Plasma containing 4.4 ×109 HBV DNA copies/mL (HBV DNA Quantiplex assay, Chiron) was serially diluted to generate a standard curve.

Article Title: Monitoring of Cytomegalovirus Viral Loads by Two Molecular Assays in Whole-Blood and Plasma Samples from Hematopoietic Stem Cell Transplant Recipients
Article Snippet: The primers and fluorescence resonance energy transfer (FRET) hybridization probes were analyte-specific reagents (ASR) from Roche Molecular Diagnostics targeting the UL54 gene. .. The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences). .. The total volume per reaction mixture was 20 μl (15 μl of master mix plus 5 μl of extracted nucleic acid).

Article Title: Evaluation of a novel real-time PCR test based on the ssrA gene for the identification of group B streptococci in vaginal swabs
Article Snippet: From these alignments, oligonucleotide primers gbsU3F and gbsU4R were designed to amplify a 293 bp PCR product from the GBS ssrA gene. .. Each reaction contained reagents to final concentrations of: 5 mM MgCl2 , 0.5 μM each primer (Table ), 0.2 μM each hybridization probe (Table ), 0.5 U uracil-DNA glycosylase (Roche).

Article Title: Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River
Article Snippet: All qPCR runs included a negative control reaction (PCR-grade H2 O without template) and a positive control reaction. .. Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination.

Article Title: Development of real-time PCR for detection of Mycoplasma hominis
Article Snippet: The DNA template from M. hominis PG21 was added by use of filter pipette tips. .. Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions. .. Reaction mixes contained dUTPs instead of dTTPs, and therefore it was possible to avoid contamination of samples by adding an enzyme that hydrolyzes uracil-glycosidic bonds at U-DNA in single and double-strained DNA [ ].

Article Title: Evaluation of a novel procedure for rapid detection of carbapenemase-producing Enterobacteriaceae (CPE) using the LightMix® modular carbapenemase kits
Article Snippet: Reactions were performed in a LightCycler® Multiwell Plate 96 (Roche Diagnostics). .. For each reaction, 15 μL reaction mixture consisted of 1 μL of PCR-grade water (Roche Probes Master Kit), 1 μL of Uracil-DNA Glycosylase (Roche Diagnostics), 0.5 μL of each reagent containing primers and probes (VIM, NDM, OXA-48, KPC and IMP), 0.5 μL of control reaction and 10 μL of Master (LC480 Probes Master, Roche Diagnostics). .. The protocol consists of three steps: denaturation at 95°C for 5 min, then cycling for 45 cycles of 95°C for 5 s, 60°C for 15 s and 72°C for 15 s, and finally cooling at 40°C for 30 s. The multiplex PCR was completed in < 90 min. For reading results, the analysis was performed using the second derivative maximum method with colour compensation.

Article Title: Four-Color Alternating-Laser Excitation Single-Molecule Fluorescence Spectroscopy for Next-Generation Biodetection Assays
Article Snippet: PCR primers were synthesized by Integrated DNA Technologies. .. Uracil-DNA glycosylase and dUTP (Roche Applied Science) were used to eliminate the potential for PCR carryover contamination. .. AmpliTaq Gold® 360 DNA polymerase (Applied Biosystems) was used for amplification.

Article Title: Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay
Article Snippet: PCR was performed on the RotorGene Q system (Qiagen, Hilden, Germany) with a reverse transcription at 50°C for 15 min, preliminary denaturation at 95°C for 10 min, followed by 45 cycles of denaturation of 95°C for 15 s, annealing and extension at 60°C for 45 s, with a single fluorescence acquisition step at the end of the annealing step. .. The reaction mix consisted of 10 × Taq buffer (including 50 mM Mg), 400 nM of each deoxynucleoside triphosphate, 500 nM of target primers, 200 nM of the target probe, 300 nM of IC primers, 100 nM of the IC probe, 0.01 U of Uracil-DNA Glycosylase (UNG, Roche Diagnostics, Mannheim, Germany) and 5 U of Taq DNA polymerase (5 PRIME, Hamburg, Germany).

Size-exclusion Chromatography:

Article Title: Osteopontin inhibits HIF-2α mRNA expression in osteoarthritic chondrocytes
Article Snippet: The TP800 Thermal Cycler Dice Real Time system (Takara Bio, Inc., Otsu, Japan) was used for all qPCR. .. The PCR thermal conditions were as follows: 50°C uracil-DNA glycosylase (UDG; Roche Diagnostics, Basel, Switzerland) pretreatment for 2 min, 1 cycle at 95°C for 10 min for initial denaturation, 40 repeats of a 15 sec 95°C denaturation step, a 30 sec 30°C annealing step and a 30 sec extension step at 72°C. .. A melting curve was constructed following the final amplification period via a temperature gradient from 95°C for 15 sec, 55°C for 30 sec and 95°C for 15 sec.

Labeling:

Article Title: Peripheral Blood Mononuclear Cell Traffic Plays a Crucial Role in Mother-to-Infant Transmission of Hepatitis B Virus
Article Snippet: The other probe, HBVFL, [5'-GA(G/C)GCAGGTCCCCTAGAAGAAGAA (2361-2384)], was labeled with fluorescein at the 3' end. .. The PCR cycling program consisted of an initial denaturing step at 95°C for 10 min, followed by 45 amplification cycles at 92°C for 10 s, 50°C for 10 s, and 72°C for 10 s. To prevent carry-over contamination, 1 U of uracil N glycosylase (Roche Diagnostics, Shanghai, China) was added to the master mix.

Purification:

Article Title: A deep vein thrombosis caused by 20209C > T mutation in homozygosis of the prothrombin gene in a Caucasian patient
Article Snippet: The GeneXpert Dx System automates and integrates sample purification, nucleic acid amplification, and detection of the target sequence in whole blood using real-time PCR assays. .. Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations.

Article Title: Four-Color Alternating-Laser Excitation Single-Molecule Fluorescence Spectroscopy for Next-Generation Biodetection Assays
Article Snippet: Purified bacterial genomic DNAs were quantified with Quant-iT™ PicoGreen® dsDNA Reagent and Kits (Invitrogen), and genomic equivalents (GE) were calculated before PCR amplification. .. Uracil-DNA glycosylase and dUTP (Roche Applied Science) were used to eliminate the potential for PCR carryover contamination.

Sequencing:

Article Title: Molecular Genealogy of a Mongol Queen’s Family and Her Possible Kinship with Genghis Khan
Article Snippet: A 10-μL aliquot of each aDNA extract was treated with 1 U of uracil-DNA glycosylase (UDG; Roche Diagnostics Co., Indianapolis, IN, USA) before PCR amplification, while another aliquot was treated with 1 U of UDG that was first heat-inactivated at 95°C for 10 min. .. DNA sequences were then analyzed in at least 4 and 5 clones for each sample from active UDG and inactive UDG samples, respectively.

Article Title: A deep vein thrombosis caused by 20209C > T mutation in homozygosis of the prothrombin gene in a Caucasian patient
Article Snippet: The GeneXpert Dx System automates and integrates sample purification, nucleic acid amplification, and detection of the target sequence in whole blood using real-time PCR assays. .. Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations.

Article Title: Exosomes Packaging APOBEC3G Confer Human Immunodeficiency Virus Resistance to Recipient Cells
Article Snippet: Exosomes (20 μg protein) were suspended in 25 μl of deaminase buffer (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 2% glycerol, 0.1% Triton X-100) with a 5′-biotin-labeled oligonucleotide substrate (50 ng) and incubated at 37°C for 5 h. The reactions were terminated by heating the reaction mixtures to 90°C for 5 min followed by adding 25 μl of 60 mM Tris, pH 8.0, with 1 mM dithiothreitol and then incubating them with uracil DNA glycosylase (0.5 U; Roche Applied Science) for 30 min at 37°C. .. Exosomes (20 μg protein) were suspended in 25 μl of deaminase buffer (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 2% glycerol, 0.1% Triton X-100) with a 5′-biotin-labeled oligonucleotide substrate (50 ng) and incubated at 37°C for 5 h. The reactions were terminated by heating the reaction mixtures to 90°C for 5 min followed by adding 25 μl of 60 mM Tris, pH 8.0, with 1 mM dithiothreitol and then incubating them with uracil DNA glycosylase (0.5 U; Roche Applied Science) for 30 min at 37°C.

Polyacrylamide Gel Electrophoresis:

Article Title: The Drosophila orthologue of progeroid human WRN exonuclease, DmWRNexo, cleaves replication substrates but is inhibited by uracil or abasic sites
Article Snippet: Figure S1 Generation of DNA substrates. a Integrity of oligonucleotides for DNA substrates was verified by running 60 pmol of each substrate post-annealing on 10% native PAGE (1× TBE, 10% 19:1 acrylamide/bis-acrylamide) and visualised using a Fuji FLA-3000 analyser. b To make abasic (AP) sites, oligonucleotides containing a single uracil residue (Table 1) were treated with uracil DNA glycosylase (Escherichia coli UDG, Roche) at 10 U/nmol DNA for 16 h at 37°C. .. Ds double stranded, c cut with uracil DNA glycosylase, uc uncut. (TIFF 150 kb) (JPEG 13 kb) High Resolution Image 1 (TIFF 150 kb) Figure S2 Quantification of nuclease activity. a Effect of increasing DmWRNexo protein concentration on degradation of ss and duplex product (n = 3, ±SEM).

IA:

Article Title: Evaluation of a novel real-time PCR test based on the ssrA gene for the identification of group B streptococci in vaginal swabs
Article Snippet: The ssrA genes of 10 GBS strains which represent 7 serotypes including the 5 most commonly occurring serotypes (Ia, Ib, II, III, V) were sequenced (Sequiserve, Vaterstetten, Germany) and aligned with other related streptococci (Table ) ssrA sequences generated in this study or available on the tmRNA website [ ]. .. Each reaction contained reagents to final concentrations of: 5 mM MgCl2 , 0.5 μM each primer (Table ), 0.2 μM each hybridization probe (Table ), 0.5 U uracil-DNA glycosylase (Roche).

Activated Clotting Time Assay:

Article Title: Osteopontin inhibits HIF-2α mRNA expression in osteoarthritic chondrocytes
Article Snippet: The sequences of the primers are as follows: OPN forward: 5′-GTGGGA AGG ACA GTT ATG AA-3′ and reverse: 5′-CTG ACT TTG GAA AGT TCC TG-3′; HIF-2α forward: 5′-GTG ACA TGA TCT TTC TGT CGG AA-3′ and reverse: 5′-CGC AAG GAT GAG TGA AGT CAAA-3′; GAPDH forward: 5′-TGA CTT CAA CAG CGA CAC CCA-3′ and reverse: 5′-CAC CCT GTT GCT GTA GCC AAA-3′. .. The PCR thermal conditions were as follows: 50°C uracil-DNA glycosylase (UDG; Roche Diagnostics, Basel, Switzerland) pretreatment for 2 min, 1 cycle at 95°C for 10 min for initial denaturation, 40 repeats of a 15 sec 95°C denaturation step, a 30 sec 30°C annealing step and a 30 sec extension step at 72°C.

Liquid Chromatography:

Article Title: Peripheral Blood Mononuclear Cell Traffic Plays a Crucial Role in Mother-to-Infant Transmission of Hepatitis B Virus
Article Snippet: One probe, HBVLC, [5'-TCCCTCGCCTGCCAGACG(A/C)AG(A/G)TCTC (2386-2411)], was labeled at the 5' end with a Light Cycler red fluorophore (LC 640) and phosphorylated at the 3' end. .. The PCR cycling program consisted of an initial denaturing step at 95°C for 10 min, followed by 45 amplification cycles at 92°C for 10 s, 50°C for 10 s, and 72°C for 10 s. To prevent carry-over contamination, 1 U of uracil N glycosylase (Roche Diagnostics, Shanghai, China) was added to the master mix.

Article Title: Monitoring of Cytomegalovirus Viral Loads by Two Molecular Assays in Whole-Blood and Plasma Samples from Hematopoietic Stem Cell Transplant Recipients
Article Snippet: The primers and fluorescence resonance energy transfer (FRET) hybridization probes were analyte-specific reagents (ASR) from Roche Molecular Diagnostics targeting the UL54 gene. .. The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences). .. The total volume per reaction mixture was 20 μl (15 μl of master mix plus 5 μl of extracted nucleic acid).

Article Title: Development of real-time PCR for detection of Mycoplasma hominis
Article Snippet: Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions. .. As negative control a sample containing all reagents except DNA was used in every PCR run.

Plasmid Preparation:

Article Title: Monitoring of Cytomegalovirus Viral Loads by Two Molecular Assays in Whole-Blood and Plasma Samples from Hematopoietic Stem Cell Transplant Recipients
Article Snippet: The PCR assay was performed using the LC FastStart DNA master hybridization probe kit and uracil-DNA glycosylase (Roche Applied Sciences). .. PCR amplification with real-time detection was performed using the following cycling parameters: 1 template-denaturing cycle at 95°C for 10 min, followed by 45 amplification cycles at 95°C for 10 s, 55°C for 15 s, and 72°C for 15 s. Following amplification, a melting curve analysis was performed by measuring the fluorescent signal during the following cycling parameters: 95°C for 0 s, 40°C for 60 s, and 85°C for 0 s, with a transition of 0.1°C/s.

Software:

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices
Article Snippet: The reaction mix contained 10 μl of LightCycler 480 Probes Master (Roche), 5 pmol of the NP F and NP R primers, 10 pmol of the TM F and TM R primers, 4 pmol of the IAC probe and 1 pmol of the NP P probe, and 5 μl template cDNA. .. 1 U of Uracil DNA Glycosylase (Roche) was used in each qPCR reaction to avoid possible carry-over contamination. qPCR was performed using the Roche LightCycler 480 under the following reaction conditions: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 60°C for 30 s and 72°C for 10 s. The subsequent analysis of results (quantification) was carried out using the “Fit point analysis” option of the LightCycler 480 Software release 1.5.0 (version 1.5.0.39). .. Quantification standards were prepared from a 10-fold dilution of in vitro -prepared RNA transcripts of the fragment encoding the specific control sequence derived from thylacine and the moa bird in the range of 5 × 109 genome copies/5 μl to 5 × 101 genome copies/5 μl.

Article Title: Mycobacterium avium subsp. Paratuberculosis and the expression of selected virulence and pathogenesis genes in response to 6?C, 65?c and ph 2.0
Article Snippet: Real time qPCR mixes were made up to a final volume of 10 μl and contained 1 × of DyNAmo Probe qPCR Master Mix (Finnzyme, Finland), 0.1 U of Uracil DNA Glycosylase (Roche Molecular Diagnostic, Germany), 5 pmol of each forward and reverse primer, 0.5 pmol of each probe labelled with FAM and 1μl of appropriate cDNA. .. Real time qPCR mixes were made up to a final volume of 10 μl and contained 1 × of DyNAmo Probe qPCR Master Mix (Finnzyme, Finland), 0.1 U of Uracil DNA Glycosylase (Roche Molecular Diagnostic, Germany), 5 pmol of each forward and reverse primer, 0.5 pmol of each probe labelled with FAM and 1μl of appropriate cDNA.

Article Title: Development of real-time PCR for detection of Mycoplasma hominis
Article Snippet: Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions. .. As negative control a sample containing all reagents except DNA was used in every PCR run.

Article Title: Four-Color Alternating-Laser Excitation Single-Molecule Fluorescence Spectroscopy for Next-Generation Biodetection Assays
Article Snippet: Oligo 7 software (Molecular Biology Insights) was used to design both PCR primers and hybridization FRET probe pairs (see ). .. Uracil-DNA glycosylase and dUTP (Roche Applied Science) were used to eliminate the potential for PCR carryover contamination.

SYBR Green Assay:

Article Title: G6PC2 Modulates the Effects of Dexamethasone on Fasting Blood Glucose and Glucose Tolerance
Article Snippet: Gene expression was quantitated using real-time PCR. .. Tissue culture cell, pancreatic, and liver gene expression were quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the deoxyuridine triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-Glycosylase (Roche). .. Islet gene expression was quantitated using the primer-probe TaqMan approach from Life Technologies as described ( ).

Article Title: G6PC2 Modulates Fasting Blood Glucose In Male Mice in Response to Stress
Article Snippet: Gene expression was quantitated using real-time PCR. .. Pancreatic gene expression was quantitated after RNA isolation by using the Turbo DNA-free DNAse Treatment kit (Ambion) to remove trace gDNA followed by cDNA generation using the iScript DNA Synthesis kit (Bio-Rad) and then PCR using the 2′-deoxyuridine 5′-triphosphate-containing FastStart SYBR Green Master Mix in conjunction with Uracil-DNA-glycosylase (Roche). .. Islet gene expression was quantitated using the primer-probe TaqMan approach from Life Technologies as described ( ).

Article Title: Real-Time PCR Assay for Detection and Differentiation of Shiga Toxin-Producing Escherichia coli from Clinical Samples
Article Snippet: The specificity of each primer was screened by BLAST analysis and validated using 30 clinical specimens with diagnoses, confirmed by culture, of Shiga toxin-producing E. coli or non- E. coli pathogens, as described above. .. Real-time PCR was performed with a final reaction volume of 40 μl containing iQ SYBR Green Supermix (2×), primers at a final concentration of 500 nM, uracil DNA glycosylase (Roche, Indianapolis, IN), and 4 μl of extracted DNA. .. The real-time PCR assay was performed using a Bio-Rad MyiQ iCycler system (Bio-Rad, Hercules, CA).

Multiplex Assay:

Article Title: Four-Color Alternating-Laser Excitation Single-Molecule Fluorescence Spectroscopy for Next-Generation Biodetection Assays
Article Snippet: Uracil-DNA glycosylase and dUTP (Roche Applied Science) were used to eliminate the potential for PCR carryover contamination. .. AmpliTaq Gold® 360 DNA polymerase (Applied Biosystems) was used for amplification.

Agarose Gel Electrophoresis:

Article Title: Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River
Article Snippet: Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination. .. Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination.

In Vitro:

Article Title: A deep vein thrombosis caused by 20209C > T mutation in homozygosis of the prothrombin gene in a Caucasian patient
Article Snippet: The blood sample was analyzed with The Xpert® HemosIL® Factor II & Factor V Assay (Cepheid/Instrumentation Laboratory), which is a qualitative in vitro diagnostic genotyping test for the detection of Factor II (20210G > A mutation) and Factor V (1691G > A mutation) alleles from sodium citrate or EDTA anticoagulated whole blood. .. Also, we used Uracil-DNA Glycosylase, heat-labile (Roche Diagnostics) 1U for to eliminate PCR carry over contaminations.

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices
Article Snippet: 1 U of Uracil DNA Glycosylase (Roche) was used in each qPCR reaction to avoid possible carry-over contamination. qPCR was performed using the Roche LightCycler 480 under the following reaction conditions: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 60°C for 30 s and 72°C for 10 s. The subsequent analysis of results (quantification) was carried out using the “Fit point analysis” option of the LightCycler 480 Software release 1.5.0 (version 1.5.0.39). .. 1 U of Uracil DNA Glycosylase (Roche) was used in each qPCR reaction to avoid possible carry-over contamination. qPCR was performed using the Roche LightCycler 480 under the following reaction conditions: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 60°C for 30 s and 72°C for 10 s. The subsequent analysis of results (quantification) was carried out using the “Fit point analysis” option of the LightCycler 480 Software release 1.5.0 (version 1.5.0.39).

Enzyme-linked Immunosorbent Assay:

Article Title: Real-Time PCR Assay for Detection and Differentiation of Shiga Toxin-Producing Escherichia coli from Clinical Samples
Article Snippet: Real-time PCR was performed with a final reaction volume of 40 μl containing iQ SYBR Green Supermix (2×), primers at a final concentration of 500 nM, uracil DNA glycosylase (Roche, Indianapolis, IN), and 4 μl of extracted DNA. .. Real-time PCR was performed with a final reaction volume of 40 μl containing iQ SYBR Green Supermix (2×), primers at a final concentration of 500 nM, uracil DNA glycosylase (Roche, Indianapolis, IN), and 4 μl of extracted DNA.

Quantitation Assay:

Article Title: Peripheral Blood Mononuclear Cell Traffic Plays a Crucial Role in Mother-to-Infant Transmission of Hepatitis B Virus
Article Snippet: Paragraph title: Quantitation of Serum HBV DNA by Real-time PCR ... The PCR cycling program consisted of an initial denaturing step at 95°C for 10 min, followed by 45 amplification cycles at 92°C for 10 s, 50°C for 10 s, and 72°C for 10 s. To prevent carry-over contamination, 1 U of uracil N glycosylase (Roche Diagnostics, Shanghai, China) was added to the master mix.

Concentration Assay:

Article Title: Real-Time PCR Assay for Detection and Differentiation of Shiga Toxin-Producing Escherichia coli from Clinical Samples
Article Snippet: The specificity of each primer was screened by BLAST analysis and validated using 30 clinical specimens with diagnoses, confirmed by culture, of Shiga toxin-producing E. coli or non- E. coli pathogens, as described above. .. Real-time PCR was performed with a final reaction volume of 40 μl containing iQ SYBR Green Supermix (2×), primers at a final concentration of 500 nM, uracil DNA glycosylase (Roche, Indianapolis, IN), and 4 μl of extracted DNA. .. The real-time PCR assay was performed using a Bio-Rad MyiQ iCycler system (Bio-Rad, Hercules, CA).

DNA Purification:

Article Title: Development of real-time PCR for detection of Mycoplasma hominis
Article Snippet: Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions. .. Uracil-DNA Glycosylase (Roche Diagnostics, Mannheim, Germany) was used to prevent the samples from possible PCR "carry-over" contaminations from previous DNA synthesis reactions.

Staining:

Article Title: Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River
Article Snippet: The gel was stained with gelStar nucleic acid stain and viewed under UV light. .. Uracil-DNA glycosylase (Roche Applied Sciences) was added to each reaction mix to prevent carryover contamination.

Clear Native PAGE:

Article Title: The Drosophila orthologue of progeroid human WRN exonuclease, DmWRNexo, cleaves replication substrates but is inhibited by uracil or abasic sites
Article Snippet: Such characteristics of DmWRNexo therefore provide strong validation of the fly model of WS and allow effects on the organism to be interpreted within the context of a clear biochemical understanding of the activity of the WRN nuclease. .. Figure S1 Generation of DNA substrates. a Integrity of oligonucleotides for DNA substrates was verified by running 60 pmol of each substrate post-annealing on 10% native PAGE (1× TBE, 10% 19:1 acrylamide/bis-acrylamide) and visualised using a Fuji FLA-3000 analyser. b To make abasic (AP) sites, oligonucleotides containing a single uracil residue (Table 1) were treated with uracil DNA glycosylase (Escherichia coli UDG, Roche) at 10 U/nmol DNA for 16 h at 37°C. .. AP-containing duplex substrates were then prepared by annealing to the FLO strand and analysed as above. c The existence of AP sites was confirmed by conversion of the AP sites to breaks by incubating with 50 mM KOH at 60°C for 30 min, with separation on 12% native PAGE with ethidium bromide.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Roche uracil dna glycosylase
    Uracil Dna Glycosylase, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/uracil dna glycosylase/product/Roche
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    uracil dna glycosylase - by Bioz Stars, 2019-10
    90/100 stars
      Buy from Supplier

    87
    Roche lc uracil dna glycosylase ung
    Lc Uracil Dna Glycosylase Ung, supplied by Roche, used in various techniques. Bioz Stars score: 87/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lc uracil dna glycosylase ung/product/Roche
    Average 87 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    lc uracil dna glycosylase ung - by Bioz Stars, 2019-10
    87/100 stars
      Buy from Supplier

    82
    Roche uracil dna glycosylase udg
    Uracil Dna Glycosylase Udg, supplied by Roche, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/uracil dna glycosylase udg/product/Roche
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    uracil dna glycosylase udg - by Bioz Stars, 2019-10
    82/100 stars
      Buy from Supplier

    Image Search Results