Structured Review

Roche uracil dna glycosylase
Uracil Dna Glycosylase, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/uracil dna glycosylase/product/Roche
Average 92 stars, based on 9 article reviews
Price from $9.99 to $1999.99
uracil dna glycosylase - by Bioz Stars, 2020-05
92/100 stars

Images

Related Articles

Amplification:

Article Title: Development of a PCR-Based Line Probe Assay for Identification of Fungal Pathogens
Article Snippet: .. PCR conditions for the amplification of the ITS region from yeast isolates were as follows; each reaction mixture contained 0.25 mM deoxynucleotide triphosphates (DU:dNTPs [2:1]), 1× reaction buffer (Promega), 3 mM MgCl2 , 1 U of uracil DNA glycosylase ( ) (Roche-Boehringer Mannheim), 40 pmol each of the forward and reverse primers (ITS 5-ITS 4 pair for full ITS amplification, and ITS 5-ITS 2 pair for ITS-1 amplification), 2.5 U of Taq polymerase (Promega), and 5 μl of template DNA made to a final volume of 100 μl with nuclease-free water (Sigma-Aldrich, Ltd.). .. PCR amplification was performed in a Touchdown thermocycler (Hybaid, Middlesex, United Kingdom), with the following cycling conditions: 37°C for 10 min for one cycle followed by 94°C for 2 min for one cycle followed by 30 cycles of DNA denaturation at 94°C for 30 s, primer annealing at 55°C for 30 s, and DNA extension at 72°C for 2 min, with a final extension cycle at 72°C for 10 min. PCR amplification of Candida DNA extracted from inoculated blood samples was performed in a final volume of 100 μl with 20 μl of DNA extracted from the blood samples (for DNA extracted from 5-ml blood samples, 20 μl of a 1/10 dilution was included in the PCR mixture) added to the PCR mixture containing a final concentration of 0.25 mM DU/dNTPs (2:1), 1× reaction buffer (Promega), 3 mM MgCl2 , 1 U of uracil DNA glycosylase ( ) (Roche-Boehringer Mannheim), 40 pmol each of ITS 5 and ITS 4 primer, and 2.5 U of Taq polymerase (Promega) made to a final volume of 100 μl in nuclease-free water (Sigma-Aldrich Ltd.).

Article Title: Peripheral Blood Mononuclear Cell Traffic Plays a Crucial Role in Mother-to-Infant Transmission of Hepatitis B Virus
Article Snippet: .. The PCR cycling program consisted of an initial denaturing step at 95°C for 10 min, followed by 45 amplification cycles at 92°C for 10 s, 50°C for 10 s, and 72°C for 10 s. To prevent carry-over contamination, 1 U of uracil N glycosylase (Roche Diagnostics, Shanghai, China) was added to the master mix. ..

Synthesized:

Article Title: Neuroinvasion by Human Respiratory Coronaviruses
Article Snippet: .. For PCR, one-fifth of the synthesized cDNA was incubated in the presence of either 20 (O1 and O3, O7 and O9, and M1 and M3 primer pairs) or 50 pmol (E7 and E9 and E11 and E13 primer pairs) of the sense and antisense primers, with either 2.0 (E7 and E9 and O7 and O9 primer pairs), 2.5 (O1 and O3 and M1 and M3 primer pairs), or 4.0 mM (E11 and E13 primer pair) MgCl2 (Roche Diagnostics, Laval, Québec, Canada), 1× PCR buffer (10 mM Tris-HCl [pH 8.3], 50 mM KCl; Roche Diagnostics), dNTP (0.2 mM dATP, dCTP, and dGTP and 0.6 mM dUTP; Roche Diagnostics), and 2 U of uracil DNA glycosylase (UNG; Roche Diagnostics) at 20°C for 10 min (UNG elimination of any potential contamination from a previous PCR) and then at 94°C for 10 min (inactivation of UNG and denaturation of DNA), and finally at 60°C for another 5 min (annealing). .. After the addition of Taq DNA polymerase (2.5 U; Roche Diagnostics) 30 cycles of 2 min at 72°C, 1 min at 94°C, and 2 min at 60°C were performed, with a final elongation step of 10 min at 72°C.

Labeling:

Article Title: Early hCG addition to rFSH for ovarian stimulation in IVF provides better results and the cDNA copies of the hCG receptor may be an indicator of successful stimulation
Article Snippet: .. The reaction mixture for RLT-PCR contained 2 μl LightCycler FastStart Taq Reaction Mix 10× (Roche, Molecular Biochemicals, Mannheim, Germany), 6 mM MgCl2 , 0.75 μM primer hCG_for inner (forward) 5'-GAACTGAGTGGCTGGACTA-3', 0.75 μM primer hCG_rev inner (reverse) (Table ), 5'-GCAAAAGTCTGCAAAGGAGA-3', 0.017 μM hLH_beacon 5'- GCCGGC CTGCTTACCCAAGACACCCCGATGTGCT GCCGGC -3' labeled with fluoresceine at the 5'-terminus and at their 3'-terminus bonded BHQ1, which is the quencher (Black Hole quencher 1). (MWG-BIOTECH Inc, U.K) (bold text indicates the complementary sequences forming the hairpin structure), 1.5 U FastStart Taq DNA polymerase (Roche, Molecular Biochemicals, Mannheim, Germany) and 1 U of uracil-DNA glycosylase (Roche, Molecular Biochemicals, Mannheim, Germany) in a final volume reaction 20 μl. ..

Real-time Polymerase Chain Reaction:

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices
Article Snippet: .. 1 U of Uracil DNA Glycosylase (Roche) was used in each qPCR reaction to avoid possible carry-over contamination. qPCR was performed using the Roche LightCycler 480 under the following reaction conditions: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 60°C for 30 s and 72°C for 10 s. The subsequent analysis of results (quantification) was carried out using the “Fit point analysis” option of the LightCycler 480 Software release 1.5.0 (version 1.5.0.39). .. Quantification standards were prepared from a 10-fold dilution of in vitro -prepared RNA transcripts of the fragment encoding the specific control sequence derived from thylacine and the moa bird in the range of 5 × 109 genome copies/5 μl to 5 × 101 genome copies/5 μl.

Incubation:

Article Title: Exosomes Packaging APOBEC3G Confer Human Immunodeficiency Virus Resistance to Recipient Cells ▿
Article Snippet: .. Exosomes (20 μg protein) were suspended in 25 μl of deaminase buffer (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 2% glycerol, 0.1% Triton X-100) with a 5′-biotin-labeled oligonucleotide substrate (50 ng) and incubated at 37°C for 5 h. The reactions were terminated by heating the reaction mixtures to 90°C for 5 min followed by adding 25 μl of 60 mM Tris, pH 8.0, with 1 mM dithiothreitol and then incubating them with uracil DNA glycosylase (0.5 U; Roche Applied Science) for 30 min at 37°C. .. Subsequently, the samples were treated with 0.15 M NaOH (by adding 0.75 μl of 10 M NaOH) at 37°C for 30 min. Products were neutralized with 0.15 M HCl (by adding 0.7 μl concentrated HCl) and mixed with 2× gel loading buffer, and 40 μl of the mixture was separated on a 15% Tris-buffered EDTA-urea polyacrylamide gel, transferred to a zeta-probe membrane (Bio-Rad), and detected by chemiluminescence with streptavidin-horseradish peroxidase (1:50,000 dilution; Sigma).

Article Title: Neuroinvasion by Human Respiratory Coronaviruses
Article Snippet: .. For PCR, one-fifth of the synthesized cDNA was incubated in the presence of either 20 (O1 and O3, O7 and O9, and M1 and M3 primer pairs) or 50 pmol (E7 and E9 and E11 and E13 primer pairs) of the sense and antisense primers, with either 2.0 (E7 and E9 and O7 and O9 primer pairs), 2.5 (O1 and O3 and M1 and M3 primer pairs), or 4.0 mM (E11 and E13 primer pair) MgCl2 (Roche Diagnostics, Laval, Québec, Canada), 1× PCR buffer (10 mM Tris-HCl [pH 8.3], 50 mM KCl; Roche Diagnostics), dNTP (0.2 mM dATP, dCTP, and dGTP and 0.6 mM dUTP; Roche Diagnostics), and 2 U of uracil DNA glycosylase (UNG; Roche Diagnostics) at 20°C for 10 min (UNG elimination of any potential contamination from a previous PCR) and then at 94°C for 10 min (inactivation of UNG and denaturation of DNA), and finally at 60°C for another 5 min (annealing). .. After the addition of Taq DNA polymerase (2.5 U; Roche Diagnostics) 30 cycles of 2 min at 72°C, 1 min at 94°C, and 2 min at 60°C were performed, with a final elongation step of 10 min at 72°C.

Polymerase Chain Reaction:

Article Title: Development of a PCR-Based Line Probe Assay for Identification of Fungal Pathogens
Article Snippet: .. PCR conditions for the amplification of the ITS region from yeast isolates were as follows; each reaction mixture contained 0.25 mM deoxynucleotide triphosphates (DU:dNTPs [2:1]), 1× reaction buffer (Promega), 3 mM MgCl2 , 1 U of uracil DNA glycosylase ( ) (Roche-Boehringer Mannheim), 40 pmol each of the forward and reverse primers (ITS 5-ITS 4 pair for full ITS amplification, and ITS 5-ITS 2 pair for ITS-1 amplification), 2.5 U of Taq polymerase (Promega), and 5 μl of template DNA made to a final volume of 100 μl with nuclease-free water (Sigma-Aldrich, Ltd.). .. PCR amplification was performed in a Touchdown thermocycler (Hybaid, Middlesex, United Kingdom), with the following cycling conditions: 37°C for 10 min for one cycle followed by 94°C for 2 min for one cycle followed by 30 cycles of DNA denaturation at 94°C for 30 s, primer annealing at 55°C for 30 s, and DNA extension at 72°C for 2 min, with a final extension cycle at 72°C for 10 min. PCR amplification of Candida DNA extracted from inoculated blood samples was performed in a final volume of 100 μl with 20 μl of DNA extracted from the blood samples (for DNA extracted from 5-ml blood samples, 20 μl of a 1/10 dilution was included in the PCR mixture) added to the PCR mixture containing a final concentration of 0.25 mM DU/dNTPs (2:1), 1× reaction buffer (Promega), 3 mM MgCl2 , 1 U of uracil DNA glycosylase ( ) (Roche-Boehringer Mannheim), 40 pmol each of ITS 5 and ITS 4 primer, and 2.5 U of Taq polymerase (Promega) made to a final volume of 100 μl in nuclease-free water (Sigma-Aldrich Ltd.).

Article Title: Peripheral Blood Mononuclear Cell Traffic Plays a Crucial Role in Mother-to-Infant Transmission of Hepatitis B Virus
Article Snippet: .. The PCR cycling program consisted of an initial denaturing step at 95°C for 10 min, followed by 45 amplification cycles at 92°C for 10 s, 50°C for 10 s, and 72°C for 10 s. To prevent carry-over contamination, 1 U of uracil N glycosylase (Roche Diagnostics, Shanghai, China) was added to the master mix. ..

Article Title: Four-Color Alternating-Laser Excitation Single-Molecule Fluorescence Spectroscopy for Next-Generation Biodetection Assays
Article Snippet: .. Uracil-DNA glycosylase and dUTP (Roche Applied Science) were used to eliminate the potential for PCR carryover contamination. .. AmpliTaq Gold® 360 DNA polymerase (Applied Biosystems) was used for amplification.

Article Title: Neuroinvasion by Human Respiratory Coronaviruses
Article Snippet: .. For PCR, one-fifth of the synthesized cDNA was incubated in the presence of either 20 (O1 and O3, O7 and O9, and M1 and M3 primer pairs) or 50 pmol (E7 and E9 and E11 and E13 primer pairs) of the sense and antisense primers, with either 2.0 (E7 and E9 and O7 and O9 primer pairs), 2.5 (O1 and O3 and M1 and M3 primer pairs), or 4.0 mM (E11 and E13 primer pair) MgCl2 (Roche Diagnostics, Laval, Québec, Canada), 1× PCR buffer (10 mM Tris-HCl [pH 8.3], 50 mM KCl; Roche Diagnostics), dNTP (0.2 mM dATP, dCTP, and dGTP and 0.6 mM dUTP; Roche Diagnostics), and 2 U of uracil DNA glycosylase (UNG; Roche Diagnostics) at 20°C for 10 min (UNG elimination of any potential contamination from a previous PCR) and then at 94°C for 10 min (inactivation of UNG and denaturation of DNA), and finally at 60°C for another 5 min (annealing). .. After the addition of Taq DNA polymerase (2.5 U; Roche Diagnostics) 30 cycles of 2 min at 72°C, 1 min at 94°C, and 2 min at 60°C were performed, with a final elongation step of 10 min at 72°C.

Article Title: Detection of Human Immunodeficiency Virus Type 1 DNA in Dried Blood Spots by a Duplex Real-Time PCR Assay
Article Snippet: .. The established assay contained 200 nM HIV long terminal repeat (LTR) forward primer (TGCTTAAGCCTCAATAAAGCTTGCCTTGA); 400 nM HIV reverse primer (TCTGAGGGATCTCTAGTTACCAG); 400 nM fluorescent probe (Fam-AAGTAGTGTGTGCCCGTCTGT-Qsy-7); 40 nM RNase P forward primer (AGATTTGGACCTGCGAGCG); 100 nM RNase P reverse primer (GAGCGGCTGTCTCCACAAGT); 200 nM RNase P fluorescent probe (Hex-TTCTGACCTGAAGGCTCTGCGCG-Qsy-7); 1× PCR buffer (Roche, Indianapolis, IN); 5 mM MgCl2 ; 200 nM each of dATP, dTTP, dGTP, and dCTP; and 400 nM dUTP; 200 nM Rox dye (Standard II; Synthegen, Houston, TX), 0.2 units of uracil DNA glycosylase (Roche), and 4 units of Amplitaq Gold DNA polymerase (Roche). .. Real-time PCR was performed in a model MX4000 instrument (Stratagene, La Jolla, CA).

Software:

Article Title: Preparation of MS2 Phage-Like Particles and Their Use As Potential Process Control Viruses for Detection and Quantification of Enteric RNA Viruses in Different Matrices
Article Snippet: .. 1 U of Uracil DNA Glycosylase (Roche) was used in each qPCR reaction to avoid possible carry-over contamination. qPCR was performed using the Roche LightCycler 480 under the following reaction conditions: initial denaturation at 95°C for 10 min, followed by 45 cycles at 95°C for 10 s, 60°C for 30 s and 72°C for 10 s. The subsequent analysis of results (quantification) was carried out using the “Fit point analysis” option of the LightCycler 480 Software release 1.5.0 (version 1.5.0.39). .. Quantification standards were prepared from a 10-fold dilution of in vitro -prepared RNA transcripts of the fragment encoding the specific control sequence derived from thylacine and the moa bird in the range of 5 × 109 genome copies/5 μl to 5 × 101 genome copies/5 μl.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Roche lightcycler uracil dna glycosylase
    Lightcycler Uracil Dna Glycosylase, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lightcycler uracil dna glycosylase/product/Roche
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    lightcycler uracil dna glycosylase - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    92
    Roche uracil dna glycosylase
    Uracil Dna Glycosylase, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/uracil dna glycosylase/product/Roche
    Average 92 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    uracil dna glycosylase - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    90
    Roche uracyl dna n glycosylase
    Uracyl Dna N Glycosylase, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/uracyl dna n glycosylase/product/Roche
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    uracyl dna n glycosylase - by Bioz Stars, 2020-05
    90/100 stars
      Buy from Supplier

    Image Search Results