ultra ii q5 master mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    NEBNext Ultra II Q5 Master Mix
    Description:
    NEBNext Ultra II Q5 Master Mix 250 rxns
    Catalog Number:
    m0544l
    Price:
    395
    Size:
    250 rxns
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs ultra ii q5 master mix
    NEBNext Ultra II Q5 Master Mix
    NEBNext Ultra II Q5 Master Mix 250 rxns
    https://www.bioz.com/result/ultra ii q5 master mix/product/New England Biolabs
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    ultra ii q5 master mix - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: The amplified locus fragments were then cloned into pCR4-TOPO vectors using the ZeroBlunt TOPO Cloning Kit (Life Technologies Zero Blunt TOPO PCR Cloning Kit for Sequencing with One Shot TOP10 Chemically Competent E. coli #K287540) and transformed in One Shot Top10 chemically competent Escherichia coli cells. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    Centrifugation:

    Article Title: Maternal Eed knockout causes loss of H3K27me3 imprinting and random X inactivation in the extraembryonic cells
    Article Snippet: The protein–DNA complexes were then released by 10-min incubation at 37°C followed by centrifugation at 20,000 g for 5 min at 4°C. .. After adaptor ligation for 30 min at 20°C, the DNA fragments were purified by 1.8× vol of SPRIselect beads (Beckman Coulter) followed by 16 cycles of PCR amplification with NEBNext Ultra II Q5 master mix (New England Biolabs).

    Amplification:

    Article Title: Fragmentation Through Polymerization (FTP): A new method to fragment DNA for next-generation sequencing
    Article Snippet: .. The conventional procedure for Fragmentase-digested DNA included repair of DNA ends with the NEBNext Ultra II End Prep Enzyme Mix, addition of adapters to the DNA fragments using NEBNext Ultra II Ligation Master Mix, and amplification of the adaptor-ligated DNA fragments with the NEBNext Ultra II Q5 Master Mix. ..

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: For Illumina amplicon sequencing, two rounds of amplification were performed: round 1 targets the TRAC region, and round 2 adds the full-length Illumina adapter sequence. .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification. .. After 15 cycles of PCR and cleanup with QIAquick PCR Purification Kit, 0.5–1 μg of WGA products were typically recovered.

    Article Title: Short tandem repeat stutter model inferred from direct measurement of in vitro stutter noise
    Article Snippet: Experimental validation of the model by using single cell STR data The high fidelity PCR enzymes were used in this study were: NEBNext Q5 Hot Start HiFi PCR Master Mix (NEB), NEBNext Ultra II Q5 Master Mix (NEB), FastStart High Fidelity PCR System, dNTPack (Roche), KOD Hot Start DNA Polymerase (Novagen), KAPA HiFi HotStart PCR Kit (Kapa Biosystems) and PrimeStar Max (Takara). .. A recreation of the original amplicon targeted sequencing protocol as presented in ( ) was performed in order to assess the error rate per polymerase enzyme using the STR stutter model.

    Article Title: Maternal Eed knockout causes loss of H3K27me3 imprinting and random X inactivation in the extraembryonic cells
    Article Snippet: .. After adaptor ligation for 30 min at 20°C, the DNA fragments were purified by 1.8× vol of SPRIselect beads (Beckman Coulter) followed by 16 cycles of PCR amplification with NEBNext Ultra II Q5 master mix (New England Biolabs). .. The PCR products were cleaned up with 0.9× vol of SPRIselect beads and quantified using Qubit dsDNA HS assay kit (Agilent Technologies).

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers. ..

    Whole Genome Amplification:

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: Paragraph title: Whole genome amplification of bisulfite converted DNA ... Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification.

    Polymerase Chain Reaction:

    Article Title: Candida albicans gains azole resistance by altering sphingolipid composition
    Article Snippet: .. The second round of PCR was performed using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544L) to add sequences required for Illumina sequencing with an Illumina flowcell attachment primer, TruPBseq and partial Tn5 adaptor primer, Illumina-R. Cycling conditions are: 1 min at 98 °C; 7 cycles of 10 s at 98 °C, 75 s at 67 °C; 5 min at 67 °C; 4 °C forever. .. The size selection and purification of the PCR products were carried out with AMPure XP beads (Beckman Coulter, A63882).

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: The PCR product was purified using (0.9×) Agencourt AMPure XP beads (Beckman Coulter Agencourt AMPure XP - PCR Purification #A63882) as per the manufacturer’s protocol. .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification. .. After 15 cycles of PCR and cleanup with QIAquick PCR Purification Kit, 0.5–1 μg of WGA products were typically recovered.

    Article Title: Short tandem repeat stutter model inferred from direct measurement of in vitro stutter noise
    Article Snippet: .. Experimental validation of the model by using single cell STR data The high fidelity PCR enzymes were used in this study were: NEBNext Q5 Hot Start HiFi PCR Master Mix (NEB), NEBNext Ultra II Q5 Master Mix (NEB), FastStart High Fidelity PCR System, dNTPack (Roche), KOD Hot Start DNA Polymerase (Novagen), KAPA HiFi HotStart PCR Kit (Kapa Biosystems) and PrimeStar Max (Takara). .. A recreation of the original amplicon targeted sequencing protocol as presented in ( ) was performed in order to assess the error rate per polymerase enzyme using the STR stutter model.

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: The amplified locus fragments were then cloned into pCR4-TOPO vectors using the ZeroBlunt TOPO Cloning Kit (Life Technologies Zero Blunt TOPO PCR Cloning Kit for Sequencing with One Shot TOP10 Chemically Competent E. coli #K287540) and transformed in One Shot Top10 chemically competent Escherichia coli cells. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    Article Title: Maternal Eed knockout causes loss of H3K27me3 imprinting and random X inactivation in the extraembryonic cells
    Article Snippet: .. After adaptor ligation for 30 min at 20°C, the DNA fragments were purified by 1.8× vol of SPRIselect beads (Beckman Coulter) followed by 16 cycles of PCR amplification with NEBNext Ultra II Q5 master mix (New England Biolabs). .. The PCR products were cleaned up with 0.9× vol of SPRIselect beads and quantified using Qubit dsDNA HS assay kit (Agilent Technologies).

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: .. Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs). .. PCR conditions were as follows: 98°C for 30 s, 4 cycles of (98°C for 10 s – 67°C for 30 s – 72°C for 30 s), and a variable number of cycles of (98°C for 10 s – 72°C for 30 s).

    Article Title: Genome-wide CRISPR Screens in Primary Human T Cells Reveal Key Regulators of Immune Function
    Article Snippet: .. Each reaction included 1μL of PCR product, 12.5 μL NEBNext Ultra II Q5 Master Mix (NEB, cat #M0544L), 1.25μL P5 forward primer, 1.25μL Illumina i7 primer, and water to 25μL. .. The PCR cycling conditions were: 3 minutes at 98°C, followed by 10 seconds at 98°C, 10 seconds at 62°C, 25 seconds at 72°C, for 10 cycles, and a final 2 minute extension at 72°C.

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers. ..

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human
    Article Snippet: .. PCR was performed using custom HPLC-purified primers (F: 5′-TAGAGCATGCACCGGCAAGCAGAAGACGGCATACGAGATNNNNATGTCTCGTGGGCTCGGAGATGT-3′, R : 5′-GGCCGAATTCGTCGATCGTCGGCAGCGTCAGATGTG-3′, where NNNN corresponds to a random 4 nt i7 barcode sequence) and NEBNext Ultra II Q5 DNA polymerase master mix (NEB #M0544L). .. Thermocycler conditions were: 65 °C for 5 min, 98 °C for 30 s, 8 cycles of: 98 °C for 10 s and 65 °C for 90 s. PCR reactions were pooled and cleaned up with a Qiagen MinElute PCR purification kit (two PCR reactions per column eluted in 20 µL of EB buffer) and run on a 1% agarose E-Gel EX with SYBR Gold II stain (Thermo Fisher #G402001).

    Neutralization:

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: Before the second adapter ligation, RNAs were digested by incubation in 100 mM NaOH at 70°C for 10 min, followed by neutralization by acetic acid and cDNA purification using Dynabeads MyOne Silane beads. .. Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs).

    Construct:

    Article Title: Fragmentation Through Polymerization (FTP): A new method to fragment DNA for next-generation sequencing
    Article Snippet: The conventional procedure for Fragmentase-digested DNA included repair of DNA ends with the NEBNext Ultra II End Prep Enzyme Mix, addition of adapters to the DNA fragments using NEBNext Ultra II Ligation Master Mix, and amplification of the adaptor-ligated DNA fragments with the NEBNext Ultra II Q5 Master Mix. .. NGS libraries from FTP digested gDNA were constructed using the NEBNext Ultra II DNA Library Prep Kit procedure, excluding the DNA end repair stage.

    Incubation:

    Article Title: Candida albicans gains azole resistance by altering sphingolipid composition
    Article Snippet: The GMM plate was incubated at 30 °C for 2 days before collecting the cells for the extraction of genomic DNA using the MasterPure Yeast DNA Purification Kit. .. The second round of PCR was performed using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544L) to add sequences required for Illumina sequencing with an Illumina flowcell attachment primer, TruPBseq and partial Tn5 adaptor primer, Illumina-R. Cycling conditions are: 1 min at 98 °C; 7 cycles of 10 s at 98 °C, 75 s at 67 °C; 5 min at 67 °C; 4 °C forever.

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: Cells were plated on Carbenicillin LB agar plates and incubated overnight at 37 °C. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    Article Title: Maternal Eed knockout causes loss of H3K27me3 imprinting and random X inactivation in the extraembryonic cells
    Article Snippet: After transferring the supernatant to a new Lo-bound tube, 1/100 vol of 10% SDS and 1/80 vol of 2.5 mg/mL Proteinase K (Thermo Fisher Scientific) were added and incubated for at least 1 h at 55°C. .. After adaptor ligation for 30 min at 20°C, the DNA fragments were purified by 1.8× vol of SPRIselect beads (Beckman Coulter) followed by 16 cycles of PCR amplification with NEBNext Ultra II Q5 master mix (New England Biolabs).

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: 40 pmol 3Tr3 DNA adapter (5’-[phosph]AGATCGGAAGAGCACACGTCTG[3ddC]) ( ) was ligated to the purified cDNAs by incubation in ligation mix (1x T4 RNA ligase reaction 1 buffer, 4% DMSO, 1 mM ATP, 24% PEG8000, and 50U T4 RNA ligase 1) overnight at room temperature, followed by nucleic acid purification using Dynabeads MyOne Silane beads. .. Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs).

    Mass Spectrometry:

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: Whole genome amplification of bisulfite converted DNA To examine application of MS-NaME on double-stranded DNA generated via whole genome amplification (WGA) of bisulfite converted DNA, 20 ng of bisulfite converted DNA was used. .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification.

    Modification:

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human
    Article Snippet: HiDRA library construction We performed 16 ATAC-seq reactions on 50,000 GM12878 cells, each using a modified protocol based upon Buenrostro et al. (Supplementary Note ). .. PCR was performed using custom HPLC-purified primers (F: 5′-TAGAGCATGCACCGGCAAGCAGAAGACGGCATACGAGATNNNNATGTCTCGTGGGCTCGGAGATGT-3′, R : 5′-GGCCGAATTCGTCGATCGTCGGCAGCGTCAGATGTG-3′, where NNNN corresponds to a random 4 nt i7 barcode sequence) and NEBNext Ultra II Q5 DNA polymerase master mix (NEB #M0544L).

    Transformation Assay:

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: The amplified locus fragments were then cloned into pCR4-TOPO vectors using the ZeroBlunt TOPO Cloning Kit (Life Technologies Zero Blunt TOPO PCR Cloning Kit for Sequencing with One Shot TOP10 Chemically Competent E. coli #K287540) and transformed in One Shot Top10 chemically competent Escherichia coli cells. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    High Performance Liquid Chromatography:

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human
    Article Snippet: .. PCR was performed using custom HPLC-purified primers (F: 5′-TAGAGCATGCACCGGCAAGCAGAAGACGGCATACGAGATNNNNATGTCTCGTGGGCTCGGAGATGT-3′, R : 5′-GGCCGAATTCGTCGATCGTCGGCAGCGTCAGATGTG-3′, where NNNN corresponds to a random 4 nt i7 barcode sequence) and NEBNext Ultra II Q5 DNA polymerase master mix (NEB #M0544L). .. Thermocycler conditions were: 65 °C for 5 min, 98 °C for 30 s, 8 cycles of: 98 °C for 10 s and 65 °C for 90 s. PCR reactions were pooled and cleaned up with a Qiagen MinElute PCR purification kit (two PCR reactions per column eluted in 20 µL of EB buffer) and run on a 1% agarose E-Gel EX with SYBR Gold II stain (Thermo Fisher #G402001).

    Ligation:

    Article Title: Fragmentation Through Polymerization (FTP): A new method to fragment DNA for next-generation sequencing
    Article Snippet: .. The conventional procedure for Fragmentase-digested DNA included repair of DNA ends with the NEBNext Ultra II End Prep Enzyme Mix, addition of adapters to the DNA fragments using NEBNext Ultra II Ligation Master Mix, and amplification of the adaptor-ligated DNA fragments with the NEBNext Ultra II Q5 Master Mix. ..

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification. .. After 15 cycles of PCR and cleanup with QIAquick PCR Purification Kit, 0.5–1 μg of WGA products were typically recovered.

    Article Title: Maternal Eed knockout causes loss of H3K27me3 imprinting and random X inactivation in the extraembryonic cells
    Article Snippet: .. After adaptor ligation for 30 min at 20°C, the DNA fragments were purified by 1.8× vol of SPRIselect beads (Beckman Coulter) followed by 16 cycles of PCR amplification with NEBNext Ultra II Q5 master mix (New England Biolabs). .. The PCR products were cleaned up with 0.9× vol of SPRIselect beads and quantified using Qubit dsDNA HS assay kit (Agilent Technologies).

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: 40 pmol 3Tr3 DNA adapter (5’-[phosph]AGATCGGAAGAGCACACGTCTG[3ddC]) ( ) was ligated to the purified cDNAs by incubation in ligation mix (1x T4 RNA ligase reaction 1 buffer, 4% DMSO, 1 mM ATP, 24% PEG8000, and 50U T4 RNA ligase 1) overnight at room temperature, followed by nucleic acid purification using Dynabeads MyOne Silane beads. .. Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs).

    Transferring:

    Article Title: Maternal Eed knockout causes loss of H3K27me3 imprinting and random X inactivation in the extraembryonic cells
    Article Snippet: After transferring the supernatant to a new Lo-bound tube, 1/100 vol of 10% SDS and 1/80 vol of 2.5 mg/mL Proteinase K (Thermo Fisher Scientific) were added and incubated for at least 1 h at 55°C. .. After adaptor ligation for 30 min at 20°C, the DNA fragments were purified by 1.8× vol of SPRIselect beads (Beckman Coulter) followed by 16 cycles of PCR amplification with NEBNext Ultra II Q5 master mix (New England Biolabs).

    Generated:

    Article Title: Fragmentation Through Polymerization (FTP): A new method to fragment DNA for next-generation sequencing
    Article Snippet: NGS libraries were generated using NEBNext Ultra II DNA Library Prep kit (New England Biolabs, Inc.) according to the manufacturer’s instructions. .. The conventional procedure for Fragmentase-digested DNA included repair of DNA ends with the NEBNext Ultra II End Prep Enzyme Mix, addition of adapters to the DNA fragments using NEBNext Ultra II Ligation Master Mix, and amplification of the adaptor-ligated DNA fragments with the NEBNext Ultra II Q5 Master Mix.

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: Whole genome amplification of bisulfite converted DNA To examine application of MS-NaME on double-stranded DNA generated via whole genome amplification (WGA) of bisulfite converted DNA, 20 ng of bisulfite converted DNA was used. .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification.

    Sequencing:

    Article Title: Candida albicans gains azole resistance by altering sphingolipid composition
    Article Snippet: .. The second round of PCR was performed using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544L) to add sequences required for Illumina sequencing with an Illumina flowcell attachment primer, TruPBseq and partial Tn5 adaptor primer, Illumina-R. Cycling conditions are: 1 min at 98 °C; 7 cycles of 10 s at 98 °C, 75 s at 67 °C; 5 min at 67 °C; 4 °C forever. .. The size selection and purification of the PCR products were carried out with AMPure XP beads (Beckman Coulter, A63882).

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: For Illumina amplicon sequencing, two rounds of amplification were performed: round 1 targets the TRAC region, and round 2 adds the full-length Illumina adapter sequence. .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: Short tandem repeat stutter model inferred from direct measurement of in vitro stutter noise
    Article Snippet: Experimental validation of the model by using single cell STR data The high fidelity PCR enzymes were used in this study were: NEBNext Q5 Hot Start HiFi PCR Master Mix (NEB), NEBNext Ultra II Q5 Master Mix (NEB), FastStart High Fidelity PCR System, dNTPack (Roche), KOD Hot Start DNA Polymerase (Novagen), KAPA HiFi HotStart PCR Kit (Kapa Biosystems) and PrimeStar Max (Takara). .. A recreation of the original amplicon targeted sequencing protocol as presented in ( ) was performed in order to assess the error rate per polymerase enzyme using the STR stutter model.

    Article Title: Maternal Eed knockout causes loss of H3K27me3 imprinting and random X inactivation in the extraembryonic cells
    Article Snippet: Sequencing libraries were prepared using a NEBNext Ultra II DNA library preparation kit for Illumina (New England Biolabs) according to the manufacturer's instructions with a few modifications. .. After adaptor ligation for 30 min at 20°C, the DNA fragments were purified by 1.8× vol of SPRIselect beads (Beckman Coulter) followed by 16 cycles of PCR amplification with NEBNext Ultra II Q5 master mix (New England Biolabs).

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs). .. Input samples required 4–6 cycles, pull-down samples 10–12 cycles, and negative controls 14–16 cycles at this stage to obtain sufficient DNA quantities for sequencing.

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human
    Article Snippet: .. PCR was performed using custom HPLC-purified primers (F: 5′-TAGAGCATGCACCGGCAAGCAGAAGACGGCATACGAGATNNNNATGTCTCGTGGGCTCGGAGATGT-3′, R : 5′-GGCCGAATTCGTCGATCGTCGGCAGCGTCAGATGTG-3′, where NNNN corresponds to a random 4 nt i7 barcode sequence) and NEBNext Ultra II Q5 DNA polymerase master mix (NEB #M0544L). .. Thermocycler conditions were: 65 °C for 5 min, 98 °C for 30 s, 8 cycles of: 98 °C for 10 s and 65 °C for 90 s. PCR reactions were pooled and cleaned up with a Qiagen MinElute PCR purification kit (two PCR reactions per column eluted in 20 µL of EB buffer) and run on a 1% agarose E-Gel EX with SYBR Gold II stain (Thermo Fisher #G402001).

    Binding Assay:

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: Remaining ssDNA probes were removed by incubating the samples with Dynabeads MyOne Streptavidin C1 beads at 60°C for 15 min with shaking at 1200 rpm in C1 binding buffer (10 mM Tris-Cl pH 7.5, 250 mM LiCl, 20 mM EDTA, 0.1% Triton X-100). .. Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs).

    Nucleic Acid Purification:

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: 40 pmol 3Tr3 DNA adapter (5’-[phosph]AGATCGGAAGAGCACACGTCTG[3ddC]) ( ) was ligated to the purified cDNAs by incubation in ligation mix (1x T4 RNA ligase reaction 1 buffer, 4% DMSO, 1 mM ATP, 24% PEG8000, and 50U T4 RNA ligase 1) overnight at room temperature, followed by nucleic acid purification using Dynabeads MyOne Silane beads. .. Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs).

    RNA Sequencing Assay:

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: Paragraph title: RNA sequencing library preparation ... Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs).

    Sensitive Assay:

    Article Title: Genome-wide CRISPR Screens in Primary Human T Cells Reveal Key Regulators of Immune Function
    Article Snippet: Each reaction included 1μL of PCR product, 12.5 μL NEBNext Ultra II Q5 Master Mix (NEB, cat #M0544L), 1.25μL P5 forward primer, 1.25μL Illumina i7 primer, and water to 25μL. .. After the PCR, all reactions were SPRI purified and quantified using the Qubit dsDNA high sensitivity assay kit (Thermo Fisher Scientific, cat# ) and run on a gel to confirm size.

    Purification:

    Article Title: Candida albicans gains azole resistance by altering sphingolipid composition
    Article Snippet: The second round of PCR was performed using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544L) to add sequences required for Illumina sequencing with an Illumina flowcell attachment primer, TruPBseq and partial Tn5 adaptor primer, Illumina-R. Cycling conditions are: 1 min at 98 °C; 7 cycles of 10 s at 98 °C, 75 s at 67 °C; 5 min at 67 °C; 4 °C forever. .. The size selection and purification of the PCR products were carried out with AMPure XP beads (Beckman Coulter, A63882).

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: The PCR product was purified using (0.9×) Agencourt AMPure XP beads (Beckman Coulter Agencourt AMPure XP - PCR Purification #A63882) as per the manufacturer’s protocol. .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: After random primer cleanup with QIAquick PCR Purification Kit (Qiagen GmbH, Hilden, Germany), the bisulfite-converted dsDNA was amplified using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs, Ipswich, MA, USA). .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification.

    Article Title: Short tandem repeat stutter model inferred from direct measurement of in vitro stutter noise
    Article Snippet: Experimental validation of the model by using single cell STR data The high fidelity PCR enzymes were used in this study were: NEBNext Q5 Hot Start HiFi PCR Master Mix (NEB), NEBNext Ultra II Q5 Master Mix (NEB), FastStart High Fidelity PCR System, dNTPack (Roche), KOD Hot Start DNA Polymerase (Novagen), KAPA HiFi HotStart PCR Kit (Kapa Biosystems) and PrimeStar Max (Takara). .. Following sample harvesting, purification and dilution 1:100, a second PCR was performed at a final volume of 20 μl, each sample with its corresponding PCR enzyme from the first PCR reaction and using its protocol, unless otherwise mentioned.

    Article Title: Maternal Eed knockout causes loss of H3K27me3 imprinting and random X inactivation in the extraembryonic cells
    Article Snippet: .. After adaptor ligation for 30 min at 20°C, the DNA fragments were purified by 1.8× vol of SPRIselect beads (Beckman Coulter) followed by 16 cycles of PCR amplification with NEBNext Ultra II Q5 master mix (New England Biolabs). .. The PCR products were cleaned up with 0.9× vol of SPRIselect beads and quantified using Qubit dsDNA HS assay kit (Agilent Technologies).

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: 40 pmol 3Tr3 DNA adapter (5’-[phosph]AGATCGGAAGAGCACACGTCTG[3ddC]) ( ) was ligated to the purified cDNAs by incubation in ligation mix (1x T4 RNA ligase reaction 1 buffer, 4% DMSO, 1 mM ATP, 24% PEG8000, and 50U T4 RNA ligase 1) overnight at room temperature, followed by nucleic acid purification using Dynabeads MyOne Silane beads. .. Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs).

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: Tagmented DNA was purified using ChIP DNA clean and concentrator columns (ZymoResearch). .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers.

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human
    Article Snippet: Tn5-fragmented DNA was cleaned up using a MinElute PCR purification kit (Qiagen #28004, four reactions per column eluted in 20 µL of EB buffer) and the resulting 80 µL of eluate was split into 16 PCR reactions (Supplementary Note ). .. PCR was performed using custom HPLC-purified primers (F: 5′-TAGAGCATGCACCGGCAAGCAGAAGACGGCATACGAGATNNNNATGTCTCGTGGGCTCGGAGATGT-3′, R : 5′-GGCCGAATTCGTCGATCGTCGGCAGCGTCAGATGTG-3′, where NNNN corresponds to a random 4 nt i7 barcode sequence) and NEBNext Ultra II Q5 DNA polymerase master mix (NEB #M0544L).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: Reverse transcription was carried out using the ThermoScript RT-PCR system (Thermo Fisher Scientific) and AR17 primer (5’- ACACGACGCTCTTCCGA) , according to the manufacturer’s instructions. .. Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs).

    Staining:

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human
    Article Snippet: PCR was performed using custom HPLC-purified primers (F: 5′-TAGAGCATGCACCGGCAAGCAGAAGACGGCATACGAGATNNNNATGTCTCGTGGGCTCGGAGATGT-3′, R : 5′-GGCCGAATTCGTCGATCGTCGGCAGCGTCAGATGTG-3′, where NNNN corresponds to a random 4 nt i7 barcode sequence) and NEBNext Ultra II Q5 DNA polymerase master mix (NEB #M0544L). .. Thermocycler conditions were: 65 °C for 5 min, 98 °C for 30 s, 8 cycles of: 98 °C for 10 s and 65 °C for 90 s. PCR reactions were pooled and cleaned up with a Qiagen MinElute PCR purification kit (two PCR reactions per column eluted in 20 µL of EB buffer) and run on a 1% agarose E-Gel EX with SYBR Gold II stain (Thermo Fisher #G402001).

    Chromatin Immunoprecipitation:

    Article Title: Short tandem repeat stutter model inferred from direct measurement of in vitro stutter noise
    Article Snippet: Experimental validation of the model by using single cell STR data The high fidelity PCR enzymes were used in this study were: NEBNext Q5 Hot Start HiFi PCR Master Mix (NEB), NEBNext Ultra II Q5 Master Mix (NEB), FastStart High Fidelity PCR System, dNTPack (Roche), KOD Hot Start DNA Polymerase (Novagen), KAPA HiFi HotStart PCR Kit (Kapa Biosystems) and PrimeStar Max (Takara). .. In summary, AA chip generates a mixture of 48× sample + PCR wells, with 48× primer mixes (1769 of amplicons in total, see ), ending up with 2304 nanoliter reactions, which are later harvested to each sample's inlets (48 reactions to a single well).

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: Tagmented DNA was purified using ChIP DNA clean and concentrator columns (ZymoResearch). .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers.

    Plasmid Preparation:

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: Plasmid DNA from 96 colonies per sample was sequenced by Genewiz, Inc. using an M13 reverse primer. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    Software:

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: Analysis of indel rates was done with the Geneious Software package (Biomatters, https://www.geneious.com ). .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers. .. Reads were aligned to hg19 with Bowtie software (Johns Hopkins University) with the parameter –m 1.

    Multiplex Assay:

    Article Title: The RNA interactome of human telomerase RNA reveals a coding-independent role for a histone mRNA in telomere homeostasis
    Article Snippet: .. Samples were enriched by PCR using NEBNext Ultra II Q5 master mix (New England Biolabs) with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (New England Biolabs). .. PCR conditions were as follows: 98°C for 30 s, 4 cycles of (98°C for 10 s – 67°C for 30 s – 72°C for 30 s), and a variable number of cycles of (98°C for 10 s – 72°C for 30 s).

    Selection:

    Article Title: Candida albicans gains azole resistance by altering sphingolipid composition
    Article Snippet: The second round of PCR was performed using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544L) to add sequences required for Illumina sequencing with an Illumina flowcell attachment primer, TruPBseq and partial Tn5 adaptor primer, Illumina-R. Cycling conditions are: 1 min at 98 °C; 7 cycles of 10 s at 98 °C, 75 s at 67 °C; 5 min at 67 °C; 4 °C forever. .. The size selection and purification of the PCR products were carried out with AMPure XP beads (Beckman Coulter, A63882).

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template. .. The PCR product was purified using (0.9×) Agencourt AMPure XP beads (Beckman Coulter Agencourt AMPure XP - PCR Purification #A63882) as per the manufacturer’s protocol followed by size 300-1200 bp size selection on the BluePippin (Sage Science, Beverly, MA) and loaded on the Illumina MiSeq with 10% phiX.

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human
    Article Snippet: PCR was performed using custom HPLC-purified primers (F: 5′-TAGAGCATGCACCGGCAAGCAGAAGACGGCATACGAGATNNNNATGTCTCGTGGGCTCGGAGATGT-3′, R : 5′-GGCCGAATTCGTCGATCGTCGGCAGCGTCAGATGTG-3′, where NNNN corresponds to a random 4 nt i7 barcode sequence) and NEBNext Ultra II Q5 DNA polymerase master mix (NEB #M0544L). .. Size selection of ATAC-seq fragments was performed by gel excision using a razor blade to select fragments between 150–500 nt.

    Sample Prep:

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: In brief, after lysis cells were spun for 30 min at 300 g and ‘tagmentation’ (transposase-based fragmentation) was performed for 1 h at 37°C with the Nextera DNA Sample Preparation Kit (Illumina). .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers.

    Ethanol Precipitation:

    Article Title: Maternal Eed knockout causes loss of H3K27me3 imprinting and random X inactivation in the extraembryonic cells
    Article Snippet: DNA was then precipitated by phenol/chloroform/isoamylalcohol followed by ethanol precipitation with glycogen and then dissolved in water. .. After adaptor ligation for 30 min at 20°C, the DNA fragments were purified by 1.8× vol of SPRIselect beads (Beckman Coulter) followed by 16 cycles of PCR amplification with NEBNext Ultra II Q5 master mix (New England Biolabs).

    Next-Generation Sequencing:

    Article Title: Candida albicans gains azole resistance by altering sphingolipid composition
    Article Snippet: Paragraph title: Mapping PB insertion sites by next-generation sequencing ... The second round of PCR was performed using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544L) to add sequences required for Illumina sequencing with an Illumina flowcell attachment primer, TruPBseq and partial Tn5 adaptor primer, Illumina-R. Cycling conditions are: 1 min at 98 °C; 7 cycles of 10 s at 98 °C, 75 s at 67 °C; 5 min at 67 °C; 4 °C forever.

    Article Title: Fragmentation Through Polymerization (FTP): A new method to fragment DNA for next-generation sequencing
    Article Snippet: Paragraph title: Preparation of NGS libraries ... The conventional procedure for Fragmentase-digested DNA included repair of DNA ends with the NEBNext Ultra II End Prep Enzyme Mix, addition of adapters to the DNA fragments using NEBNext Ultra II Ligation Master Mix, and amplification of the adaptor-ligated DNA fragments with the NEBNext Ultra II Q5 Master Mix.

    DNA Purification:

    Article Title: Candida albicans gains azole resistance by altering sphingolipid composition
    Article Snippet: The GMM plate was incubated at 30 °C for 2 days before collecting the cells for the extraction of genomic DNA using the MasterPure Yeast DNA Purification Kit. .. The second round of PCR was performed using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544L) to add sequences required for Illumina sequencing with an Illumina flowcell attachment primer, TruPBseq and partial Tn5 adaptor primer, Illumina-R. Cycling conditions are: 1 min at 98 °C; 7 cycles of 10 s at 98 °C, 75 s at 67 °C; 5 min at 67 °C; 4 °C forever.

    Lysis:

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: In brief, after lysis cells were spun for 30 min at 300 g and ‘tagmentation’ (transposase-based fragmentation) was performed for 1 h at 37°C with the Nextera DNA Sample Preparation Kit (Illumina). .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers.

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human
    Article Snippet: Initial steps of ATAC-seq (cell collection, lysis, and Tn5 digestion) followed the protocol in Buenrostro et al. : each batch of 50,000 cells was collected by spinning at 500 g for 5 min in a 4 °C cold room, washed with 50 µL of 1X PBS, and resuspended in ATAC-seq lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 , 0.1% IGEPAL CA−630); a pellet was collected by spinning at 500 g for 10 min, and was resuspended in 25 µL of TD buffer (Illumina #FC-121–1030), 2.5 µL Tn5 transposase (Illumina #FC-121–1030), and 22.5 µL of dH2 O; the transposition reaction proceeded for 30 min at 37 °C on a shaker (300 rpm). .. PCR was performed using custom HPLC-purified primers (F: 5′-TAGAGCATGCACCGGCAAGCAGAAGACGGCATACGAGATNNNNATGTCTCGTGGGCTCGGAGATGT-3′, R : 5′-GGCCGAATTCGTCGATCGTCGGCAGCGTCAGATGTG-3′, where NNNN corresponds to a random 4 nt i7 barcode sequence) and NEBNext Ultra II Q5 DNA polymerase master mix (NEB #M0544L).

    Gel Extraction:

    Article Title: High-resolution genome-wide functional dissection of transcriptional regulatory regions and nucleotides in human
    Article Snippet: PCR was performed using custom HPLC-purified primers (F: 5′-TAGAGCATGCACCGGCAAGCAGAAGACGGCATACGAGATNNNNATGTCTCGTGGGCTCGGAGATGT-3′, R : 5′-GGCCGAATTCGTCGATCGTCGGCAGCGTCAGATGTG-3′, where NNNN corresponds to a random 4 nt i7 barcode sequence) and NEBNext Ultra II Q5 DNA polymerase master mix (NEB #M0544L). .. Gel slabs were pooled into < 300 mg groups and DNA was purified using a MinElute Gel Extraction kit (Qiagen #28604), and eluted in 20 µL of buffer EB per column following modified guidelines described in Box 2 of Taiwo et al. .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs ultra ii q5 master mix
    Ultra Ii Q5 Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ultra ii q5 master mix/product/New England Biolabs
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    ultra ii q5 master mix - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results