ultra ii q5 master mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    NEBNext Ultra II Q5 Master Mix
    Description:
    NEBNext Ultra II Q5 Master Mix 250 rxns
    Catalog Number:
    M0544L
    Price:
    395
    Size:
    250 rxns
    Category:
    Thermostable DNA Polymerases
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs ultra ii q5 master mix
    NEBNext Ultra II Q5 Master Mix
    NEBNext Ultra II Q5 Master Mix 250 rxns
    https://www.bioz.com/result/ultra ii q5 master mix/product/New England Biolabs
    Average 98 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    ultra ii q5 master mix - by Bioz Stars, 2019-10
    98/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Generation of a rod-specific NRL reporter line in human pluripotent stem cells
    Article Snippet: Amplification was carried out using 2 × Q5 PCR master mix (NEB) and two different primer pairs: (1) left junction primers (red arrows in Fig. ; forward: 5′-TGTTACAAAGTCTAACTGCCC-3′; reverse: 5′-GGTGGTGCAGATGAACTTCAGG-3′) that predict an amplicon of 986 bp for a targeted NRL allele and no amplification of an unedited, wildtype NRL allele, and 2) homology arm primers (blue arrows in Fig. ; forward: 5′-CACCATCCCTCTGGCTTTCC-3′; reverse: 5′-GCAGGGTAGCCAGCCAGTAC-3′) that predict (1) a sole amplicon of 295 bp in an unedited line, (2) two amplicons of 295 bp and 3.2 kb in a targeted NRL +/eGFP clone retaining the PuroR cassette (NRL -eGFP +PuroR ), and (3) two amplicons of 295 bp and 2.1 kb in a targeted NRL +/eGFP clone following successful excision of the PuroR cassette (NRL -eGFP − PuroR ). .. PCR cycling conditions were as follows: 30 s at 98 °C (initial denaturation), then 35 cycles of 10 s at 98 °C (denaturation), 20 s at 63 °C (annealing) and 60 s at 72 °C (extension), followed by 2 min at 72 °C (final extension), with the exception that the extension time was increased to 90 s for reactions using the homology arm primers.

    Article Title: Generation of a rod-specific NRL reporter line in human pluripotent stem cells
    Article Snippet: Amplification was carried out using 2 × Q5 PCR master mix (NEB) and two different primer pairs: (1) left junction primers (red arrows in Fig. ; forward: 5′-TGTTACAAAGTCTAACTGCCC-3′; reverse: 5′-GGTGGTGCAGATGAACTTCAGG-3′) that predict an amplicon of 986 bp for a targeted NRL allele and no amplification of an unedited, wildtype NRL allele, and 2) homology arm primers (blue arrows in Fig. ; forward: 5′-CACCATCCCTCTGGCTTTCC-3′; reverse: 5′-GCAGGGTAGCCAGCCAGTAC-3′) that predict (1) a sole amplicon of 295 bp in an unedited line, (2) two amplicons of 295 bp and 3.2 kb in a targeted NRL +/eGFP clone retaining the PuroR cassette ( NRL - eGFP + PuroR ), and (3) two amplicons of 295 bp and 2.1 kb in a targeted NRL +/eGFP clone following successful excision of the PuroR cassette ( NRL - eGFP − PuroR ). .. PCR cycling conditions were as follows: 30 s at 98 °C (initial denaturation), then 35 cycles of 10 s at 98 °C (denaturation), 20 s at 63 °C (annealing) and 60 s at 72 °C (extension), followed by 2 min at 72 °C (final extension), with the exception that the extension time was increased to 90 s for reactions using the homology arm primers.

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: The amplified locus fragments were then cloned into pCR4-TOPO vectors using the ZeroBlunt TOPO Cloning Kit (Life Technologies Zero Blunt TOPO PCR Cloning Kit for Sequencing with One Shot TOP10 Chemically Competent E. coli #K287540) and transformed in One Shot Top10 chemically competent Escherichia coli cells. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    Amplification:

    Article Title: Generation of a rod-specific NRL reporter line in human pluripotent stem cells
    Article Snippet: Genomic DNA was isolated from OVs using QuickExtract DNA extraction solution 1.0 (Epicentre). .. Amplification was carried out using 2 × Q5 PCR master mix (NEB) and two different primer pairs: (1) left junction primers (red arrows in Fig. ; forward: 5′-TGTTACAAAGTCTAACTGCCC-3′; reverse: 5′-GGTGGTGCAGATGAACTTCAGG-3′) that predict an amplicon of 986 bp for a targeted NRL allele and no amplification of an unedited, wildtype NRL allele, and 2) homology arm primers (blue arrows in Fig. ; forward: 5′-CACCATCCCTCTGGCTTTCC-3′; reverse: 5′-GCAGGGTAGCCAGCCAGTAC-3′) that predict (1) a sole amplicon of 295 bp in an unedited line, (2) two amplicons of 295 bp and 3.2 kb in a targeted NRL +/eGFP clone retaining the PuroR cassette (NRL -eGFP +PuroR ), and (3) two amplicons of 295 bp and 2.1 kb in a targeted NRL +/eGFP clone following successful excision of the PuroR cassette (NRL -eGFP − PuroR ). .. PCR cycling conditions were as follows: 30 s at 98 °C (initial denaturation), then 35 cycles of 10 s at 98 °C (denaturation), 20 s at 63 °C (annealing) and 60 s at 72 °C (extension), followed by 2 min at 72 °C (final extension), with the exception that the extension time was increased to 90 s for reactions using the homology arm primers.

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: Amplicon libraries were prepared using 200 ng of each PCR product and the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® with dual indexing (barcoding). .. The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina.

    Article Title: Maize Phyllosphere Microbial Community Niche Development Across Stages of Host Leaf Growth
    Article Snippet: Paragraph title: Ribosomal spacer amplification and separation (ARISA) ... For the initial PCR step, a master mix was made to include: Q5 master mix (New England Biolabs, Ipswich, MA), ITSF primer (5’-GTCGTAACAAGGTAGCCGTA-3’), LD primer (5’-CCGGGTTTCCCCATTCGG-3’), and nuclease-free ultrapure water.

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs). .. The PCR protocol consisted of an initial denaturalization step at 98 °C during 30 sec followed by 8–9 cycles of 98 °C during 10 s and 65 °C during 1:30 min.

    Article Title: Generation of a rod-specific NRL reporter line in human pluripotent stem cells
    Article Snippet: Genomic DNA was isolated from OVs using QuickExtract DNA extraction solution 1.0 (Epicentre). .. Amplification was carried out using 2 × Q5 PCR master mix (NEB) and two different primer pairs: (1) left junction primers (red arrows in Fig. ; forward: 5′-TGTTACAAAGTCTAACTGCCC-3′; reverse: 5′-GGTGGTGCAGATGAACTTCAGG-3′) that predict an amplicon of 986 bp for a targeted NRL allele and no amplification of an unedited, wildtype NRL allele, and 2) homology arm primers (blue arrows in Fig. ; forward: 5′-CACCATCCCTCTGGCTTTCC-3′; reverse: 5′-GCAGGGTAGCCAGCCAGTAC-3′) that predict (1) a sole amplicon of 295 bp in an unedited line, (2) two amplicons of 295 bp and 3.2 kb in a targeted NRL +/eGFP clone retaining the PuroR cassette ( NRL - eGFP + PuroR ), and (3) two amplicons of 295 bp and 2.1 kb in a targeted NRL +/eGFP clone following successful excision of the PuroR cassette ( NRL - eGFP − PuroR ). .. PCR cycling conditions were as follows: 30 s at 98 °C (initial denaturation), then 35 cycles of 10 s at 98 °C (denaturation), 20 s at 63 °C (annealing) and 60 s at 72 °C (extension), followed by 2 min at 72 °C (final extension), with the exception that the extension time was increased to 90 s for reactions using the homology arm primers.

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: After random primer cleanup with QIAquick PCR Purification Kit (Qiagen GmbH, Hilden, Germany), the bisulfite-converted dsDNA was amplified using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs, Ipswich, MA, USA). .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification. .. After 15 cycles of PCR and cleanup with QIAquick PCR Purification Kit, 0.5–1 μg of WGA products were typically recovered.

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: For Illumina amplicon sequencing, two rounds of amplification were performed: round 1 targets the TRAC region, and round 2 adds the full-length Illumina adapter sequence. .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: Tagmented DNA was purified using ChIP DNA clean and concentrator columns (ZymoResearch). .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers. .. The number of cycles was determined by quantitative PCR as described ( ).

    Whole Genome Amplification:

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: Paragraph title: Whole genome amplification of bisulfite converted DNA ... Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification.

    Incubation:

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: The ligation reaction was carried out in the presence of at least 100-fold excess of barcoded adapters during 15 min at 20 °C and then incubated overnight at 16 °C. .. Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs).

    Article Title: MULTIPLEXED ELIMINATION OF WILD-TYPE DNA AND HIGH RESOLUTION MELTING PRIOR TO TARGETED RESEQUENCING OF LIQUID BIOPSIES
    Article Snippet: The incubation was at 65°C for 20min followed by 95°C for 2 min. A No-treatment control sample with the same DNA input but without probes or DSN was run in parallel. .. The anchor-tail PCR product was purified with Agencourt® AMPure XP and 5μl of product were added into a final adaptor-PCR for library preparation using NEBNext® Ultra™ II Q5® Master Mix and NEBNext® Multiplex Oligos for Illumina (New England Biolabs).

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: Cells were plated on Carbenicillin LB agar plates and incubated overnight at 37 °C. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    Mass Spectrometry:

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: To examine application of MS-NaME on double-stranded DNA generated via whole genome amplification (WGA) of bisulfite converted DNA, 20 ng of bisulfite converted DNA was used. .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification.

    Modification:

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template. .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: A Freeloader? The Highly Eroded Yet Large Genome of the Serratia symbiotica Symbiont of Cinara strobi
    Article Snippet: For whole-genome sequencing, we prepared DNA samples enriched with bacteria from previously collected colony 3249 following a slightly modified version of the protocol by as described in . .. Ligation products were purified by Ampure XP (Beckman Coulter, USA) and DNA fragments ( > 200 bp) were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB).

    Filtration:

    Article Title: A Freeloader? The Highly Eroded Yet Large Genome of the Serratia symbiotica Symbiont of Cinara strobi
    Article Snippet: For this filtration protocol 15 aphids for one colony were pooled together. .. Ligation products were purified by Ampure XP (Beckman Coulter, USA) and DNA fragments ( > 200 bp) were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB).

    Transformation Assay:

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: The amplified locus fragments were then cloned into pCR4-TOPO vectors using the ZeroBlunt TOPO Cloning Kit (Life Technologies Zero Blunt TOPO PCR Cloning Kit for Sequencing with One Shot TOP10 Chemically Competent E. coli #K287540) and transformed in One Shot Top10 chemically competent Escherichia coli cells. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    Gas Chromatography:

    Article Title: Changes in the genetic requirements for microbial interactions with increasing community complexity
    Article Snippet: After gDNA extraction, the 98°C BarSeq PCR as described in was used to amplify only the barcoded region of the transposons. .. Briefly, PCR was performed in a final volume of 50 µL: 25 µL of Q5 polymerase master mix (New England Biolab), 10 µL of GC enhancer buffer (New England Biolab), 2.5 µL of the common reverse primer (BarSeq_P1 – ) at 10 µM, 2.5 µL of a forward primer from the 96 forward primers (BarSeq_P2_ITXXX) at 10 µM and 50 ng to 2 µg of gDNA. .. For each triplicate, the PCR was performed with the same forward primer so all replicates of a condition could be pooled and have the same sequencing multiplexing index.

    Ligation:

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: Amplicon libraries were prepared using 200 ng of each PCR product and the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® with dual indexing (barcoding). .. The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina. .. The final products were cleaned using Ampure XP beads and pooled into 2 batches of 80 samples.

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: The ligation reaction was cleaned with 0.8x volumes (76 µl) of Agencourt AMPure® XP magnetic beads (Beckman Coulter). .. Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs).

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: After random primer cleanup with QIAquick PCR Purification Kit (Qiagen GmbH, Hilden, Germany), the bisulfite-converted dsDNA was amplified using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs, Ipswich, MA, USA). .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification. .. After 15 cycles of PCR and cleanup with QIAquick PCR Purification Kit, 0.5–1 μg of WGA products were typically recovered.

    Article Title: A Freeloader? The Highly Eroded Yet Large Genome of the Serratia symbiotica Symbiont of Cinara strobi
    Article Snippet: Fragments were end-repaired, 3′-adenylated, and NEXTflex PCR free barcodes adapters (Bioo Scientific, USA) were added by using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, USA). .. Ligation products were purified by Ampure XP (Beckman Coulter, USA) and DNA fragments ( > 200 bp) were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). .. After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies, USA) and qPCR quantification using the KAPA Library Quantification Kit for Illumina Libraries (Kapa Biosystems, USA), the libraries were sequenced using 251 bp paired-end reads chemistry on a HiSeq2500 Illumina sequencer.

    Cell Culture:

    Article Title: Maize Phyllosphere Microbial Community Niche Development Across Stages of Host Leaf Growth
    Article Snippet: Two separate, nested PCR reactions were performed on experimental samples as described by Cardinaleet al. , along with four positive controls from a mixture of DNAs from cultured bacteria (Carlson, 2015) and four negative (nuclease-free water) controls. .. For the initial PCR step, a master mix was made to include: Q5 master mix (New England Biolabs, Ipswich, MA), ITSF primer (5’-GTCGTAACAAGGTAGCCGTA-3’), LD primer (5’-CCGGGTTTCCCCATTCGG-3’), and nuclease-free ultrapure water.

    Generated:

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina. .. The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina.

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: To examine application of MS-NaME on double-stranded DNA generated via whole genome amplification (WGA) of bisulfite converted DNA, 20 ng of bisulfite converted DNA was used. .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification.

    Sequencing:

    Article Title: MERIT reveals the impact of genomic context on sequencing error rate in ultra-deep applications
    Article Snippet: NEBNext® Ultra™ II Q5® master mix polymerase .. NEBNext® Ultra™ II Q5® master mix polymerase

    Article Title: The HDAC inhibitor valproate induces a bivalent status of the CD20 promoter in CLL patients suggesting distinct epigenetic regulation of CD20 expression in CLL in vivo
    Article Snippet: Paragraph title: NOTCH1 sequencing ... M0544S, New England Biolabs) and specific primers 5′-agatg atgagctaccagggc-3′ (forward), 5′- aaagtttctacctggggcca-3′ (reverse) according to the manufacturer's instruction.

    Article Title: Changes in the genetic requirements for microbial interactions with increasing community complexity
    Article Snippet: Paragraph title: Library preparation and sequencing ... Briefly, PCR was performed in a final volume of 50 µL: 25 µL of Q5 polymerase master mix (New England Biolab), 10 µL of GC enhancer buffer (New England Biolab), 2.5 µL of the common reverse primer (BarSeq_P1 – ) at 10 µM, 2.5 µL of a forward primer from the 96 forward primers (BarSeq_P2_ITXXX) at 10 µM and 50 ng to 2 µg of gDNA.

    Article Title: MULTIPLEXED ELIMINATION OF WILD-TYPE DNA AND HIGH RESOLUTION MELTING PRIOR TO TARGETED RESEQUENCING OF LIQUID BIOPSIES
    Article Snippet: The anchor-tail PCR product was purified with Agencourt® AMPure XP and 5μl of product were added into a final adaptor-PCR for library preparation using NEBNext® Ultra™ II Q5® Master Mix and NEBNext® Multiplex Oligos for Illumina (New England Biolabs). .. The PCR protocol followed is depicted in .

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: For Illumina amplicon sequencing, two rounds of amplification were performed: round 1 targets the TRAC region, and round 2 adds the full-length Illumina adapter sequence. .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: A Freeloader? The Highly Eroded Yet Large Genome of the Serratia symbiotica Symbiont of Cinara strobi
    Article Snippet: Paragraph title: Aphid Collection, DNA Extraction, and Sequencing ... Ligation products were purified by Ampure XP (Beckman Coulter, USA) and DNA fragments ( > 200 bp) were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB).

    Sonication:

    Article Title: A Freeloader? The Highly Eroded Yet Large Genome of the Serratia symbiotica Symbiont of Cinara strobi
    Article Snippet: Briefly, 5 ng of genomic DNA were sonicated using the E220 Covaris instrument (Covaris, USA). .. Ligation products were purified by Ampure XP (Beckman Coulter, USA) and DNA fragments ( > 200 bp) were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB).

    Multiplexing:

    Article Title: Changes in the genetic requirements for microbial interactions with increasing community complexity
    Article Snippet: Briefly, PCR was performed in a final volume of 50 µL: 25 µL of Q5 polymerase master mix (New England Biolab), 10 µL of GC enhancer buffer (New England Biolab), 2.5 µL of the common reverse primer (BarSeq_P1 – ) at 10 µM, 2.5 µL of a forward primer from the 96 forward primers (BarSeq_P2_ITXXX) at 10 µM and 50 ng to 2 µg of gDNA. .. Briefly, PCR was performed in a final volume of 50 µL: 25 µL of Q5 polymerase master mix (New England Biolab), 10 µL of GC enhancer buffer (New England Biolab), 2.5 µL of the common reverse primer (BarSeq_P1 – ) at 10 µM, 2.5 µL of a forward primer from the 96 forward primers (BarSeq_P2_ITXXX) at 10 µM and 50 ng to 2 µg of gDNA.

    Marker:

    Article Title: Maize Phyllosphere Microbial Community Niche Development Across Stages of Host Leaf Growth
    Article Snippet: For the initial PCR step, a master mix was made to include: Q5 master mix (New England Biolabs, Ipswich, MA), ITSF primer (5’-GTCGTAACAAGGTAGCCGTA-3’), LD primer (5’-CCGGGTTTCCCCATTCGG-3’), and nuclease-free ultrapure water. .. The samples and controls were then run on an iCycler (BioRad, Hercules, CA) PCR machine with the following settings: 1X 95C for 30 seconds, 35X (95C for 30 seconds; 61.5C for 30 seconds; 72C for 1 minute, 30 seconds), 1X 72C for 10 minutes.

    Magnetic Beads:

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: The ligation reaction was cleaned with 0.8x volumes (76 µl) of Agencourt AMPure® XP magnetic beads (Beckman Coulter). .. Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs).

    Mutagenesis:

    Article Title: MERIT reveals the impact of genomic context on sequencing error rate in ultra-deep applications
    Article Snippet: NEBNext® Ultra™ II Q5® master mix polymerase .. NEBNext® Ultra™ II Q5® master mix polymerase

    Isolation:

    Article Title: Generation of a rod-specific NRL reporter line in human pluripotent stem cells
    Article Snippet: Genomic DNA was isolated from OVs using QuickExtract DNA extraction solution 1.0 (Epicentre). .. Amplification was carried out using 2 × Q5 PCR master mix (NEB) and two different primer pairs: (1) left junction primers (red arrows in Fig. ; forward: 5′-TGTTACAAAGTCTAACTGCCC-3′; reverse: 5′-GGTGGTGCAGATGAACTTCAGG-3′) that predict an amplicon of 986 bp for a targeted NRL allele and no amplification of an unedited, wildtype NRL allele, and 2) homology arm primers (blue arrows in Fig. ; forward: 5′-CACCATCCCTCTGGCTTTCC-3′; reverse: 5′-GCAGGGTAGCCAGCCAGTAC-3′) that predict (1) a sole amplicon of 295 bp in an unedited line, (2) two amplicons of 295 bp and 3.2 kb in a targeted NRL +/eGFP clone retaining the PuroR cassette (NRL -eGFP +PuroR ), and (3) two amplicons of 295 bp and 2.1 kb in a targeted NRL +/eGFP clone following successful excision of the PuroR cassette (NRL -eGFP − PuroR ).

    Article Title: Generation of a rod-specific NRL reporter line in human pluripotent stem cells
    Article Snippet: Genomic DNA was isolated from OVs using QuickExtract DNA extraction solution 1.0 (Epicentre). .. Amplification was carried out using 2 × Q5 PCR master mix (NEB) and two different primer pairs: (1) left junction primers (red arrows in Fig. ; forward: 5′-TGTTACAAAGTCTAACTGCCC-3′; reverse: 5′-GGTGGTGCAGATGAACTTCAGG-3′) that predict an amplicon of 986 bp for a targeted NRL allele and no amplification of an unedited, wildtype NRL allele, and 2) homology arm primers (blue arrows in Fig. ; forward: 5′-CACCATCCCTCTGGCTTTCC-3′; reverse: 5′-GCAGGGTAGCCAGCCAGTAC-3′) that predict (1) a sole amplicon of 295 bp in an unedited line, (2) two amplicons of 295 bp and 3.2 kb in a targeted NRL +/eGFP clone retaining the PuroR cassette ( NRL - eGFP + PuroR ), and (3) two amplicons of 295 bp and 2.1 kb in a targeted NRL +/eGFP clone following successful excision of the PuroR cassette ( NRL - eGFP − PuroR ).

    Size-exclusion Chromatography:

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs). .. Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs).

    Purification:

    Article Title: Changes in the genetic requirements for microbial interactions with increasing community complexity
    Article Snippet: Briefly, PCR was performed in a final volume of 50 µL: 25 µL of Q5 polymerase master mix (New England Biolab), 10 µL of GC enhancer buffer (New England Biolab), 2.5 µL of the common reverse primer (BarSeq_P1 – ) at 10 µM, 2.5 µL of a forward primer from the 96 forward primers (BarSeq_P2_ITXXX) at 10 µM and 50 ng to 2 µg of gDNA. .. For P. psychrophila JB418 analysis, we performed 46 PCR (T0 sample and 45 harvest samples) involving 16 other multiplexing indexes.

    Article Title: MULTIPLEXED ELIMINATION OF WILD-TYPE DNA AND HIGH RESOLUTION MELTING PRIOR TO TARGETED RESEQUENCING OF LIQUID BIOPSIES
    Article Snippet: In addition, a high concentration (200nM) of the forward and reverse oligonucleotide tails is added to the same reaction. .. The anchor-tail PCR product was purified with Agencourt® AMPure XP and 5μl of product were added into a final adaptor-PCR for library preparation using NEBNext® Ultra™ II Q5® Master Mix and NEBNext® Multiplex Oligos for Illumina (New England Biolabs). .. The PCR protocol followed is depicted in .

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: After random primer cleanup with QIAquick PCR Purification Kit (Qiagen GmbH, Hilden, Germany), the bisulfite-converted dsDNA was amplified using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs, Ipswich, MA, USA). .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification.

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: The PCR product was purified using (0.9×) Agencourt AMPure XP beads (Beckman Coulter Agencourt AMPure XP - PCR Purification #A63882) as per the manufacturer’s protocol. .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: Tagmented DNA was purified using ChIP DNA clean and concentrator columns (ZymoResearch). .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers.

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    Article Title: A Freeloader? The Highly Eroded Yet Large Genome of the Serratia symbiotica Symbiont of Cinara strobi
    Article Snippet: Fragments were end-repaired, 3′-adenylated, and NEXTflex PCR free barcodes adapters (Bioo Scientific, USA) were added by using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, USA). .. Ligation products were purified by Ampure XP (Beckman Coulter, USA) and DNA fragments ( > 200 bp) were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). .. After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies, USA) and qPCR quantification using the KAPA Library Quantification Kit for Illumina Libraries (Kapa Biosystems, USA), the libraries were sequenced using 251 bp paired-end reads chemistry on a HiSeq2500 Illumina sequencer.

    Polymerase Chain Reaction:

    Article Title: Generation of a rod-specific NRL reporter line in human pluripotent stem cells
    Article Snippet: Genomic DNA was isolated from OVs using QuickExtract DNA extraction solution 1.0 (Epicentre). .. Amplification was carried out using 2 × Q5 PCR master mix (NEB) and two different primer pairs: (1) left junction primers (red arrows in Fig. ; forward: 5′-TGTTACAAAGTCTAACTGCCC-3′; reverse: 5′-GGTGGTGCAGATGAACTTCAGG-3′) that predict an amplicon of 986 bp for a targeted NRL allele and no amplification of an unedited, wildtype NRL allele, and 2) homology arm primers (blue arrows in Fig. ; forward: 5′-CACCATCCCTCTGGCTTTCC-3′; reverse: 5′-GCAGGGTAGCCAGCCAGTAC-3′) that predict (1) a sole amplicon of 295 bp in an unedited line, (2) two amplicons of 295 bp and 3.2 kb in a targeted NRL +/eGFP clone retaining the PuroR cassette (NRL -eGFP +PuroR ), and (3) two amplicons of 295 bp and 2.1 kb in a targeted NRL +/eGFP clone following successful excision of the PuroR cassette (NRL -eGFP − PuroR ). .. PCR cycling conditions were as follows: 30 s at 98 °C (initial denaturation), then 35 cycles of 10 s at 98 °C (denaturation), 20 s at 63 °C (annealing) and 60 s at 72 °C (extension), followed by 2 min at 72 °C (final extension), with the exception that the extension time was increased to 90 s for reactions using the homology arm primers.

    Article Title: MERIT reveals the impact of genomic context on sequencing error rate in ultra-deep applications
    Article Snippet: NEBNext® Ultra™ II Q5® master mix polymerase .. NEBNext® Ultra™ II Q5® master mix polymerase

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: Amplicon libraries were prepared using 200 ng of each PCR product and the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® with dual indexing (barcoding). .. The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina. .. The final products were cleaned using Ampure XP beads and pooled into 2 batches of 80 samples.

    Article Title: Maize Phyllosphere Microbial Community Niche Development Across Stages of Host Leaf Growth
    Article Snippet: Two separate, nested PCR reactions were performed on experimental samples as described by Cardinaleet al. , along with four positive controls from a mixture of DNAs from cultured bacteria (Carlson, 2015) and four negative (nuclease-free water) controls. .. For the initial PCR step, a master mix was made to include: Q5 master mix (New England Biolabs, Ipswich, MA), ITSF primer (5’-GTCGTAACAAGGTAGCCGTA-3’), LD primer (5’-CCGGGTTTCCCCATTCGG-3’), and nuclease-free ultrapure water. .. Ten microliters of master mix was added to sterile PCR tubes followed by experimental and sample controls.

    Article Title: The HDAC inhibitor valproate induces a bivalent status of the CD20 promoter in CLL patients suggesting distinct epigenetic regulation of CD20 expression in CLL in vivo
    Article Snippet: PCR products were obtained using the NEBNext Ultra II Q5 Master Mix (cat.no. .. M0544S, New England Biolabs) and specific primers 5′-agatg atgagctaccagggc-3′ (forward), 5′- aaagtttctacctggggcca-3′ (reverse) according to the manufacturer's instruction.

    Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
    Article Snippet: This strategy has been suggested to improve the removal of adapter dimers . .. Ligated cfDNA products were eluted in 25 µl of 10 mM Tris-HCl pH = 8.0 and mixed with 5 µl of indexed PCR primers at 10 µM each and 30 µl of NEBNext Ultra II Q5 Master Mix (New England BioLabs). .. The sequences of our PCR primers, suitable for dual-indexing in Illumina platforms, are: 5′-CAAGCAGAAGACGGCATACGAGAT NNNNNN GTGACTGGAGTT3′ and 5′-AATGATACGGCGACCACCGAGATCTACAC NNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′.

    Article Title: Changes in the genetic requirements for microbial interactions with increasing community complexity
    Article Snippet: After gDNA extraction, the 98°C BarSeq PCR as described in was used to amplify only the barcoded region of the transposons. .. Briefly, PCR was performed in a final volume of 50 µL: 25 µL of Q5 polymerase master mix (New England Biolab), 10 µL of GC enhancer buffer (New England Biolab), 2.5 µL of the common reverse primer (BarSeq_P1 – ) at 10 µM, 2.5 µL of a forward primer from the 96 forward primers (BarSeq_P2_ITXXX) at 10 µM and 50 ng to 2 µg of gDNA. .. For each triplicate, the PCR was performed with the same forward primer so all replicates of a condition could be pooled and have the same sequencing multiplexing index.

    Article Title: Generation of a rod-specific NRL reporter line in human pluripotent stem cells
    Article Snippet: Genomic DNA was isolated from OVs using QuickExtract DNA extraction solution 1.0 (Epicentre). .. Amplification was carried out using 2 × Q5 PCR master mix (NEB) and two different primer pairs: (1) left junction primers (red arrows in Fig. ; forward: 5′-TGTTACAAAGTCTAACTGCCC-3′; reverse: 5′-GGTGGTGCAGATGAACTTCAGG-3′) that predict an amplicon of 986 bp for a targeted NRL allele and no amplification of an unedited, wildtype NRL allele, and 2) homology arm primers (blue arrows in Fig. ; forward: 5′-CACCATCCCTCTGGCTTTCC-3′; reverse: 5′-GCAGGGTAGCCAGCCAGTAC-3′) that predict (1) a sole amplicon of 295 bp in an unedited line, (2) two amplicons of 295 bp and 3.2 kb in a targeted NRL +/eGFP clone retaining the PuroR cassette ( NRL - eGFP + PuroR ), and (3) two amplicons of 295 bp and 2.1 kb in a targeted NRL +/eGFP clone following successful excision of the PuroR cassette ( NRL - eGFP − PuroR ). .. PCR cycling conditions were as follows: 30 s at 98 °C (initial denaturation), then 35 cycles of 10 s at 98 °C (denaturation), 20 s at 63 °C (annealing) and 60 s at 72 °C (extension), followed by 2 min at 72 °C (final extension), with the exception that the extension time was increased to 90 s for reactions using the homology arm primers.

    Article Title: MULTIPLEXED ELIMINATION OF WILD-TYPE DNA AND HIGH RESOLUTION MELTING PRIOR TO TARGETED RESEQUENCING OF LIQUID BIOPSIES
    Article Snippet: In addition, a high concentration (200nM) of the forward and reverse oligonucleotide tails is added to the same reaction. .. The anchor-tail PCR product was purified with Agencourt® AMPure XP and 5μl of product were added into a final adaptor-PCR for library preparation using NEBNext® Ultra™ II Q5® Master Mix and NEBNext® Multiplex Oligos for Illumina (New England Biolabs). .. The PCR protocol followed is depicted in .

    Article Title: Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease
    Article Snippet: After random primer cleanup with QIAquick PCR Purification Kit (Qiagen GmbH, Hilden, Germany), the bisulfite-converted dsDNA was amplified using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs, Ipswich, MA, USA). .. Amplification was performed according to the manufacturer's instructions with the following modifications: (i) NEBNext Adaptor for Illumina was treated with USER enzyme (New England Biolabs) and then re-annealed before adaptor ligation; (ii) KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (KAPA Biosystems, Boston, MA, USA) was used instead of NEBNext Ultra II Q5 Master Mix for PCR amplification. .. After 15 cycles of PCR and cleanup with QIAquick PCR Purification Kit, 0.5–1 μg of WGA products were typically recovered.

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: The PCR product was purified using (0.9×) Agencourt AMPure XP beads (Beckman Coulter Agencourt AMPure XP - PCR Purification #A63882) as per the manufacturer’s protocol. .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: Tagmented DNA was purified using ChIP DNA clean and concentrator columns (ZymoResearch). .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers. .. The number of cycles was determined by quantitative PCR as described ( ).

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: The amplified locus fragments were then cloned into pCR4-TOPO vectors using the ZeroBlunt TOPO Cloning Kit (Life Technologies Zero Blunt TOPO PCR Cloning Kit for Sequencing with One Shot TOP10 Chemically Competent E. coli #K287540) and transformed in One Shot Top10 chemically competent Escherichia coli cells. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    Article Title: A Freeloader? The Highly Eroded Yet Large Genome of the Serratia symbiotica Symbiont of Cinara strobi
    Article Snippet: Fragments were end-repaired, 3′-adenylated, and NEXTflex PCR free barcodes adapters (Bioo Scientific, USA) were added by using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, USA). .. Ligation products were purified by Ampure XP (Beckman Coulter, USA) and DNA fragments ( > 200 bp) were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). .. After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies, USA) and qPCR quantification using the KAPA Library Quantification Kit for Illumina Libraries (Kapa Biosystems, USA), the libraries were sequenced using 251 bp paired-end reads chemistry on a HiSeq2500 Illumina sequencer.

    Nested PCR:

    Article Title: Maize Phyllosphere Microbial Community Niche Development Across Stages of Host Leaf Growth
    Article Snippet: Two separate, nested PCR reactions were performed on experimental samples as described by Cardinaleet al. , along with four positive controls from a mixture of DNAs from cultured bacteria (Carlson, 2015) and four negative (nuclease-free water) controls. .. For the initial PCR step, a master mix was made to include: Q5 master mix (New England Biolabs, Ipswich, MA), ITSF primer (5’-GTCGTAACAAGGTAGCCGTA-3’), LD primer (5’-CCGGGTTTCCCCATTCGG-3’), and nuclease-free ultrapure water.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: The HDAC inhibitor valproate induces a bivalent status of the CD20 promoter in CLL patients suggesting distinct epigenetic regulation of CD20 expression in CLL in vivo
    Article Snippet: PCR products were obtained using the NEBNext Ultra II Q5 Master Mix (cat.no. .. M0544S, New England Biolabs) and specific primers 5′-agatg atgagctaccagggc-3′ (forward), 5′- aaagtttctacctggggcca-3′ (reverse) according to the manufacturer's instruction.

    Chromatin Immunoprecipitation:

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: Tagmented DNA was purified using ChIP DNA clean and concentrator columns (ZymoResearch). .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers.

    Plasmid Preparation:

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: Plasmid DNA from 96 colonies per sample was sequenced by Genewiz, Inc. using an M13 reverse primer. .. Round 1 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.125 μM forward primer (OLI4610), 0.125 μM reverse primer (OLI4611), and 20 ng of gDNA template.

    Software:

    Article Title: Maize Phyllosphere Microbial Community Niche Development Across Stages of Host Leaf Growth
    Article Snippet: For the initial PCR step, a master mix was made to include: Q5 master mix (New England Biolabs, Ipswich, MA), ITSF primer (5’-GTCGTAACAAGGTAGCCGTA-3’), LD primer (5’-CCGGGTTTCCCCATTCGG-3’), and nuclease-free ultrapure water. .. For the second PCR step, a second master mix was made with the following: Q5 master mix, ITSreub primer (5’-GCCAAGGCATCCACC-3’), which contained a fluorescent HEX marker for fragment analysis in a Genetic Analyzer, SD primer (5’-TGCGGCTGGATCCCCTCCTT-3’), and nuclease-free water.

    Article Title: MULTIPLEXED ELIMINATION OF WILD-TYPE DNA AND HIGH RESOLUTION MELTING PRIOR TO TARGETED RESEQUENCING OF LIQUID BIOPSIES
    Article Snippet: The anchor-tail PCR product was purified with Agencourt® AMPure XP and 5μl of product were added into a final adaptor-PCR for library preparation using NEBNext® Ultra™ II Q5® Master Mix and NEBNext® Multiplex Oligos for Illumina (New England Biolabs). .. Libraries with ligated Illumina adapters were assessed for DNA quality and quantity on Agilent bio-analyzer, and then pooled together into a single tube prior to MiSeq sequencing.

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: Analysis of indel rates was done with the Geneious Software package (Biomatters, https://www.geneious.com ). .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers. .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers.

    Multiplex Assay:

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: Amplicon libraries were prepared using 200 ng of each PCR product and the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® with dual indexing (barcoding). .. The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina. .. The final products were cleaned using Ampure XP beads and pooled into 2 batches of 80 samples.

    Article Title: MULTIPLEXED ELIMINATION OF WILD-TYPE DNA AND HIGH RESOLUTION MELTING PRIOR TO TARGETED RESEQUENCING OF LIQUID BIOPSIES
    Article Snippet: In addition, a high concentration (200nM) of the forward and reverse oligonucleotide tails is added to the same reaction. .. The anchor-tail PCR product was purified with Agencourt® AMPure XP and 5μl of product were added into a final adaptor-PCR for library preparation using NEBNext® Ultra™ II Q5® Master Mix and NEBNext® Multiplex Oligos for Illumina (New England Biolabs). .. The PCR protocol followed is depicted in .

    Selection:

    Article Title: UDiTaS™, a genome editing detection method for indels and genome rearrangements
    Article Snippet: Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template. .. Round 2 was performed in a 12 μl reaction volume, consisting of 6 μL of NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs), 0.5 μM forward primer (Illumina forward), 0.5 μM reverse primer (Illumina reverse), and 20 ng of gDNA template.

    Sample Prep:

    Article Title: MULTIPLEXED ELIMINATION OF WILD-TYPE DNA AND HIGH RESOLUTION MELTING PRIOR TO TARGETED RESEQUENCING OF LIQUID BIOPSIES
    Article Snippet: Paragraph title: Targeted re-sequencing (MiSeq) sample preparation using nested multiplexed anchor-tail PCR reactions ... The anchor-tail PCR product was purified with Agencourt® AMPure XP and 5μl of product were added into a final adaptor-PCR for library preparation using NEBNext® Ultra™ II Q5® Master Mix and NEBNext® Multiplex Oligos for Illumina (New England Biolabs).

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: In brief, after lysis cells were spun for 30 min at 300 g and ‘tagmentation’ (transposase-based fragmentation) was performed for 1 h at 37°C with the Nextera DNA Sample Preparation Kit (Illumina). .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers.

    Next-Generation Sequencing:

    Article Title: Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes, et al. Flower preferences and pollen transport networks for cavity‐nesting solitary bees: Implications for the design of agri‐environment schemes
    Article Snippet: Paragraph title: Next generation sequencing of pollen sample DNA ... The products were end repaired and “A” tailed using the NEBNext End Prep module, NEBNext adaptors were ligated onto the amplicons using the NEB Adaptor Ligation Module and dual indexes incorporated during the PCR enrichment step using NEBNext Ultra ll Q5 Master Mix and NEB Next Multiplex Oligos for Illumina.

    DNA Extraction:

    Article Title: Generation of a rod-specific NRL reporter line in human pluripotent stem cells
    Article Snippet: Genomic DNA was isolated from OVs using QuickExtract DNA extraction solution 1.0 (Epicentre). .. Amplification was carried out using 2 × Q5 PCR master mix (NEB) and two different primer pairs: (1) left junction primers (red arrows in Fig. ; forward: 5′-TGTTACAAAGTCTAACTGCCC-3′; reverse: 5′-GGTGGTGCAGATGAACTTCAGG-3′) that predict an amplicon of 986 bp for a targeted NRL allele and no amplification of an unedited, wildtype NRL allele, and 2) homology arm primers (blue arrows in Fig. ; forward: 5′-CACCATCCCTCTGGCTTTCC-3′; reverse: 5′-GCAGGGTAGCCAGCCAGTAC-3′) that predict (1) a sole amplicon of 295 bp in an unedited line, (2) two amplicons of 295 bp and 3.2 kb in a targeted NRL +/eGFP clone retaining the PuroR cassette (NRL -eGFP +PuroR ), and (3) two amplicons of 295 bp and 2.1 kb in a targeted NRL +/eGFP clone following successful excision of the PuroR cassette (NRL -eGFP − PuroR ).

    Article Title: Generation of a rod-specific NRL reporter line in human pluripotent stem cells
    Article Snippet: Genomic DNA was isolated from OVs using QuickExtract DNA extraction solution 1.0 (Epicentre). .. Amplification was carried out using 2 × Q5 PCR master mix (NEB) and two different primer pairs: (1) left junction primers (red arrows in Fig. ; forward: 5′-TGTTACAAAGTCTAACTGCCC-3′; reverse: 5′-GGTGGTGCAGATGAACTTCAGG-3′) that predict an amplicon of 986 bp for a targeted NRL allele and no amplification of an unedited, wildtype NRL allele, and 2) homology arm primers (blue arrows in Fig. ; forward: 5′-CACCATCCCTCTGGCTTTCC-3′; reverse: 5′-GCAGGGTAGCCAGCCAGTAC-3′) that predict (1) a sole amplicon of 295 bp in an unedited line, (2) two amplicons of 295 bp and 3.2 kb in a targeted NRL +/eGFP clone retaining the PuroR cassette ( NRL - eGFP + PuroR ), and (3) two amplicons of 295 bp and 2.1 kb in a targeted NRL +/eGFP clone following successful excision of the PuroR cassette ( NRL - eGFP − PuroR ).

    Article Title: A Freeloader? The Highly Eroded Yet Large Genome of the Serratia symbiotica Symbiont of Cinara strobi
    Article Snippet: Paragraph title: Aphid Collection, DNA Extraction, and Sequencing ... Ligation products were purified by Ampure XP (Beckman Coulter, USA) and DNA fragments ( > 200 bp) were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB).

    Concentration Assay:

    Article Title: MULTIPLEXED ELIMINATION OF WILD-TYPE DNA AND HIGH RESOLUTION MELTING PRIOR TO TARGETED RESEQUENCING OF LIQUID BIOPSIES
    Article Snippet: The anchor-tail PCR product was purified with Agencourt® AMPure XP and 5μl of product were added into a final adaptor-PCR for library preparation using NEBNext® Ultra™ II Q5® Master Mix and NEBNext® Multiplex Oligos for Illumina (New England Biolabs). .. The anchor-tail PCR product was purified with Agencourt® AMPure XP and 5μl of product were added into a final adaptor-PCR for library preparation using NEBNext® Ultra™ II Q5® Master Mix and NEBNext® Multiplex Oligos for Illumina (New England Biolabs).

    High Throughput Screening Assay:

    Article Title: MERIT reveals the impact of genomic context on sequencing error rate in ultra-deep applications
    Article Snippet: NEBNext® Ultra™ II Q5® master mix polymerase .. NEBNext® Ultra™ II Q5® master mix polymerase

    Lysis:

    Article Title: Designer epigenome modifiers enable robust and sustained gene silencing in clinically relevant human cells
    Article Snippet: In brief, after lysis cells were spun for 30 min at 300 g and ‘tagmentation’ (transposase-based fragmentation) was performed for 1 h at 37°C with the Nextera DNA Sample Preparation Kit (Illumina). .. Library fragments were amplified with NEBNext Ultra II Q5 Master Mix and custom Nextera PCR primers.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars

  • 96
    New England Biolabs ultra ii q5 master mix
    Ultra Ii Q5 Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ultra ii q5 master mix/product/New England Biolabs
    Average 96 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    ultra ii q5 master mix - by Bioz Stars, 2019-10
    96/100 stars
      Buy from Supplier

    Image Search Results